library(tidyverse)
## -- Attaching packages ------------------------------------------------------------------------- tidyverse 1.2.1 --
## v ggplot2 3.0.0     v purrr   0.2.5
## v tibble  1.4.2     v dplyr   0.7.6
## v tidyr   0.8.1     v stringr 1.3.1
## v readr   1.1.1     v forcats 0.3.0
## -- Conflicts ---------------------------------------------------------------------------- tidyverse_conflicts() --
## x dplyr::filter() masks stats::filter()
## x dplyr::lag()    masks stats::lag()

Background and Overview

DataCamp offer interactive courses related to R Programming. While some is review, it is helpful to see other perspectives on material. As well, DataCamp has some interesting materials on packages that I want to learn better (ggplot2, dplyr, ggvis, etc.). This document summarizes a few key insights from:

This document is currently split between _v003 and _v003_a and _v003_b and _v003_c due to the need to keep the number of DLL that it opens below the hard-coded maximum. This introductory section needs to be re-written, and the contents consolidated, at a future date.

The original DataCamp_Insights_v001 and DataCamp_Insights_v002 documents have been split for this document:


Hierarchical and Mixed Effects Models

Chapter 1 - Overview and Introduction

What is a hierarchical model?

  • Hierarchical data is nested within itself, and can be analyzed using the lme package
    • Example of students in a classroom - may not all be independent of each other due to teacher quality, building conditions, etc.
    • Hierarchical models can help with pooling means across small sample sizes
    • Repeated measurements (test scores each year) are also a common example of data that are not truly independent
  • Hierarchical models can include nested models and multi-level models
  • Regression frameworks can include pool information and random effects (vs. fixed effects) and mixed-effects and linear mixed-effects
  • Repeated sampling can have repeated measures modeling

Parts of a regression:

  • Linear regression and linear model can be used interchangeably for this course - epsilon is the error term, assumed to be normal with zero mean and constant variance
  • The linear model in R is closely related to analysis of variance (ANOVA)
    • lm (y ~ x, myData)
    • anova( lm (y ~ x, myData) )
  • The most basic regression has an intercept, a slope, a single predictor, and an error term
    • The concept can be extended to multiple regression with additional predictors
  • There are some limitations to the multiple regression approach
    • Parameter estimates can be very sensitive to other variables - Simpson’s paradox and the like
    • Need to note that the regression coefficient is “after controlling for . . .” (all the other variables)
    • Interaction terms can be important as well
  • Regressions in R for an intercept for every group are called as lm(y ~ x - 1)
  • The interaction term x1*x2 is the same as x1 + x2 + x1:x2

Random effects in regression:

  • Nested relationships tend to be hierarchical in nature - students are part of classes are part of schools and the like
    • Mathematically, this is referred to as a mapping among the distributions
  • The algebraic representation is that y ~ B*x + eps, with B ~ N(mu, sigma**2)
    • library(lme4) is the best packages for this in R
    • lme4::lmer(y ~ x + (1|randomGroup), data=myData)
    • lme4::lmer(y ~ x + (randomSlope|randomGroup), data=myData)

School data:

  • Appliciation of multi-level models to school data - influence of sex, teacher training, plotting parameter estmates

Example code includes:

rawStudent <- read.csv("./RInputFiles/classroom.csv")

studentData <- rawStudent %>%
    mutate(sex=factor(sex, labels=c("male", "female")), minority=factor(minority, labels=c("no", "yes")))


# Plot the data
ggplot(data = studentData, aes(x = housepov, y = mathgain)) +
    geom_point() +
    geom_smooth(method = 'lm')

# Fit a linear model
summary( lm(mathgain ~ housepov , data = studentData))
## 
## Call:
## lm(formula = mathgain ~ housepov, data = studentData)
## 
## Residuals:
##      Min       1Q   Median       3Q      Max 
## -168.226  -22.222   -1.306   19.763  195.156 
## 
## Coefficients:
##             Estimate Std. Error t value Pr(>|t|)    
## (Intercept)   56.937      1.674   34.02   <2e-16 ***
## housepov       3.531      7.515    0.47    0.639    
## ---
## Signif. codes:  0 '***' 0.001 '**' 0.01 '*' 0.05 '.' 0.1 ' ' 1
## 
## Residual standard error: 34.63 on 1188 degrees of freedom
## Multiple R-squared:  0.0001858,  Adjusted R-squared:  -0.0006558 
## F-statistic: 0.2208 on 1 and 1188 DF,  p-value: 0.6385
# I have aggregated the data for you into two new datasets at the classroom- and school-levels (As a side note, if you want to learn how to aggregate data, the dplyr or data.table courses teach these skills)
# We will also compare the model outputs across all three outputs
# Note: how we aggregate the data is important
# I aggregated the data by taking the mean across the student data (in pseudo-code: mean(mathgain) by school or mean(mathgain) by classroom), 
# but another reasonable method for aggregating the data would be to aggregate by classroom first and school second

classData <- studentData %>%
    group_by(schoolid, classid) %>%
    summarize_at(vars(mathgain, mathprep, housepov, yearstea), mean, na.rm=TRUE)
str(classData)
## Classes 'grouped_df', 'tbl_df', 'tbl' and 'data.frame':  312 obs. of  6 variables:
##  $ schoolid: int  1 1 2 2 2 3 3 3 3 4 ...
##  $ classid : int  160 217 197 211 307 11 137 145 228 48 ...
##  $ mathgain: num  65.7 57.4 49.5 69 68.8 ...
##  $ mathprep: num  2 3.25 2.5 2.33 2.3 3.83 2.25 3 2.17 2 ...
##  $ housepov: num  0.082 0.082 0.082 0.082 0.082 0.086 0.086 0.086 0.086 0.365 ...
##  $ yearstea: num  1 2 1 2 12.5 ...
##  - attr(*, "vars")= chr "schoolid"
##  - attr(*, "drop")= logi TRUE
schoolData <- studentData %>%
    group_by(schoolid) %>%
    summarize_at(vars(mathgain, mathprep, housepov, yearstea), mean, na.rm=TRUE)
str(schoolData)
## Classes 'tbl_df', 'tbl' and 'data.frame':    107 obs. of  5 variables:
##  $ schoolid: int  1 2 3 4 5 6 7 8 9 10 ...
##  $ mathgain: num  59.6 65 88.9 35.2 60.2 ...
##  $ mathprep: num  2.91 2.35 2.95 2 3.75 ...
##  $ housepov: num  0.082 0.082 0.086 0.365 0.511 0.044 0.148 0.085 0.537 0.346 ...
##  $ yearstea: num  1.73 6.02 14.93 22 3 ...
# First, plot the hosepov and mathgain at the classroom-level from the classData data.frame
ggplot(data = classData, aes(x = housepov, y = mathgain)) +
    geom_point() +
    geom_smooth(method = 'lm')

# Second, plot the hosepov and mathgain at the school-level from the schoolData data.frame
ggplot(data = schoolData, aes(x = housepov, y = mathgain)) +
    geom_point() +
    geom_smooth(method = 'lm')

# Third, compare your liner regression results from the previous expercise to the two new models
summary( lm(mathgain ~ housepov, data = studentData)) ## student-level data
## 
## Call:
## lm(formula = mathgain ~ housepov, data = studentData)
## 
## Residuals:
##      Min       1Q   Median       3Q      Max 
## -168.226  -22.222   -1.306   19.763  195.156 
## 
## Coefficients:
##             Estimate Std. Error t value Pr(>|t|)    
## (Intercept)   56.937      1.674   34.02   <2e-16 ***
## housepov       3.531      7.515    0.47    0.639    
## ---
## Signif. codes:  0 '***' 0.001 '**' 0.01 '*' 0.05 '.' 0.1 ' ' 1
## 
## Residual standard error: 34.63 on 1188 degrees of freedom
## Multiple R-squared:  0.0001858,  Adjusted R-squared:  -0.0006558 
## F-statistic: 0.2208 on 1 and 1188 DF,  p-value: 0.6385
summary( lm(mathgain ~ housepov, data = classData)) ## class-level data
## 
## Call:
## lm(formula = mathgain ~ housepov, data = classData)
## 
## Residuals:
##     Min      1Q  Median      3Q     Max 
## -80.479 -14.444  -1.447  13.151 156.516 
## 
## Coefficients:
##             Estimate Std. Error t value Pr(>|t|)    
## (Intercept)   58.160      2.542  22.879   <2e-16 ***
## housepov      -3.236     10.835  -0.299    0.765    
## ---
## Signif. codes:  0 '***' 0.001 '**' 0.01 '*' 0.05 '.' 0.1 ' ' 1
## 
## Residual standard error: 26.14 on 310 degrees of freedom
## Multiple R-squared:  0.0002876,  Adjusted R-squared:  -0.002937 
## F-statistic: 0.08918 on 1 and 310 DF,  p-value: 0.7654
summary( lm(mathgain ~ housepov, data = schoolData)) ## school-level data
## 
## Call:
## lm(formula = mathgain ~ housepov, data = schoolData)
## 
## Residuals:
##     Min      1Q  Median      3Q     Max 
## -46.660  -9.947  -2.494   9.546  41.445 
## 
## Coefficients:
##             Estimate Std. Error t value Pr(>|t|)    
## (Intercept)   59.338      2.624  22.616   <2e-16 ***
## housepov     -11.948     10.987  -1.087    0.279    
## ---
## Signif. codes:  0 '***' 0.001 '**' 0.01 '*' 0.05 '.' 0.1 ' ' 1
## 
## Residual standard error: 15.8 on 105 degrees of freedom
## Multiple R-squared:  0.01114,    Adjusted R-squared:  0.00172 
## F-statistic: 1.183 on 1 and 105 DF,  p-value: 0.2793
# Plot the means of your data, predictor is your x-variable, response is your y-variable, and intDemo is your data.frame
intDemo <- data.frame(predictor=factor(c(rep("a", 5), rep("b", 5), rep("c", 5))), 
                      response=c(-1.207, 0.277, 1.084, -2.346, 0.429, 5.759, 4.138, 4.18, 4.153, 3.665, 9.046, 8.003, 8.447, 10.129, 11.919)
                      )
str(intDemo)
## 'data.frame':    15 obs. of  2 variables:
##  $ predictor: Factor w/ 3 levels "a","b","c": 1 1 1 1 1 2 2 2 2 2 ...
##  $ response : num  -1.207 0.277 1.084 -2.346 0.429 ...
ggIntDemo <- ggplot(intDemo, aes(x = predictor, y = response) ) +
    geom_point() +
    theme_minimal() + stat_summary(fun.y = "mean", color = "red",
                                   size = 3, geom = "point") +
    xlab("Intercept groups")
print(ggIntDemo)

# Fit a linear model to your data where response is "predicted by"(~) predictor
intModel <- lm( response ~ predictor - 1 , data = intDemo)
summary(intModel)
## 
## Call:
## lm(formula = response ~ predictor - 1, data = intDemo)
## 
## Residuals:
##     Min      1Q  Median      3Q     Max 
## -1.9934 -0.7842 -0.2260  0.7056  2.4102 
## 
## Coefficients:
##            Estimate Std. Error t value Pr(>|t|)    
## predictora  -0.3526     0.5794  -0.609    0.554    
## predictorb   4.3790     0.5794   7.558 6.69e-06 ***
## predictorc   9.5088     0.5794  16.412 1.38e-09 ***
## ---
## Signif. codes:  0 '***' 0.001 '**' 0.01 '*' 0.05 '.' 0.1 ' ' 1
## 
## Residual standard error: 1.296 on 12 degrees of freedom
## Multiple R-squared:  0.9646, Adjusted R-squared:  0.9557 
## F-statistic:   109 on 3 and 12 DF,  p-value: 5.696e-09
extractAndPlotResults <- function(intModel){
    intCoefPlot <- broom::tidy(intModel)
    intCoefPlot$term <- factor(gsub("predictor", "", intCoefPlot$term))

    plotOut <- ggIntDemo + geom_point(data = intCoefPlot,
                           aes(x = term, y = estimate),
                           position = position_dodge(width = 0.4),
                           color = 'blue', size = 8, alpha = 0.25)
    print(plotOut)
}


# Run the next code that extracts out the model's coeffiecents and plots them 
extractAndPlotResults(intModel)

multIntDemo <- data.frame(group=factor(c(rep("a", 5), rep("b", 5), rep("c", 5))), 
                          x=rep(0:4, times=3), 
                          intercept=c(4.11, -1.69, 1.09, 1.9, 1.21, 4.63, 10.29, 4.67, 12.06, 4.78, 15.22, 19.15, 4.44, 8.88, 9.47), 
                          response=c(4.11, 2.31, 9.09, 13.9, 17.21, 4.63, 14.29, 12.67, 24.06, 20.78, 15.22, 23.15, 12.44, 20.88, 25.47)
                          )
str(multIntDemo)
## 'data.frame':    15 obs. of  4 variables:
##  $ group    : Factor w/ 3 levels "a","b","c": 1 1 1 1 1 2 2 2 2 2 ...
##  $ x        : int  0 1 2 3 4 0 1 2 3 4 ...
##  $ intercept: num  4.11 -1.69 1.09 1.9 1.21 ...
##  $ response : num  4.11 2.31 9.09 13.9 17.21 ...
plot_output1 <- function(out1){
    ggmultIntgDemo <- ggplot( multIntDemo, aes(x = x, y = response) ) +
        geom_point(aes(color = group)) +
        theme_minimal() +
        scale_color_manual(values = c("blue", "black", "red")) +
        stat_smooth(method = 'lm', fill = NA, color = 'orange', size = 3)
    print(ggmultIntgDemo)
}

plot_output2 <- function(out2){
    out2Tidy <- broom::tidy(out2)
    out2Tidy$term <- gsub("group", "", out2Tidy$term)
    out2Plot <- data.frame(group = pull(out2Tidy[ -1, 1]),
                           slope = pull(out2Tidy[ 1, 2]),
                           intercept = pull(out2Tidy[ -1, 2])
                           )
    ggmultIntgDemo2 <- ggplot( multIntDemo, aes(x = x, y = response) ) +
        geom_point(aes(color = group))+
        theme_minimal() +
        scale_color_manual(values = c("blue", "black", "red")) +
        geom_abline(data = out2Plot,
                    aes(intercept = intercept, slope = slope, color = group))
    print(ggmultIntgDemo2)
}

plot_output3 <- function(out3){
    ggmultIntgDemo3 <- ggplot( multIntDemo, aes(x = x, y = response) ) +
        geom_point(aes(color = group)) +
        theme_minimal() +
        scale_color_manual(values = c("blue", "black", "red")) +
        stat_smooth(method = 'lm', aes(color = group), fill = NA)
    print(ggmultIntgDemo3)
}

# First, run a model without considering different intercept for each group
out1 <- lm( response ~ x, data=multIntDemo )
summary(out1)
## 
## Call:
## lm(formula = response ~ x, data = multIntDemo)
## 
## Residuals:
##    Min     1Q Median     3Q    Max 
## -9.101 -4.021 -2.011  3.590 11.739 
## 
## Coefficients:
##             Estimate Std. Error t value Pr(>|t|)   
## (Intercept)    8.141      2.615   3.113  0.00824 **
## x              3.270      1.068   3.062  0.00908 **
## ---
## Signif. codes:  0 '***' 0.001 '**' 0.01 '*' 0.05 '.' 0.1 ' ' 1
## 
## Residual standard error: 5.848 on 13 degrees of freedom
## Multiple R-squared:  0.4191, Adjusted R-squared:  0.3744 
## F-statistic: 9.378 on 1 and 13 DF,  p-value: 0.009081
plot_output1(out1)

# Considering same slope but different intercepts
out2 <- lm( response ~ x + group - 1, data=multIntDemo )
summary(out2)
## 
## Call:
## lm(formula = response ~ x + group - 1, data = multIntDemo)
## 
## Residuals:
##    Min     1Q Median     3Q    Max 
## -6.992 -2.219 -0.234  1.810  6.988 
## 
## Coefficients:
##        Estimate Std. Error t value Pr(>|t|)    
## x        3.2697     0.7516   4.350 0.001155 ** 
## groupa   2.7847     2.3767   1.172 0.266085    
## groupb   8.7467     2.3767   3.680 0.003625 ** 
## groupc  12.8927     2.3767   5.425 0.000209 ***
## ---
## Signif. codes:  0 '***' 0.001 '**' 0.01 '*' 0.05 '.' 0.1 ' ' 1
## 
## Residual standard error: 4.117 on 11 degrees of freedom
## Multiple R-squared:  0.9534, Adjusted R-squared:  0.9364 
## F-statistic: 56.23 on 4 and 11 DF,  p-value: 2.97e-07
plot_output2(out2)

# Consdering different slope and intercept for each group (i.e., an interaction)
out3 <- lm( response ~ x + group - 1 + x:group, multIntDemo)
summary(out3)
## 
## Call:
## lm(formula = response ~ x + group - 1 + x:group, data = multIntDemo)
## 
## Residuals:
##    Min     1Q Median     3Q    Max 
## -6.992 -2.429 -0.234  2.368  5.541 
## 
## Coefficients:
##          Estimate Std. Error t value Pr(>|t|)    
## x           3.779      1.308   2.888 0.017941 *  
## groupa      1.766      3.205   0.551 0.595053    
## groupb      6.872      3.205   2.144 0.060621 .  
## groupc     15.786      3.205   4.925 0.000819 ***
## x:groupb    0.428      1.851   0.231 0.822263    
## x:groupc   -1.956      1.851  -1.057 0.318050    
## ---
## Signif. codes:  0 '***' 0.001 '**' 0.01 '*' 0.05 '.' 0.1 ' ' 1
## 
## Residual standard error: 4.138 on 9 degrees of freedom
## Multiple R-squared:  0.9615, Adjusted R-squared:  0.9358 
## F-statistic: 37.42 on 6 and 9 DF,  p-value: 7.263e-06
plot_output3(out3)

multIntDemo$intercept <- c(-0.87, 3.35, 1.25, 0.88, -1.05, 4.55, 1.22, 3.34, 1.26, 3.75, 7.71, 9.59, 2.28, 1.9, 13.35)
multIntDemo$response <- c(-0.87, 6.35, 7.25, 9.88, 10.95, 4.55, 4.22, 9.34, 10.26, 15.75, 7.71, 12.59, 8.28, 10.9, 25.35)

# Run model
outLmer <- lme4::lmer( response ~ x + ( 1 | group), multIntDemo)

# Look at model outputs 
summary( outLmer )
## Linear mixed model fit by REML ['lmerMod']
## Formula: response ~ x + (1 | group)
##    Data: multIntDemo
## 
## REML criterion at convergence: 76.9
## 
## Scaled residuals: 
##      Min       1Q   Median       3Q      Max 
## -1.31582 -0.61105 -0.01593  0.45125  2.19118 
## 
## Random effects:
##  Groups   Name        Variance Std.Dev.
##  group    (Intercept)  7.98    2.825   
##  Residual             10.71    3.272   
## Number of obs: 15, groups:  group, 3
## 
## Fixed effects:
##             Estimate Std. Error t value
## (Intercept)   3.5540     2.1913   1.622
## x             2.9733     0.5975   4.977
## 
## Correlation of Fixed Effects:
##   (Intr)
## x -0.545
broom::tidy( outLmer )
## Warning in bind_rows_(x, .id): binding factor and character vector,
## coercing into character vector
## Warning in bind_rows_(x, .id): binding character and factor vector,
## coercing into character vector
## # A tibble: 4 x 5
##   term                    estimate std.error statistic group   
##   <chr>                      <dbl>     <dbl>     <dbl> <chr>   
## 1 (Intercept)                 3.55     2.19       1.62 fixed   
## 2 x                           2.97     0.597      4.98 fixed   
## 3 sd_(Intercept).group        2.82    NA         NA    group   
## 4 sd_Observation.Residual     3.27    NA         NA    Residual
extractAndPlotOutput <- function(outLmer, slope=3){
    multIntDemo$lmerPredict <- predict(outLmer)
    ggmultIntgDemo2 <- ggplot( multIntDemo, aes(x = x, y = response) ) +
        geom_point(aes(color = group))+
        theme_minimal() +
        scale_color_manual(values = c("blue", "black", "red")) +
        geom_abline(data = multIntDemo,
                    aes(intercept = intercept, slope = slope, color = group))
    outPlot <-  ggmultIntgDemo2 +
                geom_line( data =  multIntDemo,
                      aes(x = x, y = lmerPredict, color = group),
                      linetype = 2)
    print(outPlot)
}


# Extract predictor variables and plot
extractAndPlotOutput(outLmer)

# Random effect slopes
multIntDemo$response <- c(-0.72, 1.5, 4.81, 6.61, 13.62, 10.21, 9.64, 11.91, 16.39, 16.97, 8.76, 14.79, 15.83, 15.27, 17.36)
multIntDemo$intercept <- c(-0.72, -1.5, -1.19, -2.39, 1.62, 10.21, 6.64, 5.91, 7.39, 4.97, 8.76, 11.79, 9.83, 6.27, 5.36)

outLmer2 <- lme4::lmer( response ~ ( x|group ), multIntDemo)
summary(outLmer2)
## Linear mixed model fit by REML ['lmerMod']
## Formula: response ~ (x | group)
##    Data: multIntDemo
## 
## REML criterion at convergence: 69.7
## 
## Scaled residuals: 
##      Min       1Q   Median       3Q      Max 
## -1.56747 -0.54105 -0.06286  0.75141  1.27947 
## 
## Random effects:
##  Groups   Name        Variance Std.Dev. Corr 
##  group    (Intercept) 273.998  16.553        
##           x             6.096   2.469   -1.00
##  Residual               2.466   1.570        
## Number of obs: 15, groups:  group, 3
## 
## Fixed effects:
##             Estimate Std. Error t value
## (Intercept)   21.676      1.383   15.67
broom::tidy(outLmer2)
## Warning in bind_rows_(x, .id): binding factor and character vector,
## coercing into character vector

## Warning in bind_rows_(x, .id): binding character and factor vector,
## coercing into character vector
## # A tibble: 5 x 5
##   term                    estimate std.error statistic group   
##   <chr>                      <dbl>     <dbl>     <dbl> <chr>   
## 1 (Intercept)                21.7       1.38      15.7 fixed   
## 2 sd_(Intercept).group       16.6      NA         NA   group   
## 3 sd_x.group                  2.47     NA         NA   group   
## 4 cor_(Intercept).x.group    -1        NA         NA   group   
## 5 sd_Observation.Residual     1.57     NA         NA   Residual
plotOutput <- function(outLmer2){
    multIntDemo$lmerPredict2 <- predict(outLmer2)
    ggmultIntgDemo3 <- ggplot( multIntDemo, aes(x = x, y = response) ) +
        geom_point(aes(color = group)) +
        theme_minimal() +
        scale_color_manual(values = c("blue", "black", "red")) +
        stat_smooth(method = 'lm', aes(color = group), fill = NA)
    plotOut <- ggmultIntgDemo3 +
            geom_line( data =  multIntDemo,
                      aes(x = x, y = lmerPredict2, color = group),
                      linetype = 2)
    print(plotOut)
}


# Extract and plot
plotOutput(outLmer2)

# Mixed effect model
lmerModel <- lme4::lmer(mathgain ~ sex + 
                  mathprep + mathknow + (1|classid) +
                  (1|schoolid), data = studentData, na.action = "na.omit",
                  REML = TRUE)
summary(lmerModel)
## Linear mixed model fit by REML ['lmerMod']
## Formula: 
## mathgain ~ sex + mathprep + mathknow + (1 | classid) + (1 | schoolid)
##    Data: studentData
## 
## REML criterion at convergence: 10677.9
## 
## Scaled residuals: 
##     Min      1Q  Median      3Q     Max 
## -4.3203 -0.6146 -0.0294  0.5467  5.5331 
## 
## Random effects:
##  Groups   Name        Variance Std.Dev.
##  classid  (Intercept)  103.57  10.177  
##  schoolid (Intercept)   85.44   9.244  
##  Residual             1019.47  31.929  
## Number of obs: 1081, groups:  classid, 285; schoolid, 105
## 
## Fixed effects:
##             Estimate Std. Error t value
## (Intercept)   52.250      3.838  13.613
## sexfemale     -1.526      2.041  -0.747
## mathprep       2.426      1.298   1.869
## mathknow       2.405      1.299   1.851
## 
## Correlation of Fixed Effects:
##           (Intr) sexfml mthprp
## sexfemale -0.268              
## mathprep  -0.878  0.001       
## mathknow  -0.003  0.011  0.005
extractAndPlot <- function(lmerModel){
    modelOutPlot <- broom::tidy(lmerModel, conf.int = TRUE)
    modelOutPlot <- modelOutPlot[ modelOutPlot$group =="fixed" &
                               modelOutPlot$term != "(Intercept)", ]
    plotOut <- ggplot(modelOutPlot, aes(x = term, y = estimate,
                             ymin = conf.low,
                             ymax = conf.high)) +
            theme_minimal() +
            geom_hline(yintercept = 0.0, color = 'red', size = 2.0) +
            geom_point() +
            geom_linerange() + coord_flip()
    print(plotOut)
}


# Extract and plot 
extractAndPlot(lmerModel)
## Warning in bind_rows_(x, .id): binding factor and character vector,
## coercing into character vector

## Warning in bind_rows_(x, .id): binding character and factor vector,
## coercing into character vector


Chapter 2 - Linear Mixed-Effect Models

Linear mixed effect model - Birth rates data:

  • Small populations are highly sensitive to stochastic effects - if the mean is 1, a group of 5 might have 0 or 10
  • Questions about how counties may impact birth rates, over and above other demographic factors
    • Example of plotting birth rate vs. county - will see both the highest and lowest birth rates in the smallest counties
  • Random effect syntax for the lmer model includes
    • (1 | group) - random intercept with fixed mean
    • (1 | g1/g2) - intercepts vary among g1 and g2 within g2
    • (1 | g1) + (1 | g2) - random intercepts for two variables
    • x + (x | g) - correlated random slope and intercept
    • x + (x || g) - uncorrelated random slope and intercept
    • See lme4 documentation for additional details

Understanding and reporting the outputs of lmer:

  • The output from lmer is similar to the output from lm, but with some key differences - if using print(), will see
    • The method used is REML - restricted maximum likelihood - which tends to solve better than maximum likelihood for these problems
    • There is an REML convergence criteria, which can be a helpful diagnostic
    • Can see the standard deviations for both the state and the residual, along with the number of observations
    • Get the fixed effects coefficients in a similar form as lm()
  • The summary() call on lmer produces several additional outputs
    • Residuals summary
    • Fixed effects estimates include SE and t-values (but not p-values)
    • Correlations of fixed effects
  • Can grab only the fixed effects using fixef(myLMERObject)
    • Can grab only the random effects using ranef(myLMERObject), though these will not have confidence intervals
    • The random effects confidence intervals could be estimated using bootstrapping or Bayesian methods per the author of lme4 - but actual random effects are just unobserved random variables rather than parameters
  • Can grab only the confidence intervals using confint(myLMERObject)
  • Need to be careful in reporting the results - figures vs. tables vs. in-line descriptions

Statistical inference with Maryland crime data:

  • The Maryland crime data is available on data.gov - interesting for many public and private purposes
  • The null hypothsis test can be used with LMER - frequentist approach
    • By default, lmer does not provide p-values, as there is ongoing debate as to the degrees of freedom and impact on reported results
    • Can use lmerTest package to calculate and report on the p-values
  • Can use ANOVA to look at the variability explained by one model versus another model, and the associated degrees of freedom needed

Example code includes:

# Read in births data
rawBirths <- read.csv("./RInputFiles/countyBirthsDataUse.csv")
countyBirthsData <- rawBirths
str(countyBirthsData)
## 'data.frame':    580 obs. of  8 variables:
##  $ X                 : int  1 2 3 4 5 6 7 8 9 10 ...
##  $ Year              : int  2015 2015 2015 2015 2015 2015 2015 2015 2015 2015 ...
##  $ TotalPopulation   : int  203709 115620 103057 104173 660367 156993 353089 415395 226519 119565 ...
##  $ BirthRate         : num  11.5 12.1 11.8 12.4 13.3 ...
##  $ AverageBirthWeight: num  3261 3209 3239 3207 3177 ...
##  $ AverageAgeofMother: num  27.5 26.3 25.8 26.9 27.9 ...
##  $ CountyName        : Factor w/ 472 levels "Ada","Adams",..: 22 64 141 189 200 229 248 273 278 279 ...
##  $ State             : Factor w/ 50 levels "AK","AL","AR",..: 2 2 2 2 2 2 2 2 2 2 ...
# First, build a lmer with state as a random effect. Then look at the model's summary and the plot of residuals. 
birthRateStateModel <- lme4::lmer(BirthRate ~ (1|State), data=countyBirthsData)
summary(birthRateStateModel)
## Linear mixed model fit by REML ['lmerMod']
## Formula: BirthRate ~ (1 | State)
##    Data: countyBirthsData
## 
## REML criterion at convergence: 2411
## 
## Scaled residuals: 
##     Min      1Q  Median      3Q     Max 
## -2.7957 -0.6056 -0.1063  0.5211  5.5948 
## 
## Random effects:
##  Groups   Name        Variance Std.Dev.
##  State    (Intercept) 1.899    1.378   
##  Residual             3.256    1.804   
## Number of obs: 578, groups:  State, 50
## 
## Fixed effects:
##             Estimate Std. Error t value
## (Intercept)  12.3362     0.2216   55.67
plot(birthRateStateModel)

# Next, plot the predicted values from the model ontop of the plot shown during the video.
countyBirthsData$birthPredictState <- predict(birthRateStateModel, countyBirthsData)
ggplot() + theme_minimal() +
    geom_point(data =countyBirthsData, aes(x = TotalPopulation, y = BirthRate)) + 
    geom_point(data = countyBirthsData, aes(x = TotalPopulation, y = birthPredictState),
               color = 'blue', alpha = 0.5
               )
## Warning: Removed 2 rows containing missing values (geom_point).

## Warning: Removed 2 rows containing missing values (geom_point).

# Include the AverageAgeofMother as a fixed effect within the lmer and state as a random effect
ageMotherModel <- lme4::lmer( BirthRate ~ AverageAgeofMother + (1|State), data=countyBirthsData)
summary(ageMotherModel)
## Linear mixed model fit by REML ['lmerMod']
## Formula: BirthRate ~ AverageAgeofMother + (1 | State)
##    Data: countyBirthsData
## 
## REML criterion at convergence: 2347.6
## 
## Scaled residuals: 
##     Min      1Q  Median      3Q     Max 
## -2.9602 -0.6086 -0.1042  0.5144  5.2686 
## 
## Random effects:
##  Groups   Name        Variance Std.Dev.
##  State    (Intercept) 1.562    1.250   
##  Residual             2.920    1.709   
## Number of obs: 578, groups:  State, 50
## 
## Fixed effects:
##                    Estimate Std. Error t value
## (Intercept)        27.57033    1.81801  15.165
## AverageAgeofMother -0.53549    0.06349  -8.434
## 
## Correlation of Fixed Effects:
##             (Intr)
## AvrgAgfMthr -0.994
# Compare the random-effect model to the linear effect model 
summary(lm(BirthRate ~ AverageAgeofMother, data = countyBirthsData))
## 
## Call:
## lm(formula = BirthRate ~ AverageAgeofMother, data = countyBirthsData)
## 
## Residuals:
##     Min      1Q  Median      3Q     Max 
## -6.8304 -1.3126 -0.1795  1.2198  8.7327 
## 
## Coefficients:
##                    Estimate Std. Error t value Pr(>|t|)    
## (Intercept)        29.06637    1.83374  15.851   <2e-16 ***
## AverageAgeofMother -0.59380    0.06441  -9.219   <2e-16 ***
## ---
## Signif. codes:  0 '***' 0.001 '**' 0.01 '*' 0.05 '.' 0.1 ' ' 1
## 
## Residual standard error: 2.065 on 576 degrees of freedom
##   (2 observations deleted due to missingness)
## Multiple R-squared:  0.1286, Adjusted R-squared:  0.1271 
## F-statistic: 84.99 on 1 and 576 DF,  p-value: < 2.2e-16
# Include the AverageAgeofMother as a correlated random-effect slope parameter
ageMotherModelRandomCorrelated <- lme4::lmer(BirthRate ~ AverageAgeofMother + (AverageAgeofMother|State),
                       countyBirthsData)
summary(ageMotherModelRandomCorrelated)
## Linear mixed model fit by REML ['lmerMod']
## Formula: BirthRate ~ AverageAgeofMother + (AverageAgeofMother | State)
##    Data: countyBirthsData
## 
## REML criterion at convergence: 2337.5
## 
## Scaled residuals: 
##     Min      1Q  Median      3Q     Max 
## -2.8399 -0.5966 -0.1133  0.5228  5.1815 
## 
## Random effects:
##  Groups   Name               Variance Std.Dev. Corr 
##  State    (Intercept)        78.75816 8.8746        
##           AverageAgeofMother  0.08482 0.2912   -0.99
##  Residual                     2.80306 1.6742        
## Number of obs: 578, groups:  State, 50
## 
## Fixed effects:
##                    Estimate Std. Error t value
## (Intercept)        27.22042    2.41281  11.282
## AverageAgeofMother -0.52347    0.08302  -6.306
## 
## Correlation of Fixed Effects:
##             (Intr)
## AvrgAgfMthr -0.997
# Include the AverageAgeofMother as a correlated random-effect slope parameter
ageMotherModelRandomUncorrelated <- lme4::lmer(BirthRate ~ AverageAgeofMother + 
                                                    (AverageAgeofMother || State), data=countyBirthsData
                                               )
summary(ageMotherModelRandomUncorrelated)
## Linear mixed model fit by REML ['lmerMod']
## Formula: 
## BirthRate ~ AverageAgeofMother + ((1 | State) + (0 + AverageAgeofMother |  
##     State))
##    Data: countyBirthsData
## 
## REML criterion at convergence: 2347.6
## 
## Scaled residuals: 
##     Min      1Q  Median      3Q     Max 
## -2.9602 -0.6086 -0.1042  0.5144  5.2686 
## 
## Random effects:
##  Groups   Name               Variance Std.Dev.
##  State    (Intercept)        1.562    1.250   
##  State.1  AverageAgeofMother 0.000    0.000   
##  Residual                    2.920    1.709   
## Number of obs: 578, groups:  State, 50
## 
## Fixed effects:
##                    Estimate Std. Error t value
## (Intercept)        27.57033    1.81801  15.165
## AverageAgeofMother -0.53549    0.06349  -8.434
## 
## Correlation of Fixed Effects:
##             (Intr)
## AvrgAgfMthr -0.994
out <- ageMotherModelRandomUncorrelated

# Extract the fixed-effect coefficients
lme4::fixef(out)
##        (Intercept) AverageAgeofMother 
##         27.5703303         -0.5354886
# Extract the random-effect coefficients
lme4::ranef(out)
## $State
##    (Intercept) AverageAgeofMother
## AK  1.03549149                  0
## AL -0.52500819                  0
## AR  0.48023356                  0
## AZ -1.04094123                  0
## CA  0.50530542                  0
## CO  0.09585582                  0
## CT -1.91638101                  0
## DC  0.96029532                  0
## DE -0.38938118                  0
## FL -1.87440508                  0
## GA  0.39776424                  0
## HI  0.08513474                  0
## IA  0.96279528                  0
## ID  1.17377458                  0
## IL -0.12739337                  0
## IN -0.32655206                  0
## KS  0.85650338                  0
## KY  0.64871300                  0
## LA  1.04437463                  0
## MA -1.40082047                  0
## MD  0.10842918                  0
## ME -1.63520397                  0
## MI -1.13797832                  0
## MN  0.93266233                  0
## MO  0.07081901                  0
## MS -0.21397453                  0
## MT -0.13190265                  0
## NC -0.28681241                  0
## ND  0.99847758                  0
## NE  1.49390428                  0
## NH -1.45440958                  0
## NJ -0.30089452                  0
## NM -0.69753301                  0
## NV  0.09012925                  0
## NY -0.58163335                  0
## OH -1.07390325                  0
## OK  0.77997159                  0
## OR -0.75845586                  0
## PA -1.59332743                  0
## RI -1.36395356                  0
## SC -0.59295090                  0
## SD  1.35141914                  0
## TN -0.13512968                  0
## TX  1.70872465                  0
## UT  3.66056804                  0
## VA  1.59187553                  0
## VT -0.51105276                  0
## WA  0.23008359                  0
## WI -0.51646717                  0
## WV -0.67684007                  0
# Estimate the confidence intervals 
(ciOut <- confint(out))
## Computing profile confidence intervals ...
##                         2.5 %      97.5 %
## .sig01              0.0000000  1.61243911
## .sig02              0.0000000  0.05033967
## .sigma              1.6091449  1.81592859
## (Intercept)        24.0121848 31.14668434
## AverageAgeofMother -0.6605319 -0.41123099
# Technical note: Extracting out the regression coefficients from lmer is tricky (see discussion between the lmer and broom authors development)
# Extract out the parameter estimates and confidence intervals and manipulate the data
dataPlot <- data.frame(cbind( lme4::fixef(out), ciOut[ 4:5, ]))
rownames(dataPlot)[1] <- "Intercept"
colnames(dataPlot) <- c("mean", "l95", "u95")
dataPlot$parameter <- rownames(dataPlot)

# Print the new dataframe
print(dataPlot)
##                          mean        l95       u95          parameter
## Intercept          27.5703303 24.0121848 31.146684          Intercept
## AverageAgeofMother -0.5354886 -0.6605319 -0.411231 AverageAgeofMother
# Plot the results using ggplot2
ggplot(dataPlot, aes(x = parameter, y = mean,
                     ymin = l95, ymax = u95)) +
    geom_hline( yintercept = 0, color = 'red' ) +
    geom_linerange() + geom_point() + coord_flip() + theme_minimal()

# Read in crime data
rawCrime <- read.csv("./RInputFiles/MDCrime.csv")
MDCrime <- rawCrime
str(MDCrime)
## 'data.frame':    192 obs. of  5 variables:
##  $ X     : int  1 2 3 4 5 6 7 8 9 10 ...
##  $ County: Factor w/ 24 levels "ALLEGANY","ANNE ARUNDEL",..: 2 3 4 5 6 7 8 9 10 11 ...
##  $ Year  : int  2006 2006 2006 2006 2006 2006 2006 2006 2006 2006 ...
##  $ Crime : int  3167 10871 5713 257 149 374 490 729 181 752 ...
##  $ Year2 : int  0 0 0 0 0 0 0 0 0 0 ...
plot1 <- ggplot(data = MDCrime, aes(x = Year, y = Crime, group = County)) +
    geom_line() + theme_minimal() +
    ylab("Major crimes reported per county")
print(plot1)

plot1 + geom_smooth(method = 'lm')

# Null hypothesis testing uses p-values to see if a variable is "significant"
# Recently, the abuse and overuse of null hypothesis testing and p-values has caused the American Statistical Association to issue a statement about the use of p-values
# Because of these criticisms and other numerical challenges, Doug Bates (the creator of the lme4 package) does not include p-values as part of his package
# However, you may still want to estimate p-values, because p-values are sill commonly used. Several packages exist, including the lmerTest package
# https://www.amstat.org/asa/files/pdfs/P-ValueStatement.pdf

# Load lmerTest
# library(lmerTest)

# Fit the model with Year as both a fixed and random-effect
lme4::lmer(Crime ~ Year + (1 + Year | County) , data = MDCrime)
## Warning in checkConv(attr(opt, "derivs"), opt$par, ctrl =
## control$checkConv, : Model failed to converge with max|grad| = 0.338309
## (tol = 0.002, component 1)
## Warning in checkConv(attr(opt, "derivs"), opt$par, ctrl = control$checkConv, : Model is nearly unidentifiable: very large eigenvalue
##  - Rescale variables?;Model is nearly unidentifiable: large eigenvalue ratio
##  - Rescale variables?
## Linear mixed model fit by REML ['lmerMod']
## Formula: Crime ~ Year + (1 + Year | County)
##    Data: MDCrime
## REML criterion at convergence: 2891.03
## Random effects:
##  Groups   Name        Std.Dev. Corr
##  County   (Intercept) 655.2118     
##           Year          0.8322 1.00
##  Residual             328.2865     
## Number of obs: 192, groups:  County, 24
## Fixed Effects:
## (Intercept)         Year  
##   136642.97       -67.33  
## convergence code 0; 3 optimizer warnings; 0 lme4 warnings
# Fit the model with Year2 rather than Year
out <- lme4::lmer(Crime ~ Year2 + (1 + Year2 | County) , data = MDCrime)

# Examine the model's output
summary(out)
## Linear mixed model fit by REML ['lmerMod']
## Formula: Crime ~ Year2 + (1 + Year2 | County)
##    Data: MDCrime
## 
## REML criterion at convergence: 2535.7
## 
## Scaled residuals: 
##     Min      1Q  Median      3Q     Max 
## -3.8081 -0.2235 -0.0390  0.2837  3.0768 
## 
## Random effects:
##  Groups   Name        Variance Std.Dev. Corr 
##  County   (Intercept) 7587959  2754.63       
##           Year2         16945   130.17  -0.91
##  Residual                8425    91.79       
## Number of obs: 192, groups:  County, 24
## 
## Fixed effects:
##             Estimate Std. Error t value
## (Intercept)  1577.28     562.42   2.804
## Year2         -67.33      26.73  -2.519
## 
## Correlation of Fixed Effects:
##       (Intr)
## Year2 -0.907
## Build the Null model with only County as a random-effect
null_model <- lme4::lmer(Crime ~ (1 | County) , data = MDCrime)

## Build the Year2 model with Year2 as a fixed and random slope and County as the random-effect
year_model <- lme4::lmer(Crime ~ Year2 + (1 + Year2 | County) , data = MDCrime)

## Compare the two models using an anova
anova(null_model, year_model)
## refitting model(s) with ML (instead of REML)
## Data: MDCrime
## Models:
## null_model: Crime ~ (1 | County)
## year_model: Crime ~ Year2 + (1 + Year2 | County)
##            Df    AIC    BIC  logLik deviance  Chisq Chi Df Pr(>Chisq)    
## null_model  3 2954.4 2964.2 -1474.2   2948.4                             
## year_model  6 2568.9 2588.4 -1278.4   2556.9 391.52      3  < 2.2e-16 ***
## ---
## Signif. codes:  0 '***' 0.001 '**' 0.01 '*' 0.05 '.' 0.1 ' ' 1

Chapter 3 - Generalized Linear Mixed-Effect Models

Crash course on GLMs - relaxing the assumptions around normality of the residuals:

  • Non-normal data can be transformed using arcsin or the like
  • However, with advances in methodology, it is possible to more directly model the data using binomial and poisson distributions
  • The basic glm call is glm(y ~ x, family=“”) # default is family=“gaussian”, which same as the lm()
  • The Poisson distribution is frequently best for count data, such as website visitors per hour - mean equals variance (generally best for small counts less than 30; can use normals for large counts)
  • For logistic regression, data can be entered in any of three formats
    • Binary (y=0 or 1) - glm(y ~ x, family=“binomial”)
    • Wilkinson-Rogers - glm(cbind(success, failure) ~ x, family=“binomial”)
    • Weighted - glm(y ~ x, weights=weights, family=“binomial”)
    • These methods differ primarily in the degrees of freedom (and thus deviance)

Binomial data - modeling data with only two outcomes:

  • Traditional method for analysis includes looking at proportion of successes
  • The GLM allows for direct looks at the data - logistic regression (logit)
  • Binomial data can be fit using glmer(y ~ x + (1/group), family=“error term”)
  • The regression coefficients can be difficult to explain, sometimes leading to the use of odds ratios instead
    • The odds ratio of 2.0 would mean 2:1 odds for that specific group

Count data:

  • Examples like number of events per hour (website hits) or counts per area (birds)
  • The count data differs from the binomial in that there is no pre-specified upper boundary
  • While Chi-squared is often used for goodness of fit or test of association for count data, the Poisson GLM can be a nice alternative
    • glm(y ~ x, family=“poisson”)
    • glmer(y ~ x + (1|group), family=“poisson”)

Example code includes:

# In this case study, we will be working with simulated dose-response data
# The response is mortality (1) or survival (0) at the end of a study. During this exercise, we will fit a logistic regression using all three methods described in the video
# You have been given two datasets. dfLong has the data in a "long" format with each row corresponding to an observation (i.e., a 0 or 1)
# dfShort has the data in an aggregated format with each row corresponding to a treatment (e.g., 6 successes, 4 failures, number of replicates = 10, proportion = 0.6)

dfLong <- data.frame(dose=c(0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 2, 2, 2, 2, 2, 2, 2, 2, 2, 2, 2, 2, 2, 2, 2, 2, 2, 2, 2, 2, 4, 4, 4, 4, 4, 4, 4, 4, 4, 4, 4, 4, 4, 4, 4, 4, 4, 4, 4, 4, 6, 6, 6, 6, 6, 6, 6, 6, 6, 6, 6, 6, 6, 6, 6, 6, 6, 6, 6, 6, 8, 8, 8, 8, 8, 8, 8, 8, 8, 8, 8, 8, 8, 8, 8, 8, 8, 8, 8, 8, 10, 10, 10, 10, 10, 10, 10, 10, 10, 10, 10, 10, 10, 10, 10, 10, 10, 10, 10, 10), 
                     mortality=c(0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 1, 0, 1, 0, 0, 1, 0, 0, 0, 0, 1, 0, 0, 0, 0, 0, 0, 0, 0, 1, 0, 0, 1, 1, 1, 0, 0, 0, 0, 0, 0, 0, 1, 1, 0, 0, 1, 0, 1, 0, 0, 1, 0, 1, 1, 0, 1, 1, 0, 1, 0, 1, 1, 0, 0, 0, 1, 1, 0, 0, 1, 1, 1, 0, 0, 1, 0, 0, 1, 0, 1, 0, 1, 0, 1, 1, 1, 1, 0, 1, 1, 1, 1, 1, 1, 1, 0, 0, 0, 1, 0, 1, 0, 1, 1, 0, 0, 1, 1)
                     )
str(dfLong)
## 'data.frame':    120 obs. of  2 variables:
##  $ dose     : num  0 0 0 0 0 0 0 0 0 0 ...
##  $ mortality: num  0 0 0 0 0 0 0 0 0 0 ...
dfShort <- dfLong %>% 
    group_by(dose) %>%
    summarize(mortality=sum(mortality), nReps=n()) %>%
    mutate(survival=nReps-mortality, mortalityP=mortality/nReps)
dfShort
## # A tibble: 6 x 5
##    dose mortality nReps survival mortalityP
##   <dbl>     <dbl> <int>    <dbl>      <dbl>
## 1  0         0       20    20.0       0    
## 2  2.00      4.00    20    16.0       0.200
## 3  4.00      8.00    20    12.0       0.400
## 4  6.00     10.0     20    10.0       0.500
## 5  8.00     11.0     20     9.00      0.550
## 6 10.0      13.0     20     7.00      0.650
# Fit a glm using data in a long format
fitLong <- glm(mortality ~ dose, data = dfLong, family = "binomial")
summary(fitLong)
## 
## Call:
## glm(formula = mortality ~ dose, family = "binomial", data = dfLong)
## 
## Deviance Residuals: 
##     Min       1Q   Median       3Q      Max  
## -1.5916  -0.8245  -0.4737   1.0440   1.8524  
## 
## Coefficients:
##             Estimate Std. Error z value Pr(>|z|)    
## (Intercept) -2.13075    0.44532  -4.785 1.71e-06 ***
## dose         0.30663    0.06821   4.495 6.95e-06 ***
## ---
## Signif. codes:  0 '***' 0.001 '**' 0.01 '*' 0.05 '.' 0.1 ' ' 1
## 
## (Dispersion parameter for binomial family taken to be 1)
## 
##     Null deviance: 159.76  on 119  degrees of freedom
## Residual deviance: 134.71  on 118  degrees of freedom
## AIC: 138.71
## 
## Number of Fisher Scoring iterations: 3
# Fit a glm using data in a short format with two columns
fitShort <- glm( cbind(mortality , survival ) ~ dose , data = dfShort, family = "binomial")
summary(fitShort)
## 
## Call:
## glm(formula = cbind(mortality, survival) ~ dose, family = "binomial", 
##     data = dfShort)
## 
## Deviance Residuals: 
##       1        2        3        4        5        6  
## -2.1186   0.2316   1.0698   0.6495  -0.2699  -0.6634  
## 
## Coefficients:
##             Estimate Std. Error z value Pr(>|z|)    
## (Intercept) -2.13075    0.44537  -4.784 1.72e-06 ***
## dose         0.30663    0.06822   4.495 6.97e-06 ***
## ---
## Signif. codes:  0 '***' 0.001 '**' 0.01 '*' 0.05 '.' 0.1 ' ' 1
## 
## (Dispersion parameter for binomial family taken to be 1)
## 
##     Null deviance: 31.6755  on 5  degrees of freedom
## Residual deviance:  6.6214  on 4  degrees of freedom
## AIC: 27.415
## 
## Number of Fisher Scoring iterations: 4
# Fit a glm using data in a short format with weights
fitShortP <- glm( mortalityP ~ dose , data = dfShort, weights = nReps , family = "binomial")
summary(fitShortP)
## 
## Call:
## glm(formula = mortalityP ~ dose, family = "binomial", data = dfShort, 
##     weights = nReps)
## 
## Deviance Residuals: 
##       1        2        3        4        5        6  
## -2.1186   0.2316   1.0698   0.6495  -0.2699  -0.6634  
## 
## Coefficients:
##             Estimate Std. Error z value Pr(>|z|)    
## (Intercept) -2.13075    0.44537  -4.784 1.72e-06 ***
## dose         0.30663    0.06822   4.495 6.97e-06 ***
## ---
## Signif. codes:  0 '***' 0.001 '**' 0.01 '*' 0.05 '.' 0.1 ' ' 1
## 
## (Dispersion parameter for binomial family taken to be 1)
## 
##     Null deviance: 31.6755  on 5  degrees of freedom
## Residual deviance:  6.6214  on 4  degrees of freedom
## AIC: 27.415
## 
## Number of Fisher Scoring iterations: 4
y <- c(0, 1, 0, 1, 0, 1, 0, 1, 0, 2, 1, 2, 0, 1, 1, 0, 1, 5, 1, 1)
x <- c(1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20)


# Fit the linear model
summary(lm(y ~ x))
## 
## Call:
## lm(formula = y ~ x)
## 
## Residuals:
##     Min      1Q  Median      3Q     Max 
## -1.3677 -0.6145 -0.2602  0.4297  3.4805 
## 
## Coefficients:
##             Estimate Std. Error t value Pr(>|t|)  
## (Intercept)  0.15263    0.50312   0.303   0.7651  
## x            0.07594    0.04200   1.808   0.0873 .
## ---
## Signif. codes:  0 '***' 0.001 '**' 0.01 '*' 0.05 '.' 0.1 ' ' 1
## 
## Residual standard error: 1.083 on 18 degrees of freedom
## Multiple R-squared:  0.1537, Adjusted R-squared:  0.1067 
## F-statistic: 3.269 on 1 and 18 DF,  p-value: 0.08733
# Fit the generalized linear model
summary(glm(y ~ x, family = "poisson"))
## 
## Call:
## glm(formula = y ~ x, family = "poisson")
## 
## Deviance Residuals: 
##     Min       1Q   Median       3Q      Max  
## -1.6389  -0.9726  -0.3115   0.5307   2.1559  
## 
## Coefficients:
##             Estimate Std. Error z value Pr(>|z|)  
## (Intercept) -1.04267    0.60513  -1.723   0.0849 .
## x            0.08360    0.04256   1.964   0.0495 *
## ---
## Signif. codes:  0 '***' 0.001 '**' 0.01 '*' 0.05 '.' 0.1 ' ' 1
## 
## (Dispersion parameter for poisson family taken to be 1)
## 
##     Null deviance: 23.589  on 19  degrees of freedom
## Residual deviance: 19.462  on 18  degrees of freedom
## AIC: 52.17
## 
## Number of Fisher Scoring iterations: 5
# Often, we want to "look" at our data and trends in our data
# ggplot2 allows us to add trend lines to our data
# The defult lines are created using a technique called local regression
# However, we can specify different models, including GLMs
# During this exercise, we'll see how to plot a GLM

# Plot the data using jittered points and the default stat_smooth
ggplot(data = dfLong, aes(x = dose, y = mortality)) + 
    geom_jitter(height = 0.05, width = 0.1) +
    stat_smooth(fill = 'pink', color = 'red') 
## `geom_smooth()` using method = 'loess'

# Plot the data using jittered points and the the glm stat_smooth
ggplot(data = dfLong, aes(x = dose, y = mortality)) + 
    geom_jitter(height = 0.05, width = 0.1) +
    stat_smooth(method = 'glm',  method.args = list(family = "binomial"))

# library(lmerTest)

df <- data.frame(dose=rep(rep(c(0, 2, 4, 6, 8, 10), each=20), times=3), 
                 mortality=c(0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 1, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 1, 1, 0, 0, 0, 1, 0, 0, 1, 0, 1, 0, 0, 1, 0, 1, 1, 0, 0, 1, 0, 1, 0, 1, 1, 1, 0, 0, 0, 1, 1, 0, 1, 1, 1, 1, 1, 0, 0, 1, 0, 0, 1, 1, 0, 0, 1, 0, 1, 1, 0, 1, 1, 1, 1, 1, 1, 1, 0, 1, 0, 1, 1, 0, 1, 0, 1, 1, 0, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 0, 1, 1, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 1, 0, 0, 0, 1, 1, 0, 0, 0, 0, 0, 0, 1, 0, 0, 0, 0, 0, 1, 0, 1, 1, 0, 1, 1, 1, 1, 0, 0, 1, 1, 0, 1, 0, 0, 1, 0, 1, 0, 1, 0, 0, 1, 0, 0, 1, 0, 0, 1, 0, 1, 0, 1, 1, 0, 1, 1, 0, 1, 0, 1, 1, 0, 0, 1, 1, 1, 1, 1, 1, 1, 0, 1, 1, 0, 1, 1, 0, 0, 0, 0, 1, 1, 1, 0, 1, 1, 1, 1, 1, 1, 0, 1, 1, 0, 0, 1, 1, 1, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 1, 0, 0, 0, 0, 0, 0, 1, 1, 0, 0, 0, 0, 0, 1, 0, 0, 0, 1, 1, 1, 1, 1, 0, 0, 0, 0, 0, 0, 1, 1, 1, 0, 0, 1, 1, 0, 1, 1, 1, 0, 0, 0, 0, 0, 0, 1, 1, 1, 0, 0, 0, 1, 1, 1, 0, 1, 1, 1, 0, 1, 1, 1, 1, 1, 1, 1, 1, 0, 1, 1, 1, 1, 1, 1, 0, 1, 1, 1, 1, 1, 1, 1, 1, 0, 1, 1, 1, 1, 1, 1), 
                 replicate=factor(rep(letters[1:3], each=120))
                 )
str(df)
## 'data.frame':    360 obs. of  3 variables:
##  $ dose     : num  0 0 0 0 0 0 0 0 0 0 ...
##  $ mortality: num  0 0 0 0 0 0 0 0 0 0 ...
##  $ replicate: Factor w/ 3 levels "a","b","c": 1 1 1 1 1 1 1 1 1 1 ...
glmerOut <- lme4::glmer(mortality ~ dose + (1|replicate), family = 'binomial', data = df)
summary(glmerOut)
## Generalized linear mixed model fit by maximum likelihood (Laplace
##   Approximation) [glmerMod]
##  Family: binomial  ( logit )
## Formula: mortality ~ dose + (1 | replicate)
##    Data: df
## 
##      AIC      BIC   logLik deviance df.resid 
##    378.1    389.8   -186.0    372.1      357 
## 
## Scaled residuals: 
##     Min      1Q  Median      3Q     Max 
## -2.3484 -0.6875 -0.3031  0.6413  2.1907 
## 
## Random effects:
##  Groups    Name        Variance  Std.Dev.
##  replicate (Intercept) 6.658e-15 8.16e-08
## Number of obs: 360, groups:  replicate, 3
## 
## Fixed effects:
##             Estimate Std. Error z value Pr(>|z|)    
## (Intercept) -2.38736    0.27334  -8.734   <2e-16 ***
## dose         0.40948    0.04414   9.276   <2e-16 ***
## ---
## Signif. codes:  0 '***' 0.001 '**' 0.01 '*' 0.05 '.' 0.1 ' ' 1
## 
## Correlation of Fixed Effects:
##      (Intr)
## dose -0.884
# library(lmerTest)
# Fit the model and look at its summary 
# modelOut <- lme4::glmer( cbind(Purchases, Pass) ~ friend + ranking + (1|city), data = allData, family = 'binomial')
# summary( modelOut) 

# Compare outputs to a lmer model
# summary(lme4::lmer( Purchases/( Purchases + Pass) ~ friend + ranking + (1|city), data = allData))


# Run the code to see how to calculate odds ratios
# summary(modelOut) 
# exp(fixef(modelOut)[2])
# exp(confint(modelOut)[3, ])


# Load lmerTest
# library(lmerTest)


userGroups <- data.frame(group=factor(rep(rep(LETTERS[1:4], each=10), times=2)), 
                         webpage=factor(rep(c("old", "new"), each=40)), 
                         clicks=c(0, 0, 0, 0, 0, 0, 2, 0, 0, 0, 1, 0, 0, 1, 1, 1, 2, 0, 1, 1, 0, 3, 2, 3, 1, 2, 4, 2, 1, 0, 2, 0, 1, 2, 0, 2, 1, 1, 2, 4, 2, 8, 1, 1, 1, 2, 1, 1, 0, 0, 3, 0, 1, 4, 1, 2, 0, 1, 1, 0, 0, 3, 2, 0, 3, 1, 2, 2, 0, 2, 3, 1, 3, 2, 4, 4, 2, 1, 5, 2)
                         )
str(userGroups)
## 'data.frame':    80 obs. of  3 variables:
##  $ group  : Factor w/ 4 levels "A","B","C","D": 1 1 1 1 1 1 1 1 1 1 ...
##  $ webpage: Factor w/ 2 levels "new","old": 2 2 2 2 2 2 2 2 2 2 ...
##  $ clicks : num  0 0 0 0 0 0 2 0 0 0 ...
# Fit a Poisson glmer
summary( lme4::glmer(clicks ~ webpage + (1|group), family = 'poisson', data = userGroups))
## Generalized linear mixed model fit by maximum likelihood (Laplace
##   Approximation) [glmerMod]
##  Family: poisson  ( log )
## Formula: clicks ~ webpage + (1 | group)
##    Data: userGroups
## 
##      AIC      BIC   logLik deviance df.resid 
##    255.5    262.6   -124.7    249.5       77 
## 
## Scaled residuals: 
##     Min      1Q  Median      3Q     Max 
## -1.3999 -0.9104 -0.2340  0.4978  5.6126 
## 
## Random effects:
##  Groups Name        Variance Std.Dev.
##  group  (Intercept) 0.07093  0.2663  
## Number of obs: 80, groups:  group, 4
## 
## Fixed effects:
##             Estimate Std. Error z value Pr(>|z|)   
## (Intercept)   0.5524     0.1797   3.074  0.00211 **
## webpageold   -0.5155     0.1920  -2.685  0.00726 **
## ---
## Signif. codes:  0 '***' 0.001 '**' 0.01 '*' 0.05 '.' 0.1 ' ' 1
## 
## Correlation of Fixed Effects:
##            (Intr)
## webpageold -0.400
# library(lmerTest)


rawIL <- read.csv("./RInputFiles/ILData.csv")
ILdata <- rawIL
str(ILdata)
## 'data.frame':    1808 obs. of  4 variables:
##  $ age   : Factor w/ 4 levels "15_19","20_24",..: 1 1 1 1 1 1 1 1 1 1 ...
##  $ year  : int  0 0 0 0 0 0 0 0 0 0 ...
##  $ county: Factor w/ 47 levels "ALEXANDER","BROWN",..: 1 2 3 4 5 6 7 8 9 10 ...
##  $ count : int  0 0 0 5 0 7 0 4 0 12 ...
# Age goes before year
modelOut <- lme4::glmer(count ~ age + year + (year|county), family = 'poisson', data = ILdata)
## Warning in checkConv(attr(opt, "derivs"), opt$par, ctrl = control
## $checkConv, : Model failed to converge with max|grad| = 0.00144074 (tol =
## 0.001, component 1)
summary(modelOut)
## Generalized linear mixed model fit by maximum likelihood (Laplace
##   Approximation) [glmerMod]
##  Family: poisson  ( log )
## Formula: count ~ age + year + (year | county)
##    Data: ILdata
## 
##      AIC      BIC   logLik deviance df.resid 
##   3215.6   3259.6  -1599.8   3199.6     1800 
## 
## Scaled residuals: 
##     Min      1Q  Median      3Q     Max 
## -2.4511 -0.0151 -0.0056 -0.0022  4.0053 
## 
## Random effects:
##  Groups Name        Variance Std.Dev. Corr 
##  county (Intercept) 129.9459 11.3994       
##         year          0.0648  0.2546  -1.00
## Number of obs: 1808, groups:  county, 47
## 
## Fixed effects:
##              Estimate Std. Error z value Pr(>|z|)    
## (Intercept) -10.76258    2.13022  -5.052 4.36e-07 ***
## age20_24     -0.04152    0.03690  -1.125    0.261    
## age25_29     -1.16262    0.05290 -21.976  < 2e-16 ***
## age30_34     -2.28278    0.08487 -26.898  < 2e-16 ***
## year          0.32708    0.25422   1.287    0.198    
## ---
## Signif. codes:  0 '***' 0.001 '**' 0.01 '*' 0.05 '.' 0.1 ' ' 1
## 
## Correlation of Fixed Effects:
##          (Intr) a20_24 a25_29 a30_34
## age20_24 -0.008                     
## age25_29 -0.006  0.341              
## age30_34 -0.004  0.213  0.148       
## year     -0.764  0.000  0.000  0.000
## convergence code: 0
## Model failed to converge with max|grad| = 0.00144074 (tol = 0.001, component 1)
# Extract out fixed effects
lme4::fixef(modelOut)
##  (Intercept)     age20_24     age25_29     age30_34         year 
## -10.76258497  -0.04151848  -1.16262225  -2.28277972   0.32708039
# Extract out random effects 
lme4::ranef(modelOut)
## $county
##            (Intercept)         year
## ALEXANDER   -0.2847724  0.006331741
## BROWN       -0.2847724  0.006331741
## CALHOUN     -0.2847724  0.006331741
## CARROLL     12.2418514 -0.260423999
## CASS        -0.2847724  0.006331741
## CLARK       12.2137668 -0.268553354
## CLAY        -0.2847724  0.006331741
## CRAWFORD    12.5037407 -0.265752695
## CUMBERLAND  -0.2847724  0.006331741
## DE WITT     12.7456078 -0.277675211
## DOUGLAS     13.0751590 -0.306329903
## EDGAR       12.3642794 -0.283606045
## EDWARDS     -0.2847724  0.006331741
## FAYETTE     12.8094530 -0.273060474
## FORD        -0.2847724  0.006331741
## GALLATIN    -0.2847724  0.006331741
## GREENE      -0.2847724  0.006331741
## HAMILTON    -0.2847724  0.006331741
## HANCOCK     12.8581265 -0.305650287
## HARDIN      -0.2847724  0.006331741
## HENDERSON   -0.2847724  0.006331741
## IROQUOIS    13.1616741 -0.311372907
## JASPER      -0.2847724  0.006331741
## JERSEY      12.9202747 -0.272284048
## JO DAVIESS  12.7409389 -0.289747791
## JOHNSON     -0.2847724  0.006331741
## LAWRENCE    12.3713561 -0.268571236
## MARSHALL    -0.2847724  0.006331741
## MASON       -0.2847724  0.006331741
## MENARD      -0.2180916  0.004849989
## MERCER      12.7534193 -0.271678572
## MOULTRIE    -0.2180916  0.004849989
## PIATT       12.5653132 -0.296687752
## PIKE        12.5310614 -0.259211299
## POPE        -0.2180916  0.004849989
## PULASKI     -0.2180916  0.004849989
## PUTNAM      -0.2180916  0.004849989
## RICHLAND    12.0350865 -0.273928951
## SCHUYLER    -0.2180916  0.004849989
## SCOTT       -0.2180916  0.004849989
## SHELBY      12.5183293 -0.283472292
## STARK       -0.2180916  0.004849989
## UNION       13.1465272 -0.308673332
## WABASH      -0.2180916  0.004849989
## WASHINGTON  -0.2180916  0.004849989
## WAYNE       12.1148896 -0.253234752
## WHITE       -0.2180916  0.004849989
# Run code to see one method for plotting the data
ggplot(data = ILdata, aes(x = year, y = count, group = county)) +
    geom_line() +
    facet_grid(age ~ . ) +
    stat_smooth( method = 'glm',
                method.args = list( family = "poisson"), se = FALSE,
                alpha = 0.5) +
    theme_minimal()


Chapter 4 - Repeated Measures

An introduction to repeated measures:

  • Sampling the same thing over time is a repeated measure, a specific example of a mixed effects model
    • Follow the same individual through time - cohorts allow for controlling for individuality
    • The paired t-test is often used for assessing a repeated measures dataset - t.test(x1, x2, paired=TRUE) # x1 and x2 need to be the same length and each element needs to be the same individual
  • Repeated measures ANOVA is a conceptual extension of the paired t-test - are the means constant over time
    • anova(lmer(y ~ time + (1|individual)))
    • Can be used with glmer() also
    • Note that degrees of freedom is still an open question - different packages calculate this differently

Sleep study:

  • Applying LMER to the sleep study dataset - impact of drugs on sleep patterns for 10 patients followed over time
    • This is the classic “Student” dataset due to Guinness at the time not allowing its employees to publish
    • Ho will be that the amount of sleep does not vary with the treatments
    • Modeling will be done using a linear mixed model
  • Modeling approach - iteratively;
    • EDA
    • Simple regression
    • Model of interest
    • Extract information from model
    • Visualize final data

Hate in NY state?

  • Change in rate of hate crimes over time by county - available from data.gov for 2010-2016
  • Level of technical details in reporting should vary significantly by audience - blend data in to story for wider audiences, while being reporducible/technical for a scientifc audience

Wrap up:

  • Hiearchical data, mixed effects models, case studies
  • Start with the LME4 documentation for additional explorations and details

Example code includes:

y <- c(0.23, 2.735, -0.038, 6.327, -0.643, 1.69, -1.378, -1.228, -0.252, 2.014, -0.073, 6.101, 0.213, 3.127, -0.29, 8.395, -0.33, 2.735, 0.223, 1.301)
treat <- rep(c("before", "after"), times=10)
x <- rep(letters[1:10], each=2)

# Run a standard, non-paired t-test
t.test(y[treat == "before"], y[treat == "after"], paired = FALSE)
## 
##  Welch Two Sample t-test
## 
## data:  y[treat == "before"] and y[treat == "after"]
## t = -3.9043, df = 9.5409, p-value = 0.003215
## alternative hypothesis: true difference in means is not equal to 0
## 95 percent confidence interval:
##  -5.594744 -1.512256
## sample estimates:
## mean of x mean of y 
##   -0.2338    3.3197
# Run a standard, paired t-test
t.test(y[treat == "before"], y[treat == "after"], paired = TRUE)
## 
##  Paired t-test
## 
## data:  y[treat == "before"] and y[treat == "after"]
## t = -4.2235, df = 9, p-value = 0.002228
## alternative hypothesis: true difference in means is not equal to 0
## 95 percent confidence interval:
##  -5.456791 -1.650209
## sample estimates:
## mean of the differences 
##                 -3.5535
library(lmerTest)
## Loading required package: lme4
## Loading required package: Matrix
## 
## Attaching package: 'Matrix'
## The following object is masked from 'package:tidyr':
## 
##     expand
## 
## Attaching package: 'lmerTest'
## The following object is masked from 'package:lme4':
## 
##     lmer
## The following object is masked from 'package:stats':
## 
##     step
library(lme4)

# Run the paired-test like before
t.test(y[treat == "before"], y[treat == "after"], paired = TRUE)
## 
##  Paired t-test
## 
## data:  y[treat == "before"] and y[treat == "after"]
## t = -4.2235, df = 9, p-value = 0.002228
## alternative hypothesis: true difference in means is not equal to 0
## 95 percent confidence interval:
##  -5.456791 -1.650209
## sample estimates:
## mean of the differences 
##                 -3.5535
# Run a repeated-measures ANOVA
anova(lmer( y ~ treat + (1|x)))
## Type III Analysis of Variance Table with Satterthwaite's method
##       Sum Sq Mean Sq NumDF DenDF F value   Pr(>F)   
## treat 63.137  63.137     1     9  17.838 0.002228 **
## ---
## Signif. codes:  0 '***' 0.001 '**' 0.01 '*' 0.05 '.' 0.1 ' ' 1
data(sleepstudy, package="lme4")
str(sleepstudy)
## 'data.frame':    180 obs. of  3 variables:
##  $ Reaction: num  250 259 251 321 357 ...
##  $ Days    : num  0 1 2 3 4 5 6 7 8 9 ...
##  $ Subject : Factor w/ 18 levels "308","309","310",..: 1 1 1 1 1 1 1 1 1 1 ...
# Plot the data
ggplot(data = sleepstudy) +
    geom_line(aes(x = Days, y = Reaction, group = Subject)) +
    stat_smooth(aes(x = Days, y = Reaction), method = 'lm', size = 3, se = FALSE)

# Build a lm 
lm( Reaction ~ Days, data = sleepstudy)
## 
## Call:
## lm(formula = Reaction ~ Days, data = sleepstudy)
## 
## Coefficients:
## (Intercept)         Days  
##      251.41        10.47
# Build a lmer
(lmerOut <- lmer( Reaction ~ Days + (1|Subject), data = sleepstudy))
## Linear mixed model fit by REML ['lmerModLmerTest']
## Formula: Reaction ~ Days + (1 | Subject)
##    Data: sleepstudy
## REML criterion at convergence: 1786.465
## Random effects:
##  Groups   Name        Std.Dev.
##  Subject  (Intercept) 37.12   
##  Residual             30.99   
## Number of obs: 180, groups:  Subject, 18
## Fixed Effects:
## (Intercept)         Days  
##      251.41        10.47
# The lmer model you built during the previous exercise has been saved as lmerOut
# During this exercise, you will examine the effects of drug type using both an ANOVA framework and a regression framework

# Run an anova
anova(lmerOut)
## Type III Analysis of Variance Table with Satterthwaite's method
##      Sum Sq Mean Sq NumDF DenDF F value    Pr(>F)    
## Days 162703  162703     1   161   169.4 < 2.2e-16 ***
## ---
## Signif. codes:  0 '***' 0.001 '**' 0.01 '*' 0.05 '.' 0.1 ' ' 1
# Look at the regression coefficients
summary(lmerOut)
## Linear mixed model fit by REML. t-tests use Satterthwaite's method [
## lmerModLmerTest]
## Formula: Reaction ~ Days + (1 | Subject)
##    Data: sleepstudy
## 
## REML criterion at convergence: 1786.5
## 
## Scaled residuals: 
##     Min      1Q  Median      3Q     Max 
## -3.2257 -0.5529  0.0109  0.5188  4.2506 
## 
## Random effects:
##  Groups   Name        Variance Std.Dev.
##  Subject  (Intercept) 1378.2   37.12   
##  Residual              960.5   30.99   
## Number of obs: 180, groups:  Subject, 18
## 
## Fixed effects:
##             Estimate Std. Error       df t value Pr(>|t|)    
## (Intercept) 251.4051     9.7467  22.8102   25.79   <2e-16 ***
## Days         10.4673     0.8042 161.0000   13.02   <2e-16 ***
## ---
## Signif. codes:  0 '***' 0.001 '**' 0.01 '*' 0.05 '.' 0.1 ' ' 1
## 
## Correlation of Fixed Effects:
##      (Intr)
## Days -0.371
# Read in NY hate data
rawHate <- read.csv("./RInputFiles/hateNY.csv")
hate <- rawHate
str(hate)
## 'data.frame':    233 obs. of  4 variables:
##  $ Year          : int  2010 2011 2012 2013 2014 2015 2016 2013 2010 2011 ...
##  $ County        : Factor w/ 59 levels "Albany","Allegany",..: 1 1 1 1 1 1 1 2 3 3 ...
##  $ TotalIncidents: int  13 7 5 3 3 3 3 1 22 11 ...
##  $ Year2         : int  0 1 2 3 4 5 6 3 0 1 ...
ggplot( data = hate, aes(x = Year, y = TotalIncidents, group = County)) +
    geom_line() + 
    geom_smooth(method = 'lm', se = FALSE)

# During this exercise, you will build a glmer
# Because most of the incidents are small count values, use a Poisson (R function family poisson) error term
# First, build a model using the actually year (variable Year, such as 2006, 2007, etc) - this model will fail
# Second, build a model using the rescaled year (variable Year2, such as 0, 1, 2, etc)
# This demonstrates the importance of considering where the intercept is located when building regression models
# Recall that a variable x can be both a fixed and random effect in a lmer() or glmer(): for example lmer(y ~ x + (x| group) demonstrates this syntax

# glmer with raw Year
glmer(TotalIncidents ~ Year + (Year|County), data = hate, family = "poisson")
## Warning in checkConv(attr(opt, "derivs"), opt$par, ctrl =
## control$checkConv, : Model failed to converge with max|grad| = 0.370207
## (tol = 0.001, component 1)
## Warning in checkConv(attr(opt, "derivs"), opt$par, ctrl = control$checkConv, : Model is nearly unidentifiable: very large eigenvalue
##  - Rescale variables?;Model is nearly unidentifiable: large eigenvalue ratio
##  - Rescale variables?
## Generalized linear mixed model fit by maximum likelihood (Laplace
##   Approximation) [glmerMod]
##  Family: poisson  ( log )
## Formula: TotalIncidents ~ Year + (Year | County)
##    Data: hate
##       AIC       BIC    logLik  deviance  df.resid 
## 1165.2746 1182.5298 -577.6373 1155.2746       228 
## Random effects:
##  Groups Name        Std.Dev. Corr 
##  County (Intercept) 217.8915      
##         Year          0.1084 -1.00
## Number of obs: 233, groups:  County, 59
## Fixed Effects:
## (Intercept)         Year  
##    295.4814      -0.1464  
## convergence code 0; 3 optimizer warnings; 0 lme4 warnings
# glmer with scaled Year, Year2
glmerOut <- glmer(TotalIncidents ~ Year2 + (Year2|County), data = hate, family = "poisson")
summary(glmerOut)
## Generalized linear mixed model fit by maximum likelihood (Laplace
##   Approximation) [glmerMod]
##  Family: poisson  ( log )
## Formula: TotalIncidents ~ Year2 + (Year2 | County)
##    Data: hate
## 
##      AIC      BIC   logLik deviance df.resid 
##   1165.3   1182.5   -577.6   1155.3      228 
## 
## Scaled residuals: 
##     Min      1Q  Median      3Q     Max 
## -2.5434 -0.4864 -0.1562  0.3319  3.1939 
## 
## Random effects:
##  Groups Name        Variance Std.Dev. Corr
##  County (Intercept) 1.16291  1.0784       
##         Year2       0.01175  0.1084   0.02
## Number of obs: 233, groups:  County, 59
## 
## Fixed effects:
##             Estimate Std. Error z value Pr(>|z|)    
## (Intercept)  1.27952    0.16600   7.708 1.28e-14 ***
## Year2       -0.14622    0.03324  -4.398 1.09e-05 ***
## ---
## Signif. codes:  0 '***' 0.001 '**' 0.01 '*' 0.05 '.' 0.1 ' ' 1
## 
## Correlation of Fixed Effects:
##       (Intr)
## Year2 -0.338
# Extract and manipulate data
countyTrend <- ranef(glmerOut)$County
countyTrend$county <- factor(row.names(countyTrend), levels =row.names(countyTrend)[order(countyTrend$Year2)])

# Plot results 
ggplot(data = countyTrend, aes(x = county, y = Year2)) + geom_point() +
    coord_flip() + 
    ylab("Change in hate crimes per year")  +
    xlab("County")


Forecasting Product Demand in R

Chapter 1 - Forecasting Demand with Time Series

Loading data in to an xts object:

  • The xts object will be the buidling block for the course - extensible time series (xts) is an extension of the zoo package - basically, a time index attached to the data matrix
  • Can create dates using dates=seq(as.Date(“MM-DD-YYYY”), length=, by=“weeks”) # to create weekly data
    • xts(myData, order.by=dates) # will create an XTS using dates as the index

ARIMA Time Series 101:

  • AR - AutoRegressive (lags help to determine today’s values - “long memory models”)
  • MA - Moving Average (shocks/errors help to determine today’s shocks/errors - “short memory models” due to dissipation)
  • I - Integrated (does the data have a dependency across time, and how long does it last) - make the time series stationary
    • Stationarity is the idea that effects disipate over time - today has more impact on tomorrow than on time periods in the future
    • Differencing (monthly, seasonal, etc.) the data can be a useful approach for data with stationarity
  • Begin by creating training dataset and valiadation training dataset
  • The auto.arima() function tries to estimate the best ARIMA for a given data series
    • ARIMA(p, d, q) is ARIMA(AR, Differencing, MA)

Forecasting and Evaluating:

  • Can use the ARIMA data to forecast the data forward - extrapolating the signal (forecasting) and estimating the amount of noise (error or CI)
  • The forecast() function in R simplifies the process - forecast(myModel, h=) which will forecast forward h time periods
  • Two common error measurements include MAE (mean average error) and MAPE (mean average percentage error)
    • MAPE is better at putting things on a common scale

Example code includes:

# Read in beverages data
rawBev <- read.csv("./RInputFiles/Bev.csv")
bev <- rawBev
str(bev)
## 'data.frame':    176 obs. of  14 variables:
##  $ M.hi.p  : num  59.2 56.3 56.3 49.3 61.3 ...
##  $ M.lo.p  : num  29.2 26.3 26.2 26.1 25.9 ...
##  $ MET.hi.p: num  63.7 60.3 60.8 55.1 65.1 ...
##  $ MET.lo.p: num  26 25.5 25.7 26.5 25.7 ...
##  $ MET.sp.p: num  50.1 48.8 48.6 47.7 50.8 ...
##  $ SEC.hi.p: num  58.6 54.6 57.9 49.7 63.7 ...
##  $ SEC.lo.p: num  29.2 26.3 26.2 26.1 25.9 ...
##  $ M.hi    : int  458 477 539 687 389 399 392 417 568 583 ...
##  $ M.lo    : int  1455 1756 2296 3240 2252 1901 1939 1999 1798 1558 ...
##  $ MET.hi  : int  2037 1700 1747 2371 1741 2072 2353 2909 3204 2395 ...
##  $ MET.lo  : int  3437 3436 3304 3864 3406 3418 3553 3376 3233 3262 ...
##  $ MET.sp  : int  468 464 490 657 439 453 423 408 501 481 ...
##  $ SEC.hi  : int  156 151 178 217 141 149 134 148 195 170 ...
##  $ SEC.lo  : int  544 624 611 646 624 610 623 599 551 539 ...
# Load xts package 
library(xts)
## Loading required package: zoo
## 
## Attaching package: 'zoo'
## The following objects are masked from 'package:base':
## 
##     as.Date, as.Date.numeric
## 
## Attaching package: 'xts'
## The following objects are masked from 'package:dplyr':
## 
##     first, last
library(forecast)


# Create the dates object as an index for your xts object
dates <- seq(as.Date("2014-01-19"), length = 176, by = "weeks")

# Create an xts object called bev_xts
bev_xts <- xts(bev, order.by = dates)


# Create the individual region sales as their own objects
MET_hi <- bev_xts[,"MET.hi"]
MET_lo <- bev_xts[,"MET.lo"]
MET_sp <- bev_xts[,"MET.sp"]

# Sum the region sales together
MET_t <- MET_hi + MET_lo + MET_sp

# Plot the metropolitan region total sales
plot(MET_t)

# Split the data into training and validation
MET_t_train <- MET_t[index(MET_t) < "2017-01-01"]
MET_t_valid <- MET_t[index(MET_t) >= "2017-01-01"]

# Use auto.arima() function for metropolitan sales
MET_t_model <- auto.arima(MET_t_train)


# Forecast the first 22 weeks of 2017
forecast_MET_t <- forecast(MET_t_model, h = 22)

# Plot this forecast #
plot(forecast_MET_t)

# Convert to numeric for ease
for_MET_t <- as.numeric(forecast_MET_t$mean)
v_MET_t <- as.numeric(MET_t_valid)

# Calculate the MAE
MAE <- mean(abs(for_MET_t - v_MET_t))

# Calculate the MAPE
MAPE <- 100*mean(abs(for_MET_t - v_MET_t)/v_MET_t)

# Print to see how good your forecast is!
print(MAE)
## [1] 898.8403
print(MAPE)
## [1] 17.10332
# Convert your forecast to an xts object
for_dates <- seq(as.Date("2017-01-01"), length = 22, by = "weeks")
for_MET_t_xts <- xts(forecast_MET_t$mean, order.by = for_dates)

# Plot the validation data set
plot(for_MET_t_xts, main = 'Forecast Comparison', ylim = c(4000, 8500))

# Overlay the forecast of 2017
lines(MET_t_valid, col = "blue")

# Plot the validation data set
plot(MET_t_valid, main = 'Forecast Comparison', ylim = c(4000, 8500))

# Overlay the forecast of 2017
lines(for_MET_t_xts, col = "blue")

# Convert the limits to xts objects
lower <- xts(forecast_MET_t$lower[, 2], order.by = for_dates)
upper <- xts(forecast_MET_t$upper[, 2], order.by = for_dates)

# Adding confidence intervals of forecast to plot
lines(lower, col = "blue", lty = "dashed")

lines(upper, col = "blue", lty = "dashed")


Chapter 2 - Components of Demand

Price elasticity:

  • Price is one of the obvious factors that impacts demand, with the relationship called price elasticity (% dDemand / % dPrice)
    • Elastic goods have elasticity > 1, meaning demand changes more quickly (percentage wise) than price
    • Inelastic goods have elasticity < 1, for example gasoline
    • Unit elastic goods have elasticity = 1, meaning that X% increase in price drives X% decrease in demand
    • Linear regression can be employed to estimate the elasticity for a given product - the log-log transform helps get the % vs % coefficients

Seasonal/holiday/promotional effects:

  • Seasonal products are common - can be bought any time of the year, though certain seasons have higher demand (holidays are a common example)
  • Promotions are attempts by companies to influence demand
  • Linear regression can help determine relationships between demand and many other factors
    • If an xts vector has been created for key dates, can merge(train, holiday, fill=0) and the holiday column will be 0 wherever there is no match to holiday

Forecasting with regression:

  • Forecasting with time series is straightforward due to the lag nature of the models - tomorrow forecasts today and today forecasts tomorrow and etc.
  • Forecasting with regression can be more tricky, particularly since we need the future inputs (such as price) in order to predict the future demand
    • Even when there are contractually fixed prices, promotions can effectively create a de facto price change anyways
  • Need to have the same column names in the test/validation dataset as were used in the modeling
    • Then, can use predict(myModel, myData)
    • May need to exponentiate in case the data are currently on the log scale rather than the absolute scale

Example code includes:

bev_xts_train <- bev_xts[index(bev_xts) < "2017-01-01"]
bev_xts_valid <- bev_xts[index(bev_xts) >= "2017-01-01"]

# Save the prices of each product
l_MET_hi_p <- log(as.vector(bev_xts_train[, "MET.hi.p"]))

# Save as a data frame
MET_hi_train <- data.frame(as.vector(log(MET_hi[index(MET_hi) < "2017-01-01"])), l_MET_hi_p)
colnames(MET_hi_train) <- c("log_sales", "log_price")

# Calculate the regression
model_MET_hi <- lm(log_sales ~ log_price, data = MET_hi_train)


# Plot the product's sales
plot(MET_hi)

# Plot the product's price
MET_hi_p <- bev_xts_train[, "MET.hi.p"]
plot(MET_hi_p)

# Create date indices for New Year's week
n.dates <- as.Date(c("2014-12-28", "2015-12-27", "2016-12-25"))

# Create xts objects for New Year's
newyear <- as.xts(rep(1, 3), order.by = n.dates)

# Create sequence of dates for merging
dates_train <- seq(as.Date("2014-01-19"), length = 154, by = "weeks")

# Merge training dates into New Year's object
newyear <- merge(newyear, dates_train, fill = 0)


# Add newyear variable to your data frame
MET_hi_train <- data.frame(MET_hi_train, newyear=as.vector(newyear))

# Build regressions for the product
model_MET_hi_full <- lm(log_sales ~ log_price + newyear, data = MET_hi_train)


# Subset the validation prices #
l_MET_hi_p_valid <- log(as.vector(bev_xts_valid[, "MET.hi.p"]))

# Create a validation data frame #
MET_hi_valid <- data.frame(l_MET_hi_p_valid)
colnames(MET_hi_valid) <- "log_price"


# Predict the log of sales for your high end product
pred_MET_hi <- predict(model_MET_hi, MET_hi_valid)

# Convert predictions out of log scale
pred_MET_hi <- exp(pred_MET_hi)


# Convert to an xts object
dates_valid <- seq(as.Date("2017-01-01"), length = 22, by = "weeks")
pred_MET_hi_xts <- xts(pred_MET_hi, order.by = dates_valid)

# Plot the forecast
plot(pred_MET_hi_xts)

# Calculate and print the MAPE
MET_hi_v <- bev_xts_valid[,"MET.hi"]

MAPE <- 100*mean(abs((pred_MET_hi_xts - MET_hi_v)/MET_hi_v))
print(MAPE)
## [1] 29.57455

Chapter 3 - Blending Regression with Time Series

Residuals from regression model:

  • The residuals from the regression models can be used for further modeling - see if the residuals are related over time, and model them with time series if so
  • Need to start by gathering the residuals and then converting them to an XTS object - explore for patterns in this XTS object

Forecasting residuals:

  • When the residuals are related across time, we can use time series to model the residuals - basically, patterns to the errors provide an opportunity for further modeling
  • Can use auto.arima() on the residuals data, to see what the best ARIMA model for the residuals is
    • Can then forecast the residuals in to the future using forecast(myModel, h=) # h being the time periods to predict forward

Transfer functions and ensembling:

  • Techniques for combining forecasts - single model (transfer function) or averaging of models (ensembling)
  • Demand can be based on both regression (modeling external factors) and time series (residuals)
  • Ensembling is a combination (blend) of the forecasts, with simple averaging being the simplest approach
    • Basically, build a stand-alone time series model and a stand-alone regression model
    • The ensemble forecast can be better or worse than any of the stand-alone models

Example code includes:

# Calculate the residuals from the model
MET_hi_full_res <- resid(model_MET_hi_full)

# Convert the residuals to an xts object
MET_hi_full_res <- xts(MET_hi_full_res, order.by = dates_train)


# Plot the histogram of the residuals
hist(MET_hi_full_res)

# Plot the residuals over time
plot(MET_hi_full_res)

# Build an ARIMA model on the residuals: MET_hi_arima
MET_hi_arima <- auto.arima(MET_hi_full_res)

# Look at a summary of the model
summary(MET_hi_arima)
## Series: MET_hi_full_res 
## ARIMA(2,0,2) with zero mean 
## 
## Coefficients:
##          ar1      ar2      ma1     ma2
##       1.5736  -0.7833  -0.8149  0.2865
## s.e.  0.0992   0.0758   0.1266  0.0941
## 
## sigma^2 estimated as 0.03921:  log likelihood=32.19
## AIC=-54.37   AICc=-53.97   BIC=-39.19
## 
## Training set error measures:
##                         ME      RMSE      MAE       MPE     MAPE      MASE
## Training set -0.0004334041 0.1954382 0.145018 -47.18396 223.0022 0.5227844
##                     ACF1
## Training set -0.01034041
# Forecast 22 weeks with your model: for_MET_hi_arima
for_MET_hi_arima <- forecast(MET_hi_arima, h=22)

# Print first 10 observations
head(for_MET_hi_arima$mean, n = 10)
## Time Series:
## Start = 1079 
## End = 1142 
## Frequency = 0.142857142857143 
##  [1] -0.07662326 -0.10617141 -0.10705342 -0.08529747 -0.05037188
##  [6] -0.01245420  0.01985656  0.04100076  0.04896519  0.04493645
# Convert your forecasts into an xts object
dates_valid <- seq(as.Date("2017-01-01"), length = 22, by = "weeks")
for_MET_hi_arima <- xts(for_MET_hi_arima$mean, order.by = dates_valid)

# Plot the forecast
plot(for_MET_hi_arima)

# Convert your residual forecast to the exponential version
for_MET_hi_arima <- exp(for_MET_hi_arima)

# Multiply your forecasts together!
for_MET_hi_final <- for_MET_hi_arima * pred_MET_hi_xts


# Plot the final forecast - don't touch the options!
plot(for_MET_hi_final, ylim = c(1000, 4300))

# Overlay the validation data set
lines(MET_hi_v, col = "blue")

# Calculate the MAE
MAE <- mean(abs(for_MET_hi_final - MET_hi_v))
print(MAE)
## [1] 481.6678
# Calculate the MAPE
MAPE <- 100 * mean(abs(for_MET_hi_final - MET_hi_v)/MET_hi_v)
print(MAPE)
## [1] 28.82836
# Build an ARIMA model using the auto.arima function
MET_hi_model_arima <- auto.arima(MET_hi)

# Forecast the ARIMA model
for_MET_hi <- forecast(MET_hi_model_arima, h = length(MET_hi_v))

# Save the forecast as an xts object
dates_valid <- seq(as.Date("2017-01-01"), length = 22, by = "weeks")
for_MET_hi_xts <- xts(for_MET_hi$mean, order.by = dates_valid)

# Calculate the MAPE of the forecast
MAPE <- 100 * mean(abs(for_MET_hi_xts - MET_hi_v) / MET_hi_v)
print(MAPE)
## [1] 36.95411
# Ensemble the two forecasts together
for_MET_hi_en <- 0.5 * (for_MET_hi_xts + pred_MET_hi_xts)

# Calculate the MAE and MAPE
MAE <- mean(abs(for_MET_hi_en - MET_hi_v))
print(MAE)
## [1] 533.8911
MAPE <- 100 * mean(abs(for_MET_hi_en - MET_hi_v) / MET_hi_v)
print(MAPE)
## [1] 32.28549

Chapter 4 - Hierarchical Forecasting

Bottom-Up Hierarchical Forecasting:

  • The hierarchical data structuring can be an advantage in forecasting, provided that the data has a natural hierarchy
  • The sum of all the lower-level forecasts should equal the higher-level forecasts
    • Bottom-up: Forecast at the lowest level and aggregate (easiest but requires the most number of forecasts)
    • Top-down: Forecast at the top level and the apply downwards
    • Middle-out: Forecast at the middle levels and then apply both upwards and downwards

Top-Down Hierarchical Forecasting:

  • The top-down forecasting process is typically quicker but less accurate than the bottom-up forecasting process
  • Two techniques available for top-down reconciliation
    • Average of historical proportions - mean percentage that each component contributes to the total (calculated by sub-component such as week)
    • Proportion of historical averages - mean percentage that each component contributes to the total (calculated by aggregate)
  • Reconciled forecasts at lower levels are typically less accurate than the direct forecast of the lower levels

Middle-Out Hierarchical Forecasting:

  • Bottom-up forecasting is higher quality but more time-consuming than top-down forecasting
  • The middle-out forecasting method is a sometimes successful blend of the methods, getting decent accuracy at a lesser time commitment

Wrap up:

  • Using time series to forecast demand forward
  • Incorporating external factors using linear regression
  • Blending time series and regression approaches
  • Top-down, bottom-up, middle-out approaches to aggregation and forecasting at various levels (hierarchical)
  • Can extend by looking at cross-elasticities (impact of competitor pricing)
  • Can better forecast proportions using time series analysis
  • Additional demand forecasting models include neural networks, exponential smoothing, etc.

Example code includes:

# Build a time series model 
MET_sp_model_arima <- auto.arima(MET_sp)

# Forecast the time series model for 22 periods
for_MET_sp <- forecast(MET_sp_model_arima, h=22)

# Create an xts object
for_MET_sp_xts <- xts(for_MET_sp$mean, order.by=dates_valid)

MET_sp_v <- MET_sp["2017"]

# Calculate the MAPE
MAPE <- 100 * mean(abs(for_MET_sp_xts - MET_sp_v) / MET_sp_v)
print(MAPE)
## [1] 6.703272
MET_sp_train <- bev_xts_train %>%
    transform(log_sales = log(MET.sp), log_price=log(MET.sp.p))
MET_sp_train <- MET_sp_train[, c("log_sales", "log_price")]
MET_sp_train$newyear <- 0
MET_sp_train$valentine <- 0
MET_sp_train$christmas <- 0
MET_sp_train$mother <- 0

MET_sp_train[index(MET_sp_train) %in% as.Date(c("2014-12-28", "2015-12-27", "2016-12-25")), "newyear"] <- 1
MET_sp_train[index(MET_sp_train) %in% as.Date(c("2014-02-09", "2015-02-08", "2016-02-07")), "valentine"] <- 1
MET_sp_train[index(MET_sp_train) %in% as.Date(c("2014-12-21", "2015-12-20", "2016-12-18")), "christmas"] <- 1
MET_sp_train[index(MET_sp_train) %in% as.Date(c("2014-05-04", "2015-05-03", "2016-05-01")), "mother"] <- 1


# THE BELOW IS TOTAL NONSENSE
# Build a regression model
model_MET_sp <- lm(log_sales ~ log_price + newyear + valentine + christmas + mother, data = MET_sp_train)


MET_sp_valid <- as.data.frame(bev_xts_valid) %>%
    mutate(log_sales = log(MET.sp), log_price=log(MET.sp.p)) %>%
    select("log_sales", "log_price")
MET_sp_valid$newyear <- 0
MET_sp_valid$valentine <- 0
MET_sp_valid$christmas <- 0
MET_sp_valid$mother <- 0  

MET_sp_valid[7, "valentine"] <- 1
MET_sp_valid[19, "mother"] <- 1
MET_sp_valid$log_sales <- NULL


# Forecast the regression model using the predict function 
pred_MET_sp <- predict(model_MET_sp, MET_sp_valid)

# Exponentiate your predictions and create an xts object
pred_MET_sp <- exp(pred_MET_sp)
pred_MET_sp_xts <- xts(pred_MET_sp, order.by = dates_valid)

# Calculate MAPE
MAPE <- 100*mean(abs((pred_MET_sp_xts - MET_sp_v)/MET_sp_v))
print(MAPE)
## [1] 6.55473
# Ensemble the two forecasts
for_MET_sp_en <- 0.5 * (for_MET_sp_xts + pred_MET_sp_xts)

# Calculate the MAPE
MAPE <- 100 * mean(abs(for_MET_sp_en - MET_sp_v) / MET_sp_v)
print(MAPE)
## [1] 6.048594
# Copy over pred_MET_lo_xts
pred_MET_lo_xts <- xts(c(2960.6, 2974.1, 2943.2, 2948.6, 2915.6, 2736.4, 2953.9, 3199.4, 2934, 2898.7, 3027.7, 3165.9, 3073.1, 2842.7, 2928.7, 3070.2, 2982.2, 3018, 3031.9, 2879.4, 2993.2, 2974.1), order.by=dates_valid)


# Calculate the metropolitan regional sales forecast
for_MET_total <- pred_MET_hi_xts + for_MET_sp_en + pred_MET_lo_xts

# Calculate a validation data set 
MET_t_v <- bev_xts_valid[,"MET.hi"] + bev_xts_valid[,"MET.lo"] + bev_xts_valid[,"MET.sp"]

# Calculate the MAPE
MAPE <- 100 * mean(abs(for_MET_total - MET_t_v) / MET_t_v)
print(MAPE)
## [1] 10.61952
# Create the MET_total data
MET_total <- xts(data.frame(MET.hi=c(5942, 5600, 5541, 6892, 5586, 5943, 6329, 6693, 6938, 6138, 6361, 6378, 5423, 5097, 4937, 5496, 6870, 6626, 6356, 5657, 6577, 7202, 7381, 7404, 7204, 6667, 6153, 6035, 5633, 5283, 5178, 4758, 5058, 5254, 5954, 6166, 6247, 6304, 7202, 6662, 6814, 6174, 5412, 5380, 5674, 6472, 6912, 7404, 8614, 8849, 7174, 6489, 7174, 6555, 6402, 7671, 5012, 4790, 5075, 5238, 5615, 6113, 7706, 7811, 7898, 7232, 6585, 5870, 7084, 5125, 5330, 5553, 6349, 6195, 6271, 5851, 5333, 5854, 5609, 5649, 6051, 6409, 5786, 5190, 5085, 4949, 5151, 5147, 5426, 5509, 6956, 7870, 8224, 6685, 6153, 5802, 5244, 5162, 5036, 5025, 8378, 8944, 7109, 7605, 7846, 7598, 8012, 9551, 6102, 5366, 4932, 4962, 5392, 6194, 7239, 7621, 7460, 7097, 6596, 5848, 8306, 5344, 5848, 6341, 7364, 7269, 7053, 6682, 6971, 7521, 7063, 6298, 6003, 5227, 5047, 4877, 4851, 4628, 4516, 4442, 4935, 5181, 5431, 5866, 5919, 5704, 5957, 6019, 5962, 6021, 5880, 5674, 7439, 7415)),
                 order.by=dates_train
                 )

# Build a regional time series model
MET_t_model_arima <- auto.arima(MET_total)

# Calculate a 2017 forecast for 22 periods
for_MET_t <- forecast(MET_t_model_arima, h=22)

# Make an xts object from your forecast
for_MET_t_xts <- xts(for_MET_t$mean, order.by=dates_valid)

# Calculate the MAPE
MAPE <- 100 * mean(abs(for_MET_t_xts - MET_t_v) / MET_t_v)
print(MAPE)
## [1] 17.10332
# Calculate the average historical proportions
prop_hi <- mean(MET_hi/MET_total)
prop_lo <- mean(MET_lo/MET_total)
prop_sp <- mean(MET_sp/MET_total)

# Distribute out your forecast to each product
for_prop_hi <- prop_hi*for_MET_t_xts
for_prop_lo <- prop_lo*for_MET_t_xts
for_prop_sp <- prop_sp*for_MET_t_xts

# Calculate the MAPE's for each product
MAPE_hi <- 100 * mean(abs(for_prop_hi - MET_hi_v) / MET_hi_v)
print(MAPE_hi)
## [1] 38.7318
MET_lo_v <- bev_xts_valid[,"MET.lo"]
MAPE_lo <- 100 * mean(abs(for_prop_lo - MET_lo_v) / MET_lo_v)
print(MAPE_lo)
## [1] 10.70649
MAPE_sp <- 100 * mean(abs(for_prop_sp - MET_sp_v) / MET_sp_v)
print(MAPE_sp)
## [1] 6.232888
# Calculate the average historical proportions
prop_hi_2 <- mean(MET_hi) / mean(MET_total)
prop_lo_2 <- mean(MET_lo) / mean(MET_total)
prop_sp_2 <- mean(MET_sp) / mean(MET_total)

# Distribute out your forecast to each product
for_prop_hi_2 <- prop_hi_2 * for_MET_t_xts
for_prop_lo_2 <- prop_lo_2 * for_MET_t_xts
for_prop_sp_2 <- prop_sp_2 * for_MET_t_xts

# Calculate the MAPE's for each product
MAPE_hi <- 100 * mean(abs(for_prop_hi_2 - MET_hi_v) / MET_hi_v)
print(MAPE_hi)
## [1] 38.33559
MAPE_lo <- 100 * mean(abs(for_prop_lo_2 - MET_lo_v) / MET_lo_v)
print(MAPE_lo)
## [1] 8.450784
MAPE_sp <- 100 * mean(abs(for_prop_sp_2 - MET_sp_v) / MET_sp_v)
print(MAPE_sp)
## [1] 6.517045
SEC_total <- xts(data.frame(SEC.hi=c(700, 775, 789, 863, 765, 759, 757, 747, 746, 709, 749, 786, 796, 726, 727, 723, 778, 755, 739, 740, 723, 695, 727, 707, 725, 684, 667, 698, 727, 722, 748, 695, 742, 739, 715, 724, 686, 671, 688, 682, 710, 700, 672, 680, 695, 780, 751, 693, 809, 881, 703, 712, 768, 796, 808, 904, 641, 662, 693, 725, 719, 736, 715, 722, 732, 745, 689, 705, 811, 739, 744, 700, 745, 735, 732, 722, 721, 732, 750, 714, 752, 677, 731, 674, 720, 675, 741, 722, 715, 719, 649, 697, 743, 733, 772, 698, 690, 734, 713, 644, 788, 833, 749, 731, 670, 675, 675, 993, 773, 751, 697, 677, 750, 723, 780, 763, 721, 701, 704, 684, 985, 791, 731, 714, 704, 694, 685, 652, 708, 754, 747, 705, 711, 699, 712, 745, 706, 665, 666, 692, 676, 696, 689, 697, 689, 717, 697, 708, 660, 707, 715, 680, 922, 888)), order.by=dates_train
                 )

# Build a time series model for the region
SEC_t_model_arima <- auto.arima(SEC_total)

# Forecast the time series model
for_SEC_t <- forecast(SEC_t_model_arima, h=22)

# Make into an xts object
for_SEC_t_xts <- xts(for_SEC_t$mean, order.by=dates_valid)

SEC_t_v <- bev_xts_valid$SEC.hi + bev_xts_valid$SEC.lo
# Calculate the MAPE
MAPE <- 100 * mean(abs(for_SEC_t_xts - SEC_t_v) / SEC_t_v)
print(MAPE)
## [1] 4.742324
SEC_hi <- bev_xts_train[, "SEC.hi"]
SEC_lo <- bev_xts_train[, "SEC.lo"]
SEC_hi_v <- bev_xts_valid[, "SEC.hi"]
SEC_lo_v <- bev_xts_valid[, "SEC.lo"]

# Calculate the average of historical proportions
prop_hi <- mean(SEC_hi / SEC_total)
prop_lo <- mean(SEC_lo / SEC_total)

# Distribute the forecast
for_prop_hi <- prop_hi * for_SEC_t_xts
for_prop_lo <- prop_lo * for_SEC_t_xts

# Calculate a MAPE for each product
MAPE_hi <- 100 * mean(abs(for_prop_hi - SEC_hi_v) / SEC_hi_v)
print(MAPE_hi)
## [1] 7.988508
MAPE_lo <- 100 * mean(abs(for_prop_lo - SEC_lo_v) / SEC_lo_v)
print(MAPE_lo)
## [1] 5.202529
# Copy over for_M_t_xts data
for_M_t_xts <- xts(c(2207, 2021, 2010, 2052, 2075, 2074, 2065, 2058, 2056, 2055, 2053, 2052, 2050, 2049, 2048, 2047, 2046, 2045, 2044, 2043, 2043, 2042), order.by=dates_valid)

# Calculate the state sales forecast: for_state
for_state = for_SEC_t_xts + for_MET_t_xts + for_M_t_xts

# See the forecasts
for_state
##                [,1]
## 2017-01-01 9996.689
## 2017-01-08 9525.915
## 2017-01-15 9342.760
## 2017-01-22 9269.321
## 2017-01-29 9214.912
## 2017-02-05 9162.005
## 2017-02-12 9118.199
## 2017-02-19 9087.859
## 2017-02-26 9070.209
## 2017-03-05 9058.715
## 2017-03-12 9049.677
## 2017-03-19 9043.959
## 2017-03-26 9038.794
## 2017-04-02 9035.673
## 2017-04-09 9033.250
## 2017-04-16 9031.296
## 2017-04-23 9029.656
## 2017-04-30 9028.227
## 2017-05-07 9026.939
## 2017-05-14 9025.746
## 2017-05-21 9025.617
## 2017-05-28 9024.530

HR Analytics in R: Exploring Employee Data

Chapter 1 - Identifying the Best Recruiting Source

Introduction - Ben Teusch, HR Analytics Consultant:

  • HR analytics has many other names - people analytics, workforce analytics, etc.
  • Identify groups for comparison - high vs. low performers, groups with high vs. low turnover, etc.
    • Exploratory analysis and statistics for each group, including plots of key differences
  • Course is outlines as a series of case studies, with one case per chapter

Recruiting and quality of hire:

  • Where are the best hires coming from, and how can you get more of them
    • Defining quality of hire is challenging - some mix of productivity, satisfaction, retention, performance reviews, etc.
    • Attrition can be defined as the mean of a 1, 0 vector of “did the person leave in the time period T”

Visualizing recruiting data:

  • Helpful for communicating findings to decision makers
  • The geom_col() in ggplot will make a bar chart, with the y aestehtic being the bar height

Example code includes:

# Import the recruitment data
recruitment <- readr::read_csv("./RInputFiles/recruitment_data.csv")
## Parsed with column specification:
## cols(
##   attrition = col_integer(),
##   performance_rating = col_integer(),
##   sales_quota_pct = col_double(),
##   recruiting_source = col_character()
## )
# Look at the first few rows of the dataset
head(recruitment)
## # A tibble: 6 x 4
##   attrition performance_rating sales_quota_pct recruiting_source
##       <int>              <int>           <dbl> <chr>            
## 1         1                  3           1.09  Applied Online   
## 2         0                  3           2.39  <NA>             
## 3         1                  2           0.498 Campus           
## 4         0                  2           2.51  <NA>             
## 5         0                  3           1.42  Applied Online   
## 6         1                  3           0.548 Referral
# Get an overview of the recruitment data
summary(recruitment)
##    attrition     performance_rating sales_quota_pct   recruiting_source 
##  Min.   :0.000   Min.   :1.000      Min.   :-0.7108   Length:446        
##  1st Qu.:0.000   1st Qu.:2.000      1st Qu.: 0.5844   Class :character  
##  Median :0.000   Median :3.000      Median : 1.0701   Mode  :character  
##  Mean   :0.213   Mean   :2.895      Mean   : 1.0826                     
##  3rd Qu.:0.000   3rd Qu.:3.000      3rd Qu.: 1.5325                     
##  Max.   :1.000   Max.   :5.000      Max.   : 3.6667
# See which recruiting sources the company has been using
recruitment %>% 
  count(recruiting_source)
## # A tibble: 5 x 2
##   recruiting_source     n
##   <chr>             <int>
## 1 Applied Online      130
## 2 Campus               56
## 3 Referral             45
## 4 Search Firm          10
## 5 <NA>                205
# Find the average sales quota attainment for each recruiting source
avg_sales <- recruitment %>% 
  group_by(recruiting_source) %>% 
  summarize(avg_sales_quota_pct=mean(sales_quota_pct))

# Display the result
avg_sales
## # A tibble: 5 x 2
##   recruiting_source avg_sales_quota_pct
##   <chr>                           <dbl>
## 1 Applied Online                  1.06 
## 2 Campus                          0.908
## 3 Referral                        1.02 
## 4 Search Firm                     0.887
## 5 <NA>                            1.17
# Find the average attrition for the sales team, by recruiting source, sorted from lowest attrition rate to highest
avg_attrition <- recruitment %>%
  group_by(recruiting_source) %>% 
  summarize(attrition_rate=mean(attrition)) %>%
  arrange(attrition_rate)

# Display the result
avg_attrition
## # A tibble: 5 x 2
##   recruiting_source attrition_rate
##   <chr>                      <dbl>
## 1 <NA>                       0.132
## 2 Applied Online             0.246
## 3 Campus                     0.286
## 4 Referral                   0.333
## 5 Search Firm                0.5
# Plot the bar chart
avg_sales %>% ggplot(aes(x=recruiting_source, y=avg_sales_quota_pct)) + geom_col()

# Plot the bar chart
avg_attrition %>% ggplot(aes(x=recruiting_source, y=attrition_rate)) + geom_col()


Chapter 2 - What is driving low employee engagement

Analyzing employee engagement:

  • Gallup defines engaged employees as those who are involved in, enthusiastic about, and committed to their workplace
  • Survey data are available in the example case study
    • Will use both mutate() and ifelse()
    • The ifelse() is needed for vectors of length > 1 since it can work in a vectorized manner (and is thus OK inside the mutate call)

Visualizing the engagement data:

  • Multiple attributes in a single place can make for a more compelling report
  • The tidyr package is part of the tidyverse, and hslps arrange the data properly for plotting
    • tidyr::gather(columns, key=“key”, value=“value”) will be the package used in this example - pull the data from the columns down to the rows
    • ggplot(survey_gathered, aes(x = key, y = value, fill = department)) + geom_col(position = “dodge”)
    • ggplot(survey_gathered, aes(x = key, y = value, fill = department)) + geom_col(position = “dodge”) + facet_wrap(~ key, scales = “free”)

Are differences meaningful?

  • Can use significance testing to assess likelhood (p-value) that the second sample could have come from the same population as the first sample
    • This course will use t-test (continuous variables) and chi-squared test (categorical variables)
    • t.test(tenure ~ is_manager, data = survey)
    • chisq.test(survey\(left_company, survey\)is_manager) # no data= argument is available in the function

Example code includes:

# Import the data
survey <- readr::read_csv("./RInputFiles/survey_data.csv")
## Parsed with column specification:
## cols(
##   employee_id = col_integer(),
##   department = col_character(),
##   engagement = col_integer(),
##   salary = col_double(),
##   vacation_days_taken = col_integer()
## )
# Get an overview of the data
summary(survey)
##   employee_id      department          engagement       salary      
##  Min.   :   1.0   Length:1470        Min.   :1.00   Min.   : 45530  
##  1st Qu.: 491.2   Class :character   1st Qu.:3.00   1st Qu.: 59407  
##  Median :1020.5   Mode  :character   Median :3.00   Median : 70481  
##  Mean   :1024.9                      Mean   :3.05   Mean   : 74162  
##  3rd Qu.:1555.8                      3rd Qu.:4.00   3rd Qu.: 84763  
##  Max.   :2068.0                      Max.   :5.00   Max.   :164073  
##  vacation_days_taken
##  Min.   : 0.00      
##  1st Qu.: 6.00      
##  Median :10.00      
##  Mean   :11.27      
##  3rd Qu.:16.00      
##  Max.   :38.00
# Examine the counts of the department variable
survey %>% count(department)
## # A tibble: 3 x 2
##   department      n
##   <chr>       <int>
## 1 Engineering   961
## 2 Finance        63
## 3 Sales         446
# Output the average engagement score for each department, sorted
survey %>%
  group_by(department) %>%
  summarize(avg_engagement=mean(engagement)) %>%
  arrange(avg_engagement)
## # A tibble: 3 x 2
##   department  avg_engagement
##   <chr>                <dbl>
## 1 Sales                 2.81
## 2 Engineering           3.15
## 3 Finance               3.24
# Create the disengaged variable and assign the result to survey
survey_disengaged <- survey %>% 
  mutate(disengaged = ifelse(engagement <= 2, 1, 0)) 

survey_disengaged
## # A tibble: 1,470 x 6
##    employee_id department  engagement  salary vacation_days_ta~ disengaged
##          <int> <chr>            <int>   <dbl>             <int>      <dbl>
##  1           1 Sales                3 103264.                 7          0
##  2           2 Engineering          3  80709.                12          0
##  3           4 Engineering          3  60737.                12          0
##  4           5 Engineering          3  99116.                 7          0
##  5           7 Engineering          3  51022.                18          0
##  6           8 Engineering          3  98400.                 9          0
##  7          10 Engineering          3  57106.                18          0
##  8          11 Engineering          1  55065.                 4          1
##  9          12 Engineering          4  77158.                12          0
## 10          13 Engineering          2  48365.                14          1
## # ... with 1,460 more rows
# Summarize the three variables by department
survey_summary <- survey_disengaged %>%
  group_by(department) %>%
  summarize(pct_disengaged=mean(disengaged), 
            avg_salary=mean(salary), 
            avg_vacation_taken=mean(vacation_days_taken)
            )

survey_summary
## # A tibble: 3 x 4
##   department  pct_disengaged avg_salary avg_vacation_taken
##   <chr>                <dbl>      <dbl>              <dbl>
## 1 Engineering          0.206     73576.              12.2 
## 2 Finance              0.190     76652.              11.5 
## 3 Sales                0.330     75074.               9.22
# Gather data for plotting
survey_gathered <- survey_summary %>% 
  gather(key = "measure", value = "value",
         pct_disengaged, avg_salary, avg_vacation_taken)

# Create three bar charts
ggplot(survey_gathered, aes(x=measure, y=value, fill=department)) +
  geom_col(position="dodge") + 
  facet_wrap(~ measure, scales="free")

# Add the in_sales variable
survey_sales <- survey %>%
  mutate(in_sales = ifelse(department == "Sales", "Sales", "Other"), 
         disengaged = ifelse(engagement < 3, 1L, 0L)
         )

# Test the hypothesis using survey_sales
chisq.test(survey_sales$disengaged, survey_sales$in_sales)
## 
##  Pearson's Chi-squared test with Yates' continuity correction
## 
## data:  survey_sales$disengaged and survey_sales$in_sales
## X-squared = 25.524, df = 1, p-value = 4.368e-07
t.test(disengaged ~ in_sales, data=survey_sales)
## 
##  Welch Two Sample t-test
## 
## data:  disengaged by in_sales
## t = -4.862, df = 743.16, p-value = 1.419e-06
## alternative hypothesis: true difference in means is not equal to 0
## 95 percent confidence interval:
##  -0.17479596 -0.07424062
## sample estimates:
## mean in group Other mean in group Sales 
##           0.2050781           0.3295964
# Test the hypothesis using the survey_sales data
t.test(vacation_days_taken ~ in_sales, data = survey_sales)
## 
##  Welch Two Sample t-test
## 
## data:  vacation_days_taken by in_sales
## t = 8.1549, df = 1022.9, p-value = 1.016e-15
## alternative hypothesis: true difference in means is not equal to 0
## 95 percent confidence interval:
##  2.229473 3.642409
## sample estimates:
## mean in group Other mean in group Sales 
##           12.160156            9.224215

Chapter 3 - Are new hires getting paid too much?

Paying new hires fairly:

  • Sometimes, current employees get paid less than new employees, which can drive low engagement and turnover
  • Case study will have a simulated pay dataset available for analysis
  • Can use broom::tidy() to return the outputs in a nicely formatted data frame
    • chisq.test(survey\(in_sales, survey\)disengaged) %>% tidy()

Omitted variable bias:

  • Key assumption of the tests is that the groups are the same, with the exception of the variables being tested
  • Omitted variable bias occurs when both 1) the omitted variable is correlated with the dependent variable, and 2) the omitted variable is correlated with an explanatory variable
    • Omitted variables are often known as confounders
    • Plotting can help to identify the issue, particularly with a stacked (to 100%) bar chart
    • pay %>% ggplot(aes(x = new_hire, fill = department)) + geom_bar(position = “fill”)
    • The geom_bar() object has height that is fully dependent on x, in contrast to geom_col() which has a y-aestehtic

Linear regression helps to test the multivariate impacts of variables:

  • lm(salary ~ new_hire, data = pay) %>% tidy() # single dependent variable
  • lm(salary ~ new_hire + department, data = pay) %>% tidy() # multiple dependent variables
  • lm(salary ~ new_hire + department, data = pay) %>% summary() # more detailed summary of the linear regression

Example code includes:

# Import the data
pay <- readr::read_csv("./RInputFiles/fair_pay_data.csv")
## Parsed with column specification:
## cols(
##   employee_id = col_integer(),
##   department = col_character(),
##   salary = col_double(),
##   new_hire = col_character(),
##   job_level = col_character()
## )
# Get an overview of the data
summary(pay)
##   employee_id      department            salary         new_hire        
##  Min.   :   1.0   Length:1470        Min.   : 43820   Length:1470       
##  1st Qu.: 491.2   Class :character   1st Qu.: 59378   Class :character  
##  Median :1020.5   Mode  :character   Median : 70425   Mode  :character  
##  Mean   :1024.9                      Mean   : 74142                     
##  3rd Qu.:1555.8                      3rd Qu.: 84809                     
##  Max.   :2068.0                      Max.   :164073                     
##   job_level        
##  Length:1470       
##  Class :character  
##  Mode  :character  
##                    
##                    
## 
# Check average salary of new hires and non-new hires
pay %>% 
  group_by(new_hire) %>%
  summarize(avg_salary=mean(salary))
## # A tibble: 2 x 2
##   new_hire avg_salary
##   <chr>         <dbl>
## 1 No           73425.
## 2 Yes          76074.
# Perform the correct statistical test
t.test(salary ~ new_hire, data = pay)
## 
##  Welch Two Sample t-test
## 
## data:  salary by new_hire
## t = -2.3437, df = 685.16, p-value = 0.01938
## alternative hypothesis: true difference in means is not equal to 0
## 95 percent confidence interval:
##  -4869.4242  -429.9199
## sample estimates:
##  mean in group No mean in group Yes 
##          73424.60          76074.28
t.test(salary ~ new_hire, data = pay) %>%
  broom::tidy()
## # A tibble: 1 x 10
##   estimate estimate1 estimate2 statistic p.value parameter conf.low
##      <dbl>     <dbl>     <dbl>     <dbl>   <dbl>     <dbl>    <dbl>
## 1   -2650.    73425.    76074.     -2.34  0.0194      685.   -4869.
## # ... with 3 more variables: conf.high <dbl>, method <chr>,
## #   alternative <chr>
# Create a stacked bar chart
pay %>%
  ggplot(aes(x=new_hire, fill=job_level)) + 
  geom_bar(position="fill")

# Calculate the average salary for each group of interest
pay_grouped <- pay %>% 
  group_by(new_hire, job_level) %>% 
  summarize(avg_salary = mean(salary))
  
# Graph the results using facet_wrap()  
pay_grouped %>%
  ggplot(aes(x=new_hire, y=avg_salary)) + 
  geom_col() + 
  facet_wrap(~ job_level)

# Filter the data to include only hourly employees
pay_filter <- pay %>%
  filter(job_level == "Hourly")

# Test the difference in pay
t.test(salary ~ new_hire, data=pay_filter) %>%
  broom::tidy()
## # A tibble: 1 x 10
##   estimate estimate1 estimate2 statistic p.value parameter conf.low
##      <dbl>     <dbl>     <dbl>     <dbl>   <dbl>     <dbl>    <dbl>
## 1   -1107.    63966.    65073.     -1.75  0.0807      500.   -2349.
## # ... with 3 more variables: conf.high <dbl>, method <chr>,
## #   alternative <chr>
# Run the simple regression
model_simple <- lm(salary ~ new_hire, data = pay)

# Display the summary of model_simple
model_simple %>% 
  summary()
## 
## Call:
## lm(formula = salary ~ new_hire, data = pay)
## 
## Residuals:
##    Min     1Q Median     3Q    Max 
## -32255 -14466  -3681  10740  87998 
## 
## Coefficients:
##             Estimate Std. Error t value Pr(>|t|)    
## (Intercept)  73424.6      577.2 127.200   <2e-16 ***
## new_hireYes   2649.7     1109.4   2.388    0.017 *  
## ---
## Signif. codes:  0 '***' 0.001 '**' 0.01 '*' 0.05 '.' 0.1 ' ' 1
## 
## Residual standard error: 18900 on 1468 degrees of freedom
## Multiple R-squared:  0.003871,   Adjusted R-squared:  0.003193 
## F-statistic: 5.705 on 1 and 1468 DF,  p-value: 0.01704
# Display a tidy summary
model_simple %>% 
  broom::tidy()
## # A tibble: 2 x 5
##   term        estimate std.error statistic p.value
##   <chr>          <dbl>     <dbl>     <dbl>   <dbl>
## 1 (Intercept)   73425.      577.    127.    0     
## 2 new_hireYes    2650.     1109.      2.39  0.0170
# Run the multiple regression
model_multiple <- lm(salary ~ new_hire + job_level, data = pay)

# Display the summary of model_multiple
model_multiple %>% 
  summary()
## 
## Call:
## lm(formula = salary ~ new_hire + job_level, data = pay)
## 
## Residuals:
##    Min     1Q Median     3Q    Max 
## -21013  -7091   -425   6771  44322 
## 
## Coefficients:
##                   Estimate Std. Error t value Pr(>|t|)    
## (Intercept)        64049.3      308.3 207.722   <2e-16 ***
## new_hireYes          782.7      524.8   1.491    0.136    
## job_levelManager   54918.8      915.3  60.001   <2e-16 ***
## job_levelSalaried  26865.6      567.2  47.369   <2e-16 ***
## ---
## Signif. codes:  0 '***' 0.001 '**' 0.01 '*' 0.05 '.' 0.1 ' ' 1
## 
## Residual standard error: 8930 on 1466 degrees of freedom
## Multiple R-squared:  0.7779, Adjusted R-squared:  0.7775 
## F-statistic:  1712 on 3 and 1466 DF,  p-value: < 2.2e-16
# Display a tidy summary
model_multiple %>% 
  broom::tidy()
## # A tibble: 4 x 5
##   term              estimate std.error statistic   p.value
##   <chr>                <dbl>     <dbl>     <dbl>     <dbl>
## 1 (Intercept)         64049.      308.    208.   0.       
## 2 new_hireYes           783.      525.      1.49 1.36e-  1
## 3 job_levelManager    54919.      915.     60.0  0.       
## 4 job_levelSalaried   26866.      567.     47.4  7.39e-298

Chapter 4 - Are performance ratings being given consistently?

Joining HR data:

  • Employee data tend to be stored in different locations, requiring joins (merges) prior to running analyses
    • dplyr::left_join(hr_data, bonus_pay_data, by = “employee_id”)
    • All employees in hr_data will be kept, even if there is no matching record in bonus_pay_data
    • Employee ID (or similar) is by far the best way to join data - names tend to be non-unique and can differ in different systems

Performance ratings and fairness:

  • Performance ratings are inherently subjective and thus prone to bias
  • Unconscious bias is based on the brain’s heuristics, and may include preferences for members of various groups (biases, as reflected in hiring, promotion, etc.)

Logistic regression is especially helpful for modeling binary response variables:

  • glm(high_performer ~ salary, data = hr, family = “binomial”) %>% tidy()
  • glm(high_performer ~ salary + department, data = hr, family = “binomial”) %>% tidy()

Example code includes:

# Import the data
hr_data <- readr::read_csv("./RInputFiles/hr_data.csv")
## Parsed with column specification:
## cols(
##   employee_id = col_integer(),
##   department = col_character(),
##   job_level = col_character(),
##   gender = col_character()
## )
performance_data <- readr::read_csv("./RInputFiles/performance_data.csv")
## Parsed with column specification:
## cols(
##   employee_id = col_integer(),
##   rating = col_integer()
## )
# Examine the datasets
summary(hr_data)
##   employee_id      department         job_level            gender         
##  Min.   :   1.0   Length:1470        Length:1470        Length:1470       
##  1st Qu.: 491.2   Class :character   Class :character   Class :character  
##  Median :1020.5   Mode  :character   Mode  :character   Mode  :character  
##  Mean   :1024.9                                                           
##  3rd Qu.:1555.8                                                           
##  Max.   :2068.0
summary(performance_data)
##   employee_id         rating    
##  Min.   :   1.0   Min.   :1.00  
##  1st Qu.: 491.2   1st Qu.:2.00  
##  Median :1020.5   Median :3.00  
##  Mean   :1024.9   Mean   :2.83  
##  3rd Qu.:1555.8   3rd Qu.:4.00  
##  Max.   :2068.0   Max.   :5.00
# Join the two tables
joined_data <- left_join(hr_data, performance_data, by = "employee_id")

# Examine the result
summary(joined_data)
##   employee_id      department         job_level            gender         
##  Min.   :   1.0   Length:1470        Length:1470        Length:1470       
##  1st Qu.: 491.2   Class :character   Class :character   Class :character  
##  Median :1020.5   Mode  :character   Mode  :character   Mode  :character  
##  Mean   :1024.9                                                           
##  3rd Qu.:1555.8                                                           
##  Max.   :2068.0                                                           
##      rating    
##  Min.   :1.00  
##  1st Qu.:2.00  
##  Median :3.00  
##  Mean   :2.83  
##  3rd Qu.:4.00  
##  Max.   :5.00
# Check whether the average performance rating differs by gender 
joined_data %>%
  group_by(gender) %>%
  summarize(avg_rating = mean(rating))
## # A tibble: 2 x 2
##   gender avg_rating
##   <chr>       <dbl>
## 1 Female       2.75
## 2 Male         2.92
# Add the high_performer column
performance <- joined_data %>%  
  mutate(high_performer = ifelse(rating >= 4, 1, 0))

# Test whether one gender is more likely to be a high performer
chisq.test(performance$gender, performance$high_performer)   
## 
##  Pearson's Chi-squared test with Yates' continuity correction
## 
## data:  performance$gender and performance$high_performer
## X-squared = 22.229, df = 1, p-value = 2.42e-06
# Do the same test, and tidy the output
chisq.test(performance$gender, performance$high_performer) %>% broom::tidy()
## # A tibble: 1 x 4
##   statistic   p.value parameter method                                    
##       <dbl>     <dbl>     <int> <chr>                                     
## 1      22.2   2.42e-6         1 Pearson's Chi-squared test with Yates' co~
# Visualize the distribution of high_performer by gender
performance %>%
  ggplot(aes(x=gender, fill=factor(high_performer))) + 
  geom_bar(position="fill")

# Visualize the distribution of all ratings by gender
performance %>%
  ggplot(aes(x=gender, fill=factor(rating))) + 
  geom_bar(position="fill")

# Visualize the distribution of job_level by gender
performance %>%
  ggplot(aes(x = gender, fill = job_level)) +
  geom_bar(position = "fill")

# Test whether men and women have different job level distributions
chisq.test(performance$gender, performance$job_level) 
## 
##  Pearson's Chi-squared test
## 
## data:  performance$gender and performance$job_level
## X-squared = 44.506, df = 2, p-value = 2.166e-10
# Visualize the distribution of high_performer by gender, faceted by job level
performance %>%
  ggplot(aes(x = gender, fill = factor(high_performer))) +
  geom_bar(position = "fill") + 
  facet_wrap(~ job_level)

# Run a simple logistic regression
logistic_simple <- glm(high_performer ~ gender, family = "binomial", data = performance) 

# View the result with summary()
logistic_simple %>%
  summary()
## 
## Call:
## glm(formula = high_performer ~ gender, family = "binomial", data = performance)
## 
## Deviance Residuals: 
##     Min       1Q   Median       3Q      Max  
## -0.8871  -0.8871  -0.6957   1.4986   1.7535  
## 
## Coefficients:
##             Estimate Std. Error z value Pr(>|z|)    
## (Intercept) -1.29540    0.08813 -14.699  < 2e-16 ***
## genderMale   0.56596    0.11921   4.748 2.06e-06 ***
## ---
## Signif. codes:  0 '***' 0.001 '**' 0.01 '*' 0.05 '.' 0.1 ' ' 1
## 
## (Dispersion parameter for binomial family taken to be 1)
## 
##     Null deviance: 1709.0  on 1469  degrees of freedom
## Residual deviance: 1686.1  on 1468  degrees of freedom
## AIC: 1690.1
## 
## Number of Fisher Scoring iterations: 4
# View a tidy version of the result
logistic_simple %>%
  broom::tidy()
## # A tibble: 2 x 5
##   term        estimate std.error statistic  p.value
##   <chr>          <dbl>     <dbl>     <dbl>    <dbl>
## 1 (Intercept)   -1.30     0.0881    -14.7  6.58e-49
## 2 genderMale     0.566    0.119       4.75 2.06e- 6
# Run a multiple logistic regression
logistic_multiple <- glm(high_performer ~ gender + job_level, family = "binomial", data = performance)

# View the result with summary() or tidy()
logistic_multiple %>% broom::tidy()
## # A tibble: 4 x 5
##   term              estimate std.error statistic  p.value
##   <chr>                <dbl>     <dbl>     <dbl>    <dbl>
## 1 (Intercept)         -1.69      0.103    -16.5  2.74e-61
## 2 genderMale           0.319     0.129      2.47 1.34e- 2
## 3 job_levelManager     2.74      0.251     10.9  1.01e-27
## 4 job_levelSalaried    1.10      0.141      7.82 5.17e-15

Chapter 5 - Improving employee safety with data

Employee safety - looking at accident rates and drivers:

  • Requires joining data on multiple variables
    • joined_data <- left_join(hr_data, safety_data, by = c(“year”, “employee_id”))
    • joined_data %>% filter(is.na(accident_time)) # use is.na() instead

Focusing on the location of interest:

  • May want to run comparisons of the same location over time
  • May want to assess differences by locations to see if they may be explanatory variables

Explaining the increase in accidents:

  • Can use multiple regression to help test for explanatory variables that impact the accident rate

Wrap up:

  • Key tools from the Tidyverse (ggplot2, broom, dplyr, etc.) to assess HR data
  • Analytics usage within HR, including differences in HR and other data
  • Can apply additional data science techniques on HR data

Example code includes:

# Import the data 
hr_data <- readr::read_csv("./RInputFiles/hr_data_2.csv")
## Parsed with column specification:
## cols(
##   year = col_integer(),
##   employee_id = col_integer(),
##   location = col_character(),
##   overtime_hours = col_integer()
## )
accident_data <- readr::read_csv("./RInputFiles/accident_data.csv")
## Parsed with column specification:
## cols(
##   year = col_integer(),
##   employee_id = col_integer(),
##   accident_type = col_character()
## )
# Create hr_joined with left_join() and mutate()
hr_joined <- left_join(hr_data, accident_data, by=c("year", "employee_id")) %>% 
  mutate(had_accident=ifelse(is.na(accident_type), 0, 1))
  
hr_joined
## # A tibble: 2,940 x 6
##     year employee_id location    overtime_hours accident_type had_accident
##    <int>       <int> <chr>                <int> <chr>                <dbl>
##  1  2016           1 Northwood               14 <NA>                     0
##  2  2017           1 Northwood                8 Mild                     1
##  3  2016           2 East Valley              8 <NA>                     0
##  4  2017           2 East Valley             11 <NA>                     0
##  5  2016           4 East Valley              4 <NA>                     0
##  6  2017           4 East Valley              2 Mild                     1
##  7  2016           5 West River               0 <NA>                     0
##  8  2017           5 West River              17 <NA>                     0
##  9  2016           7 West River              21 <NA>                     0
## 10  2017           7 West River               9 <NA>                     0
## # ... with 2,930 more rows
# Find accident rate for each year
hr_joined %>% 
  group_by(year) %>% 
  summarize(accident_rate = mean(had_accident))
## # A tibble: 2 x 2
##    year accident_rate
##   <int>         <dbl>
## 1  2016        0.0850
## 2  2017        0.120
# Test difference in accident rate between years
chisq.test(hr_joined$year, hr_joined$had_accident)
## 
##  Pearson's Chi-squared test with Yates' continuity correction
## 
## data:  hr_joined$year and hr_joined$had_accident
## X-squared = 9.5986, df = 1, p-value = 0.001947
# Which location had the highest acccident rate?
hr_joined %>%
  group_by(location) %>%
  summarize(accident_rate=mean(had_accident)) %>%
  arrange(-accident_rate)
## # A tibble: 4 x 2
##   location    accident_rate
##   <chr>               <dbl>
## 1 East Valley        0.128 
## 2 Southfield         0.103 
## 3 West River         0.0961
## 4 Northwood          0.0831
# Compare annual accident rates by location
accident_rates <- hr_joined %>% 
  group_by(location, year) %>% 
  summarize(accident_rate = mean(had_accident))
  
accident_rates
## # A tibble: 8 x 3
## # Groups:   location [?]
##   location     year accident_rate
##   <chr>       <int>         <dbl>
## 1 East Valley  2016        0.113 
## 2 East Valley  2017        0.143 
## 3 Northwood    2016        0.0644
## 4 Northwood    2017        0.102 
## 5 Southfield   2016        0.0764
## 6 Southfield   2017        0.130 
## 7 West River   2016        0.0824
## 8 West River   2017        0.110
# Graph it
accident_rates %>% 
  ggplot(aes(factor(year), accident_rate)) +
  geom_col() +
  facet_wrap(~location)

# Filter out the other locations
southfield <- hr_joined %>% 
  filter(location == "Southfield")

# Find the average overtime hours worked by year
southfield %>%
  group_by(year) %>% 
  summarize(average_overtime_hours = mean(overtime_hours))
## # A tibble: 2 x 2
##    year average_overtime_hours
##   <int>                  <dbl>
## 1  2016                   8.67
## 2  2017                   9.97
# Test difference in Southfield's overtime hours between years
t.test(overtime_hours ~ year, data=southfield) 
## 
##  Welch Two Sample t-test
## 
## data:  overtime_hours by year
## t = -1.6043, df = 595.46, p-value = 0.1092
## alternative hypothesis: true difference in means is not equal to 0
## 95 percent confidence interval:
##  -2.904043  0.292747
## sample estimates:
## mean in group 2016 mean in group 2017 
##           8.667774           9.973422
# Import the survey data
survey_data <- readr::read_csv("./RInputFiles/survey_data_2.csv")
## Parsed with column specification:
## cols(
##   year = col_integer(),
##   employee_id = col_integer(),
##   engagement = col_integer()
## )
# Create the safety dataset
safety <- left_join(hr_joined, survey_data, by=c("employee_id", "year")) %>%
  mutate(disengaged=ifelse(engagement <= 2, 1, 0), year=factor(year))


# Visualize the difference in % disengaged by year in Southfield
safety %>% 
    filter(location=="Southfield") %>%
    ggplot(aes(x = year, fill = factor(disengaged))) +
    geom_bar(position = "fill")

# Test whether one year had significantly more disengaged employees
southSafety <- safety %>% 
    filter(location=="Southfield")
chisq.test(southSafety$disengaged, southSafety$year)
## 
##  Pearson's Chi-squared test with Yates' continuity correction
## 
## data:  southSafety$disengaged and southSafety$year
## X-squared = 7.1906, df = 1, p-value = 0.007329
# Filter out Southfield
other_locs <- safety %>% 
  filter(location != "Southfield")

# Test whether one year had significantly more overtime hours worked
t.test(overtime_hours ~ year, data = other_locs) 
## 
##  Welch Two Sample t-test
## 
## data:  overtime_hours by year
## t = -0.48267, df = 2320.3, p-value = 0.6294
## alternative hypothesis: true difference in means is not equal to 0
## 95 percent confidence interval:
##  -0.9961022  0.6026035
## sample estimates:
## mean in group 2016 mean in group 2017 
##           9.278015           9.474765
# Test whether one year had significantly more disengaged employees
chisq.test(other_locs$year, other_locs$disengaged)
## 
##  Pearson's Chi-squared test with Yates' continuity correction
## 
## data:  other_locs$year and other_locs$disengaged
## X-squared = 0.0023091, df = 1, p-value = 0.9617
# Use multiple regression to test the impact of year and disengaged on accident rate in Southfield
regression <- glm(had_accident ~ year + disengaged, family = "binomial", data = southSafety)

# Examine the output
regression %>% broom::tidy()
## # A tibble: 3 x 5
##   term        estimate std.error statistic  p.value
##   <chr>          <dbl>     <dbl>     <dbl>    <dbl>
## 1 (Intercept)   -2.92      0.250    -11.7  1.74e-31
## 2 year2017       0.440     0.285      1.55 1.22e- 1
## 3 disengaged     1.44      0.278      5.19 2.13e- 7

Supervised Learning in R: Case Studies

Chapter 1 - Cars Data

Making predictions using machine learning:

  • Course focuses on applied skills from predictive learning, using regression and classification as well as EDA
    • Regression tends to be for predicting continuous, numeric variables
    • Classification tends to be for predicting categorical variables
  • Case studies include 1) fuel efficiency, 2) Stack Overflow developer survey, 3) voter turnout, and 4) ages of nuns
  • The fuel efficiency data is stored in cars2018 and is based on data from the US Department of Energy
    • Variables names with spaces can be handled by surrounding them with backticks
    • Tidyverse includes tibble, readr, ggplot2, dplyr, tidyr, purrr, etc. - can be loaded as a package using library(tidyverse)

Getting started with caret:

  • The caret package is useful for predictive modeling - full process including the test/train split for the raw dataset
    • in_train <- createDataPartition(cars_vars$Aspiration, p = 0.8, list = FALSE) # will stratify on ‘Aspiration’ variable
    • training <- cars_vars[in_train,]
    • testing <- cars_vars[-in_train,]
  • Can then train the model using only the training dataset
    • fit_lm <- train(log(MPG) ~ ., method = “lm”, data=training, trControl=trainControl(method = “none”))
    • Can then use the yardstick package to assess the quality of the model

Sampling data:

  • Bootstrap resampling means sampling with replacement, and then fitting on the resampled dataset (run multiple times)
    • cars_rf_bt <- train(log(MPG) ~ ., method = “rf”, data = training, trControl = trainControl(method = “boot”)) # default 25 resamples
    • Can both visualize the models and assess the model statistically

Example code includes:

cars2018 <- readr::read_csv("./RInputFiles/cars2018.csv")
## Parsed with column specification:
## cols(
##   Model = col_character(),
##   `Model Index` = col_integer(),
##   Displacement = col_double(),
##   Cylinders = col_integer(),
##   Gears = col_integer(),
##   Transmission = col_character(),
##   MPG = col_integer(),
##   Aspiration = col_character(),
##   `Lockup Torque Converter` = col_character(),
##   Drive = col_character(),
##   `Max Ethanol` = col_integer(),
##   `Recommended Fuel` = col_character(),
##   `Intake Valves Per Cyl` = col_integer(),
##   `Exhaust Valves Per Cyl` = col_integer(),
##   `Fuel injection` = col_character()
## )
str(cars2018, give.attr = FALSE)
## Classes 'tbl_df', 'tbl' and 'data.frame':    1144 obs. of  15 variables:
##  $ Model                  : chr  "Acura NSX" "ALFA ROMEO 4C" "Audi R8 AWD" "Audi R8 RWD" ...
##  $ Model Index            : int  57 410 65 71 66 72 46 488 38 278 ...
##  $ Displacement           : num  3.5 1.8 5.2 5.2 5.2 5.2 2 3 8 6.2 ...
##  $ Cylinders              : int  6 4 10 10 10 10 4 6 16 8 ...
##  $ Gears                  : int  9 6 7 7 7 7 6 7 7 8 ...
##  $ Transmission           : chr  "Manual" "Manual" "Manual" "Manual" ...
##  $ MPG                    : int  21 28 17 18 17 18 26 20 11 18 ...
##  $ Aspiration             : chr  "Turbocharged/Supercharged" "Turbocharged/Supercharged" "Naturally Aspirated" "Naturally Aspirated" ...
##  $ Lockup Torque Converter: chr  "Y" "Y" "Y" "Y" ...
##  $ Drive                  : chr  "All Wheel Drive" "2-Wheel Drive, Rear" "All Wheel Drive" "2-Wheel Drive, Rear" ...
##  $ Max Ethanol            : int  10 10 15 15 15 15 15 10 15 10 ...
##  $ Recommended Fuel       : chr  "Premium Unleaded Required" "Premium Unleaded Required" "Premium Unleaded Recommended" "Premium Unleaded Recommended" ...
##  $ Intake Valves Per Cyl  : int  2 2 2 2 2 2 2 2 2 1 ...
##  $ Exhaust Valves Per Cyl : int  2 2 2 2 2 2 2 2 2 1 ...
##  $ Fuel injection         : chr  "Direct ignition" "Direct ignition" "Direct ignition" "Direct ignition" ...
summary(cars2018)
##     Model            Model Index     Displacement     Cylinders     
##  Length:1144        Min.   :  1.0   Min.   :1.000   Min.   : 3.000  
##  Class :character   1st Qu.: 36.0   1st Qu.:2.000   1st Qu.: 4.000  
##  Mode  :character   Median :108.0   Median :3.000   Median : 6.000  
##                     Mean   :201.3   Mean   :3.087   Mean   : 5.564  
##                     3rd Qu.:323.8   3rd Qu.:3.600   3rd Qu.: 6.000  
##                     Max.   :821.0   Max.   :8.000   Max.   :16.000  
##      Gears        Transmission            MPG        Aspiration       
##  Min.   : 1.000   Length:1144        Min.   :11.0   Length:1144       
##  1st Qu.: 6.000   Class :character   1st Qu.:19.0   Class :character  
##  Median : 7.000   Mode  :character   Median :23.0   Mode  :character  
##  Mean   : 6.935                      Mean   :23.2                     
##  3rd Qu.: 8.000                      3rd Qu.:26.0                     
##  Max.   :10.000                      Max.   :58.0                     
##  Lockup Torque Converter    Drive            Max Ethanol   
##  Length:1144             Length:1144        Min.   :10.00  
##  Class :character        Class :character   1st Qu.:10.00  
##  Mode  :character        Mode  :character   Median :10.00  
##                                             Mean   :15.29  
##                                             3rd Qu.:15.00  
##                                             Max.   :85.00  
##  Recommended Fuel   Intake Valves Per Cyl Exhaust Valves Per Cyl
##  Length:1144        Min.   :1.000         Min.   :1.000         
##  Class :character   1st Qu.:2.000         1st Qu.:2.000         
##  Mode  :character   Median :2.000         Median :2.000         
##                     Mean   :1.926         Mean   :1.922         
##                     3rd Qu.:2.000         3rd Qu.:2.000         
##                     Max.   :2.000         Max.   :2.000         
##  Fuel injection    
##  Length:1144       
##  Class :character  
##  Mode  :character  
##                    
##                    
## 
# Print the cars2018 object
cars2018
## # A tibble: 1,144 x 15
##    Model     `Model Index` Displacement Cylinders Gears Transmission   MPG
##    <chr>             <int>        <dbl>     <int> <int> <chr>        <int>
##  1 Acura NSX            57         3.50         6     9 Manual          21
##  2 ALFA ROM~           410         1.80         4     6 Manual          28
##  3 Audi R8 ~            65         5.20        10     7 Manual          17
##  4 Audi R8 ~            71         5.20        10     7 Manual          18
##  5 Audi R8 ~            66         5.20        10     7 Manual          17
##  6 Audi R8 ~            72         5.20        10     7 Manual          18
##  7 Audi TT ~            46         2.00         4     6 Manual          26
##  8 BMW M4 D~           488         3.00         6     7 Manual          20
##  9 Bugatti ~            38         8.00        16     7 Manual          11
## 10 Chevrole~           278         6.20         8     8 Automatic       18
## # ... with 1,134 more rows, and 8 more variables: Aspiration <chr>,
## #   `Lockup Torque Converter` <chr>, Drive <chr>, `Max Ethanol` <int>,
## #   `Recommended Fuel` <chr>, `Intake Valves Per Cyl` <int>, `Exhaust
## #   Valves Per Cyl` <int>, `Fuel injection` <chr>
# Plot the histogram
ggplot(cars2018, aes(x = MPG)) +
    geom_histogram(bins = 25) +
    labs(y = "Number of cars",
         x = "Fuel efficiency (mpg)")

# Deselect the 2 columns to create cars_vars
cars_vars <- cars2018 %>%
    select(-Model, -`Model Index`)

# Fit a linear model
fit_all <- lm(MPG ~ ., data = cars_vars)

# Print the summary of the model
summary(fit_all)
## 
## Call:
## lm(formula = MPG ~ ., data = cars_vars)
## 
## Residuals:
##     Min      1Q  Median      3Q     Max 
## -8.5261 -1.6473 -0.1096  1.3572 26.5045 
## 
## Coefficients:
##                                                 Estimate Std. Error
## (Intercept)                                    44.539519   1.176283
## Displacement                                   -3.786147   0.264845
## Cylinders                                       0.520284   0.161802
## Gears                                           0.157674   0.069984
## TransmissionCVT                                 4.877637   0.404051
## TransmissionManual                             -1.074608   0.366075
## AspirationTurbocharged/Supercharged            -2.190248   0.267559
## `Lockup Torque Converter`Y                     -2.624494   0.381252
## Drive2-Wheel Drive, Rear                       -2.676716   0.291044
## Drive4-Wheel Drive                             -3.397532   0.335147
## DriveAll Wheel Drive                           -2.941084   0.257174
## `Max Ethanol`                                  -0.007377   0.005898
## `Recommended Fuel`Premium Unleaded Required    -0.403935   0.262413
## `Recommended Fuel`Regular Unleaded Recommended -0.996343   0.272495
## `Intake Valves Per Cyl`                        -1.446107   1.620575
## `Exhaust Valves Per Cyl`                       -2.469747   1.547748
## `Fuel injection`Multipoint/sequential ignition -0.658428   0.243819
##                                                t value Pr(>|t|)    
## (Intercept)                                     37.865  < 2e-16 ***
## Displacement                                   -14.296  < 2e-16 ***
## Cylinders                                        3.216 0.001339 ** 
## Gears                                            2.253 0.024450 *  
## TransmissionCVT                                 12.072  < 2e-16 ***
## TransmissionManual                              -2.935 0.003398 ** 
## AspirationTurbocharged/Supercharged             -8.186 7.24e-16 ***
## `Lockup Torque Converter`Y                      -6.884 9.65e-12 ***
## Drive2-Wheel Drive, Rear                        -9.197  < 2e-16 ***
## Drive4-Wheel Drive                             -10.137  < 2e-16 ***
## DriveAll Wheel Drive                           -11.436  < 2e-16 ***
## `Max Ethanol`                                   -1.251 0.211265    
## `Recommended Fuel`Premium Unleaded Required     -1.539 0.124010    
## `Recommended Fuel`Regular Unleaded Recommended  -3.656 0.000268 ***
## `Intake Valves Per Cyl`                         -0.892 0.372400    
## `Exhaust Valves Per Cyl`                        -1.596 0.110835    
## `Fuel injection`Multipoint/sequential ignition  -2.700 0.007028 ** 
## ---
## Signif. codes:  0 '***' 0.001 '**' 0.01 '*' 0.05 '.' 0.1 ' ' 1
## 
## Residual standard error: 2.916 on 1127 degrees of freedom
## Multiple R-squared:  0.7314, Adjusted R-squared:  0.7276 
## F-statistic: 191.8 on 16 and 1127 DF,  p-value: < 2.2e-16
# Load caret
library(caret)
## Loading required package: lattice
## 
## Attaching package: 'caret'
## The following object is masked from 'package:purrr':
## 
##     lift
# Split the data into training and test sets
set.seed(1234)
in_train <- createDataPartition(cars_vars$Transmission, p = 0.8, list = FALSE)
training <- cars_vars[in_train, ]
testing <- cars_vars[-in_train, ]

# Train a linear regression model
fit_lm <- train(log(MPG) ~ ., method = "lm", data = training,
                trControl = trainControl(method = "none"))

# Print the model object
fit_lm
## Linear Regression 
## 
## 916 samples
##  12 predictor
## 
## No pre-processing
## Resampling: None
# Train a random forest model
fit_rf <- train(log(MPG) ~ ., method = "rf", data = training,
                trControl = trainControl(method = "none"))

# Print the model object
fit_rf
## Random Forest 
## 
## 916 samples
##  12 predictor
## 
## No pre-processing
## Resampling: None
# Create the new columns
results <- training %>%
    mutate(`Linear regression` = predict(fit_lm, training),
           `Random forest` = predict(fit_rf, training))

# Evaluate the performance
yardstick::metrics(results, truth = MPG, estimate = `Linear regression`)
## # A tibble: 1 x 2
##    rmse   rsq
##   <dbl> <dbl>
## 1  20.9 0.702
yardstick::metrics(results, truth = MPG, estimate = `Random forest`)
## # A tibble: 1 x 2
##    rmse   rsq
##   <dbl> <dbl>
## 1  20.9 0.845
# Create the new columns
results <- testing %>%
    mutate(`Linear regression` = predict(fit_lm, testing),
           `Random forest` = predict(fit_rf, testing))

# Evaluate the performance
yardstick::metrics(results, truth = MPG, estimate = `Linear regression`)
## # A tibble: 1 x 2
##    rmse   rsq
##   <dbl> <dbl>
## 1  20.5 0.799
yardstick::metrics(results, truth = MPG, estimate = `Random forest`)
## # A tibble: 1 x 2
##    rmse   rsq
##   <dbl> <dbl>
## 1  20.5 0.880
# Fit the models with bootstrap resampling
cars_lm_bt <- train(log(MPG) ~ ., method = "lm", data = training,
                   trControl = trainControl(method = "boot"))
## Warning in predict.lm(modelFit, newdata): prediction from a rank-deficient
## fit may be misleading

## Warning in predict.lm(modelFit, newdata): prediction from a rank-deficient
## fit may be misleading
cars_rf_bt <- train(log(MPG) ~ ., method = "rf", data = training,
                   trControl = trainControl(method = "boot"))
                   
# Quick look at the models
cars_lm_bt
## Linear Regression 
## 
## 916 samples
##  12 predictor
## 
## No pre-processing
## Resampling: Bootstrapped (25 reps) 
## Summary of sample sizes: 916, 916, 916, 916, 916, 916, ... 
## Resampling results:
## 
##   RMSE       Rsquared   MAE       
##   0.1036278  0.7890514  0.07656104
## 
## Tuning parameter 'intercept' was held constant at a value of TRUE
cars_rf_bt
## Random Forest 
## 
## 916 samples
##  12 predictor
## 
## No pre-processing
## Resampling: Bootstrapped (25 reps) 
## Summary of sample sizes: 916, 916, 916, 916, 916, 916, ... 
## Resampling results across tuning parameters:
## 
##   mtry  RMSE        Rsquared   MAE       
##    2    0.10015480  0.8205322  0.07299305
##    9    0.08758544  0.8466598  0.06129895
##   16    0.09100659  0.8360034  0.06313542
## 
## RMSE was used to select the optimal model using the smallest value.
## The final value used for the model was mtry = 9.
results <- testing %>%
    mutate(`Linear regression` = predict(cars_lm_bt, testing),
           `Random forest` = predict(cars_rf_bt, testing))

yardstick::metrics(results, truth = MPG, estimate = `Linear regression`)
## # A tibble: 1 x 2
##    rmse   rsq
##   <dbl> <dbl>
## 1  20.5 0.799
yardstick::metrics(results, truth = MPG, estimate = `Random forest`)
## # A tibble: 1 x 2
##    rmse   rsq
##   <dbl> <dbl>
## 1  20.5 0.903
results %>%
    gather(Method, Result, `Linear regression`:`Random forest`) %>%
    ggplot(aes(log(MPG), Result, color = Method)) +
    geom_point(size = 1.5, alpha = 0.5) +
    facet_wrap(~Method) +
    geom_abline(lty = 2, color = "gray50") +
    geom_smooth(method = "lm")


Chapter 2 - Stack Overflow Developer Data

Essential copying and pasting from Stack Overflow (largest and most trusted developer community):

  • Annual survey of developer perspectives on Stack Overflow - can be used for predictive modeling
  • Data is made available publicly at insights.stackoverflow.com/survey
  • Key question is “what makes a developer more likely to work remotely” (size of company, geography of employee, etc.)
    • Data are calss imbalanced, with many more Non-Remote employees than Remote employees
    • Best first step is the simplest model - logit, without any tricks
    • simple_glm <- stackoverflow %>% select(-Respondent) %>% glm(Remote ~ ., family = “binomial”, + data = .) # Remote ~ . Means “all variables” while data=. Means from the piped dataset

Dealing with imbalanced data:

  • Class imbalance is a common problem that can negatively impact model performance
    • This dataset has 10x the number of non-remote, which can influence models to just start predicting non-remote in all cases
  • One approach to class imbalance is upsampling, basically running resampling with replacement on the small class until it is the same size as the large class
    • Simple to implement, but with the risk of over-fitting
    • up_train <- upSample(x = select(training, -Remote), y = training$Remote, yname = “Remote”) %>% as_tibble()
    • stack_glm <- train(Remote ~ ., method = “glm”, family = “binomial”, data = training, trControl = trainControl(method = “boot”, sampling = “up”))

Predicting remote status:

  • Classification models can include logistic regression and random forests
    • stack_glm <- train(Remote ~ ., method = “glm”, family = “binomial”, data = training, trControl = trainControl(method = “boot”, sampling = “up”))
    • stack_rf <- train(Remote ~ ., method = “rf”, data = training, trControl = trainControl(method = “boot”, sampling = “up”))
  • Classification models can be evaluated using the confusion matrix
    • confusionMatrix(predict(stack_glm, testing), testing$Remote)
    • yardstick::accuracy(testing_results, truth = Remote, estimate = Logistic regression)
    • yardstick::ppv(testing_results, truth = Remote, estimate = Logistic regression)
    • yardstick::npv(testing_results, truth = Remote, estimate = Logistic regression)

Example code includes:

stackoverflow <- readr::read_csv("./RInputFiles/stackoverflow.csv")
## Parsed with column specification:
## cols(
##   .default = col_logical(),
##   Respondent = col_integer(),
##   Country = col_character(),
##   Salary = col_double(),
##   YearsCodedJob = col_integer(),
##   CompanySizeNumber = col_double(),
##   Remote = col_character(),
##   CareerSatisfaction = col_integer()
## )
## See spec(...) for full column specifications.
stackoverflow$Remote <- factor(stackoverflow$Remote, levels=c("Not remote", "Remote"))
str(stackoverflow, give.attr = FALSE)
## Classes 'tbl_df', 'tbl' and 'data.frame':    6991 obs. of  22 variables:
##  $ Respondent                          : int  3 15 18 19 26 55 62 71 73 77 ...
##  $ Country                             : chr  "United Kingdom" "United Kingdom" "United States" "United States" ...
##  $ Salary                              : num  113750 100000 130000 82500 175000 ...
##  $ YearsCodedJob                       : int  20 20 20 3 16 4 1 1 20 20 ...
##  $ OpenSource                          : logi  TRUE FALSE TRUE FALSE FALSE FALSE ...
##  $ Hobby                               : logi  TRUE TRUE TRUE TRUE TRUE FALSE ...
##  $ CompanySizeNumber                   : num  10000 5000 1000 10000 10000 1000 5000 20 100 1000 ...
##  $ Remote                              : Factor w/ 2 levels "Not remote","Remote": 1 2 2 1 1 1 1 1 2 2 ...
##  $ CareerSatisfaction                  : int  8 8 9 5 7 9 5 8 8 10 ...
##  $ Data scientist                      : logi  FALSE FALSE FALSE FALSE FALSE FALSE ...
##  $ Database administrator              : logi  FALSE FALSE FALSE FALSE FALSE FALSE ...
##  $ Desktop applications developer      : logi  FALSE FALSE FALSE FALSE FALSE FALSE ...
##  $ Developer with stats/math background: logi  FALSE FALSE FALSE FALSE FALSE FALSE ...
##  $ DevOps                              : logi  FALSE FALSE TRUE FALSE FALSE FALSE ...
##  $ Embedded developer                  : logi  FALSE TRUE TRUE FALSE FALSE FALSE ...
##  $ Graphic designer                    : logi  FALSE FALSE FALSE FALSE FALSE FALSE ...
##  $ Graphics programming                : logi  FALSE FALSE FALSE FALSE FALSE FALSE ...
##  $ Machine learning specialist         : logi  FALSE FALSE FALSE FALSE FALSE FALSE ...
##  $ Mobile developer                    : logi  FALSE FALSE FALSE FALSE FALSE FALSE ...
##  $ Quality assurance engineer          : logi  FALSE FALSE TRUE FALSE FALSE FALSE ...
##  $ Systems administrator               : logi  FALSE FALSE FALSE FALSE FALSE FALSE ...
##  $ Web developer                       : logi  FALSE FALSE TRUE TRUE TRUE TRUE ...
# Print stackoverflow
stackoverflow
## # A tibble: 6,991 x 22
##    Respondent Country        Salary YearsCodedJob OpenSource Hobby
##         <int> <chr>           <dbl>         <int> <lgl>      <lgl>
##  1          3 United Kingdom 113750            20 T          T    
##  2         15 United Kingdom 100000            20 F          T    
##  3         18 United States  130000            20 T          T    
##  4         19 United States   82500             3 F          T    
##  5         26 United States  175000            16 F          T    
##  6         55 Germany         64516             4 F          F    
##  7         62 India            6636             1 F          T    
##  8         71 United States   65000             1 F          T    
##  9         73 United States  120000            20 T          T    
## 10         77 United States   96283            20 T          T    
## # ... with 6,981 more rows, and 16 more variables:
## #   CompanySizeNumber <dbl>, Remote <fct>, CareerSatisfaction <int>, `Data
## #   scientist` <lgl>, `Database administrator` <lgl>, `Desktop
## #   applications developer` <lgl>, `Developer with stats/math
## #   background` <lgl>, DevOps <lgl>, `Embedded developer` <lgl>, `Graphic
## #   designer` <lgl>, `Graphics programming` <lgl>, `Machine learning
## #   specialist` <lgl>, `Mobile developer` <lgl>, `Quality assurance
## #   engineer` <lgl>, `Systems administrator` <lgl>, `Web developer` <lgl>
# First count for Remote
stackoverflow %>% 
    count(Remote, sort = TRUE)
## # A tibble: 2 x 2
##   Remote         n
##   <fct>      <int>
## 1 Not remote  6273
## 2 Remote       718
# then count for Country
stackoverflow %>% 
    count(Country, sort = TRUE)
## # A tibble: 5 x 2
##   Country            n
##   <chr>          <int>
## 1 United States   3486
## 2 United Kingdom  1270
## 3 Germany          950
## 4 India            666
## 5 Canada           619
ggplot(stackoverflow, aes(x=Remote, y=YearsCodedJob)) +
    geom_boxplot() +
    labs(x = NULL,
         y = "Years of professional coding experience") 

# Build a simple logistic regression model
simple_glm <- stackoverflow %>%
        select(-Respondent) %>%
        glm(Remote ~ .,
            family = "binomial",
            data = .)

# Print the summary of the model
summary(simple_glm)
## 
## Call:
## glm(formula = Remote ~ ., family = "binomial", data = .)
## 
## Deviance Residuals: 
##     Min       1Q   Median       3Q      Max  
## -1.1942  -0.4971  -0.3824  -0.2867   2.9118  
## 
## Coefficients:
##                                              Estimate Std. Error z value
## (Intercept)                                -4.156e+00  2.929e-01 -14.187
## CountryGermany                             -2.034e-01  2.196e-01  -0.927
## CountryIndia                                9.574e-01  2.220e-01   4.312
## CountryUnited Kingdom                       5.599e-02  1.974e-01   0.284
## CountryUnited States                        5.990e-01  1.799e-01   3.330
## Salary                                      4.076e-06  1.589e-06   2.565
## YearsCodedJob                               7.133e-02  7.556e-03   9.440
## OpenSourceTRUE                              4.207e-01  8.555e-02   4.917
## HobbyTRUE                                   8.330e-03  9.827e-02   0.085
## CompanySizeNumber                          -6.104e-05  1.223e-05  -4.990
## CareerSatisfaction                          6.748e-02  2.664e-02   2.533
## `Data scientist`TRUE                       -1.186e-01  1.838e-01  -0.645
## `Database administrator`TRUE                2.763e-01  1.267e-01   2.181
## `Desktop applications developer`TRUE       -2.903e-01  9.842e-02  -2.950
## `Developer with stats/math background`TRUE  2.840e-02  1.359e-01   0.209
## DevOpsTRUE                                 -1.532e-01  1.292e-01  -1.185
## `Embedded developer`TRUE                   -2.777e-01  1.653e-01  -1.680
## `Graphic designer`TRUE                     -1.904e-01  2.725e-01  -0.699
## `Graphics programming`TRUE                  1.078e-01  2.312e-01   0.466
## `Machine learning specialist`TRUE          -2.289e-01  2.769e-01  -0.827
## `Mobile developer`TRUE                      2.170e-01  1.019e-01   2.130
## `Quality assurance engineer`TRUE           -2.826e-01  2.437e-01  -1.160
## `Systems administrator`TRUE                 1.462e-01  1.421e-01   1.029
## `Web developer`TRUE                         1.158e-01  9.993e-02   1.159
##                                            Pr(>|z|)    
## (Intercept)                                 < 2e-16 ***
## CountryGermany                             0.354161    
## CountryIndia                               1.62e-05 ***
## CountryUnited Kingdom                      0.776710    
## CountryUnited States                       0.000868 ***
## Salary                                     0.010314 *  
## YearsCodedJob                               < 2e-16 ***
## OpenSourceTRUE                             8.78e-07 ***
## HobbyTRUE                                  0.932444    
## CompanySizeNumber                          6.04e-07 ***
## CareerSatisfaction                         0.011323 *  
## `Data scientist`TRUE                       0.518709    
## `Database administrator`TRUE               0.029184 *  
## `Desktop applications developer`TRUE       0.003178 ** 
## `Developer with stats/math background`TRUE 0.834400    
## DevOpsTRUE                                 0.235833    
## `Embedded developer`TRUE                   0.093039 .  
## `Graphic designer`TRUE                     0.484596    
## `Graphics programming`TRUE                 0.641060    
## `Machine learning specialist`TRUE          0.408484    
## `Mobile developer`TRUE                     0.033194 *  
## `Quality assurance engineer`TRUE           0.246098    
## `Systems administrator`TRUE                0.303507    
## `Web developer`TRUE                        0.246655    
## ---
## Signif. codes:  0 '***' 0.001 '**' 0.01 '*' 0.05 '.' 0.1 ' ' 1
## 
## (Dispersion parameter for binomial family taken to be 1)
## 
##     Null deviance: 4627.8  on 6990  degrees of freedom
## Residual deviance: 4268.8  on 6967  degrees of freedom
## AIC: 4316.8
## 
## Number of Fisher Scoring iterations: 5
stack_select <- stackoverflow %>%
    select(-Respondent)

# Split the data into training and testing sets
set.seed(1234)
in_train <- caret::createDataPartition(stack_select$Remote, p=0.8, list = FALSE)
training <- stack_select[in_train,]
testing <- stack_select[-in_train,]


up_train <- caret::upSample(x = select(training, -Remote), y = training$Remote, yname = "Remote") %>%
    as_tibble()

up_train %>%
    count(Remote)
## # A tibble: 2 x 2
##   Remote         n
##   <fct>      <int>
## 1 Not remote  5019
## 2 Remote      5019
# Sub-sample to 5% of original
inUse <- sample(1:nrow(training), round(0.05*nrow(training)), replace=FALSE)
useTrain <- training[sort(inUse), ]

# Build a logistic regression model
stack_glm <- caret::train(Remote ~ ., method="glm", family="binomial", data = training, 
                          trControl = trainControl(method = "boot", sampling = "up")
                          )

# Print the model object 
stack_glm
## Generalized Linear Model 
## 
## 5594 samples
##   20 predictor
##    2 classes: 'Not remote', 'Remote' 
## 
## No pre-processing
## Resampling: Bootstrapped (25 reps) 
## Summary of sample sizes: 5594, 5594, 5594, 5594, 5594, 5594, ... 
## Addtional sampling using up-sampling
## 
## Resampling results:
## 
##   Accuracy   Kappa    
##   0.6568743  0.1279825
# Build a random forest model
stack_rf <- caret::train(Remote ~ ., method="rf", data = useTrain, 
                         trControl = trainControl(method = "boot", sampling="up")
                         )

# Print the model object
stack_rf
## Random Forest 
## 
## 280 samples
##  20 predictor
##   2 classes: 'Not remote', 'Remote' 
## 
## No pre-processing
## Resampling: Bootstrapped (25 reps) 
## Summary of sample sizes: 280, 280, 280, 280, 280, 280, ... 
## Addtional sampling using up-sampling
## 
## Resampling results across tuning parameters:
## 
##   mtry  Accuracy   Kappa       
##    2    0.8626254   0.110738058
##   12    0.9038825  -0.002127159
##   23    0.8887612   0.035777206
## 
## Accuracy was used to select the optimal model using the largest value.
## The final value used for the model was mtry = 12.
# Confusion matrix for logistic regression model
caret::confusionMatrix(predict(stack_glm, testing), testing$Remote)
## Confusion Matrix and Statistics
## 
##             Reference
## Prediction   Not remote Remote
##   Not remote        837     53
##   Remote            417     90
##                                           
##                Accuracy : 0.6636          
##                  95% CI : (0.6381, 0.6883)
##     No Information Rate : 0.8976          
##     P-Value [Acc > NIR] : 1               
##                                           
##                   Kappa : 0.1395          
##  Mcnemar's Test P-Value : <2e-16          
##                                           
##             Sensitivity : 0.6675          
##             Specificity : 0.6294          
##          Pos Pred Value : 0.9404          
##          Neg Pred Value : 0.1775          
##              Prevalence : 0.8976          
##          Detection Rate : 0.5991          
##    Detection Prevalence : 0.6371          
##       Balanced Accuracy : 0.6484          
##                                           
##        'Positive' Class : Not remote      
## 
# Confusion matrix for random forest model
caret::confusionMatrix(predict(stack_rf, testing), testing$Remote)
## Confusion Matrix and Statistics
## 
##             Reference
## Prediction   Not remote Remote
##   Not remote       1207    125
##   Remote             47     18
##                                           
##                Accuracy : 0.8769          
##                  95% CI : (0.8585, 0.8937)
##     No Information Rate : 0.8976          
##     P-Value [Acc > NIR] : 0.9945          
##                                           
##                   Kappa : 0.1166          
##  Mcnemar's Test P-Value : 4.327e-09       
##                                           
##             Sensitivity : 0.9625          
##             Specificity : 0.1259          
##          Pos Pred Value : 0.9062          
##          Neg Pred Value : 0.2769          
##              Prevalence : 0.8976          
##          Detection Rate : 0.8640          
##    Detection Prevalence : 0.9535          
##       Balanced Accuracy : 0.5442          
##                                           
##        'Positive' Class : Not remote      
## 
# Predict values
testing_results <- testing %>%
    mutate(`Logistic regression` = predict(stack_glm, testing), `Random forest` = predict(stack_rf, testing))

## Calculate accuracy
yardstick::accuracy(testing_results, truth = Remote, estimate = `Logistic regression`)
## [1] 0.6635648
yardstick::accuracy(testing_results, truth = Remote, estimate = `Random forest`)
## [1] 0.876879
## Calculate positive predict value
yardstick::ppv(testing_results, truth = Remote, estimate = `Logistic regression`)
## [1] 0.9404494
yardstick::ppv(testing_results, truth = Remote, estimate = `Random forest`)
## [1] 0.9061562

Chapter 3 - Voting

Predicting voter turnout from survey data:

  • Survey data available from https://www.voterstudygroup.org/publications/2016-elections/data
    • Opinions about political and economic topics
    • Includes whether the voter turned out (voted), based on self-reporting, in the 2016 election
    • Data are coded as integers, requiring a data dictionary to map the questions and responses to what they mean

Vote 2016:

  • Exploratory data analysis will help with learning about the underlying dataset
    • There are differences on many of the individual dimensions between voters and non-voters
    • A good first step can be to start with the very simplest model, Dependent ~ .

Cross-validation is the process of sub-dividing the data into folds, with each fold used once as the validation set:

  • Allows for more accurate estimates of model performance on out-of-sample error
  • Each process of CV will work through the data k times (assuming there are k folds)
    • Repeated CV is the process of running CV multiple times (this is particularly well suited to parallel processing)

Comparing model performance:

  • Random forest models tend to be more powerful and capable of classifying the training data (and thus subject to risk of overfits and associated poor quality of test set predictions)

Example code includes:

voters <- readr::read_csv("./RInputFiles/voters.csv")
## Parsed with column specification:
## cols(
##   .default = col_integer(),
##   turnout16_2016 = col_character()
## )
## See spec(...) for full column specifications.
voters$turnout16_2016 <- factor(voters$turnout16_2016, levels=c("Did not vote", "Voted"))
str(voters, give.attr = FALSE)
## Classes 'tbl_df', 'tbl' and 'data.frame':    6692 obs. of  43 variables:
##  $ case_identifier     : int  779 2108 2597 4148 4460 5225 5903 6059 8048 13112 ...
##  $ turnout16_2016      : Factor w/ 2 levels "Did not vote",..: 2 2 2 2 2 2 2 2 2 2 ...
##  $ RIGGED_SYSTEM_1_2016: int  3 2 2 1 3 3 3 2 4 2 ...
##  $ RIGGED_SYSTEM_2_2016: int  4 1 4 4 1 3 4 3 4 3 ...
##  $ RIGGED_SYSTEM_3_2016: int  1 3 1 1 3 2 1 3 1 1 ...
##  $ RIGGED_SYSTEM_4_2016: int  4 1 4 4 1 2 1 2 3 2 ...
##  $ RIGGED_SYSTEM_5_2016: int  3 3 1 2 3 2 2 1 3 2 ...
##  $ RIGGED_SYSTEM_6_2016: int  2 2 1 1 2 3 1 2 1 2 ...
##  $ track_2016          : int  2 2 1 1 2 2 1 2 2 2 ...
##  $ persfinretro_2016   : int  2 3 3 1 2 2 2 3 2 1 ...
##  $ econtrend_2016      : int  1 3 3 1 2 2 1 3 1 1 ...
##  $ Americatrend_2016   : int  1 1 1 3 3 1 2 3 2 1 ...
##  $ futuretrend_2016    : int  4 1 1 3 4 3 1 3 1 1 ...
##  $ wealth_2016         : int  2 1 2 2 1 2 2 1 2 2 ...
##  $ values_culture_2016 : int  2 3 3 3 3 2 3 3 1 3 ...
##  $ US_respect_2016     : int  2 3 1 1 2 2 2 3 3 3 ...
##  $ trustgovt_2016      : int  3 3 3 3 3 2 3 3 3 3 ...
##  $ trust_people_2016   : int  8 2 1 1 1 2 2 1 2 1 ...
##  $ helpful_people_2016 : int  1 1 2 1 1 1 2 2 1 2 ...
##  $ fair_people_2016    : int  8 2 1 1 1 2 2 1 2 1 ...
##  $ imiss_a_2016        : int  2 1 1 1 1 2 1 1 3 1 ...
##  $ imiss_b_2016        : int  2 1 1 2 1 1 1 2 1 1 ...
##  $ imiss_c_2016        : int  1 2 2 3 1 2 2 1 4 2 ...
##  $ imiss_d_2016        : int  1 2 1 1 1 1 1 2 1 1 ...
##  $ imiss_e_2016        : int  1 1 3 1 1 3 1 2 1 1 ...
##  $ imiss_f_2016        : int  2 1 1 2 1 2 1 3 2 1 ...
##  $ imiss_g_2016        : int  1 4 3 3 3 1 3 4 2 2 ...
##  $ imiss_h_2016        : int  1 2 2 2 1 1 1 2 1 1 ...
##  $ imiss_i_2016        : int  2 2 4 4 2 1 1 3 2 1 ...
##  $ imiss_j_2016        : int  1 1 1 1 1 1 1 1 1 1 ...
##  $ imiss_k_2016        : int  1 2 1 1 2 1 1 4 2 1 ...
##  $ imiss_l_2016        : int  1 4 1 2 4 1 1 3 1 1 ...
##  $ imiss_m_2016        : int  1 2 1 2 1 1 1 1 1 1 ...
##  $ imiss_n_2016        : int  1 2 1 1 1 1 1 2 2 1 ...
##  $ imiss_o_2016        : int  2 1 1 1 1 2 1 2 2 1 ...
##  $ imiss_p_2016        : int  2 1 2 3 1 3 1 1 4 1 ...
##  $ imiss_q_2016        : int  1 1 1 2 2 1 1 4 2 1 ...
##  $ imiss_r_2016        : int  2 1 1 2 1 2 1 2 4 2 ...
##  $ imiss_s_2016        : int  1 2 1 2 2 1 1 1 1 1 ...
##  $ imiss_t_2016        : int  1 1 3 3 1 1 3 4 1 1 ...
##  $ imiss_u_2016        : int  2 2 2 2 1 3 3 1 4 2 ...
##  $ imiss_x_2016        : int  1 3 1 2 1 1 1 4 1 1 ...
##  $ imiss_y_2016        : int  1 4 2 3 1 1 1 3 2 1 ...
# Print voters
voters
## # A tibble: 6,692 x 43
##    case_identifier turnout16_2016 RIGGED_SYSTEM_1_2016 RIGGED_SYSTEM_2_20~
##              <int> <fct>                         <int>               <int>
##  1             779 Voted                             3                   4
##  2            2108 Voted                             2                   1
##  3            2597 Voted                             2                   4
##  4            4148 Voted                             1                   4
##  5            4460 Voted                             3                   1
##  6            5225 Voted                             3                   3
##  7            5903 Voted                             3                   4
##  8            6059 Voted                             2                   3
##  9            8048 Voted                             4                   4
## 10           13112 Voted                             2                   3
## # ... with 6,682 more rows, and 39 more variables:
## #   RIGGED_SYSTEM_3_2016 <int>, RIGGED_SYSTEM_4_2016 <int>,
## #   RIGGED_SYSTEM_5_2016 <int>, RIGGED_SYSTEM_6_2016 <int>,
## #   track_2016 <int>, persfinretro_2016 <int>, econtrend_2016 <int>,
## #   Americatrend_2016 <int>, futuretrend_2016 <int>, wealth_2016 <int>,
## #   values_culture_2016 <int>, US_respect_2016 <int>,
## #   trustgovt_2016 <int>, trust_people_2016 <int>,
## #   helpful_people_2016 <int>, fair_people_2016 <int>, imiss_a_2016 <int>,
## #   imiss_b_2016 <int>, imiss_c_2016 <int>, imiss_d_2016 <int>,
## #   imiss_e_2016 <int>, imiss_f_2016 <int>, imiss_g_2016 <int>,
## #   imiss_h_2016 <int>, imiss_i_2016 <int>, imiss_j_2016 <int>,
## #   imiss_k_2016 <int>, imiss_l_2016 <int>, imiss_m_2016 <int>,
## #   imiss_n_2016 <int>, imiss_o_2016 <int>, imiss_p_2016 <int>,
## #   imiss_q_2016 <int>, imiss_r_2016 <int>, imiss_s_2016 <int>,
## #   imiss_t_2016 <int>, imiss_u_2016 <int>, imiss_x_2016 <int>,
## #   imiss_y_2016 <int>
# How many people voted?
voters %>%
    count(turnout16_2016)
## # A tibble: 2 x 2
##   turnout16_2016     n
##   <fct>          <int>
## 1 Did not vote     264
## 2 Voted           6428
# How do the reponses on the survey vary with voting behavior?
voters %>%
    group_by(turnout16_2016) %>%
    summarize(`Elections don't matter` = mean(RIGGED_SYSTEM_1_2016 <= 2),
              `Economy is getting better` = mean(econtrend_2016 == 1),
              `Crime is very important` = mean(imiss_a_2016 == 2))
## # A tibble: 2 x 4
##   turnout16_2016 `Elections don't ~ `Economy is gettin~ `Crime is very im~
##   <fct>                       <dbl>               <dbl>              <dbl>
## 1 Did not vote                0.553               0.163              0.292
## 2 Voted                       0.341               0.289              0.342
## Visualize difference by voter turnout
voters %>%
    ggplot(aes(econtrend_2016, ..density.., fill = turnout16_2016)) +
    geom_histogram(alpha = 0.5, position = "identity", binwidth = 1) +
    labs(title = "Overall, is the economy getting better or worse?")

# Remove the case_indetifier column
voters_select <- voters %>%
        select(-case_identifier)

# Build a simple logistic regression model
simple_glm <- glm(turnout16_2016 ~ .,  family = "binomial", 
                  data = voters_select)

# Print the summary                  
summary(simple_glm)
## 
## Call:
## glm(formula = turnout16_2016 ~ ., family = "binomial", data = voters_select)
## 
## Deviance Residuals: 
##     Min       1Q   Median       3Q      Max  
## -3.2373   0.1651   0.2214   0.3004   1.7708  
## 
## Coefficients:
##                       Estimate Std. Error z value Pr(>|z|)    
## (Intercept)           2.457036   0.732721   3.353 0.000799 ***
## RIGGED_SYSTEM_1_2016  0.236284   0.085081   2.777 0.005484 ** 
## RIGGED_SYSTEM_2_2016  0.064749   0.089208   0.726 0.467946    
## RIGGED_SYSTEM_3_2016  0.049357   0.107352   0.460 0.645680    
## RIGGED_SYSTEM_4_2016 -0.074694   0.087583  -0.853 0.393749    
## RIGGED_SYSTEM_5_2016  0.190252   0.096454   1.972 0.048556 *  
## RIGGED_SYSTEM_6_2016 -0.005881   0.101381  -0.058 0.953740    
## track_2016            0.241075   0.121467   1.985 0.047178 *  
## persfinretro_2016    -0.040229   0.106714  -0.377 0.706191    
## econtrend_2016       -0.295370   0.087224  -3.386 0.000708 ***
## Americatrend_2016    -0.105213   0.080845  -1.301 0.193116    
## futuretrend_2016      0.210568   0.071201   2.957 0.003103 ** 
## wealth_2016          -0.069405   0.026344  -2.635 0.008424 ** 
## values_culture_2016  -0.041402   0.038670  -1.071 0.284332    
## US_respect_2016      -0.068200   0.043785  -1.558 0.119322    
## trustgovt_2016        0.315354   0.166655   1.892 0.058456 .  
## trust_people_2016     0.040423   0.041518   0.974 0.330236    
## helpful_people_2016  -0.037513   0.035353  -1.061 0.288643    
## fair_people_2016     -0.017081   0.030170  -0.566 0.571294    
## imiss_a_2016          0.397121   0.138987   2.857 0.004273 ** 
## imiss_b_2016         -0.250803   0.155454  -1.613 0.106667    
## imiss_c_2016          0.017536   0.090647   0.193 0.846606    
## imiss_d_2016          0.043510   0.122118   0.356 0.721619    
## imiss_e_2016         -0.095552   0.078603  -1.216 0.224126    
## imiss_f_2016         -0.323280   0.105432  -3.066 0.002168 ** 
## imiss_g_2016         -0.332034   0.078673  -4.220 2.44e-05 ***
## imiss_h_2016         -0.157298   0.107111  -1.469 0.141954    
## imiss_i_2016          0.088695   0.091467   0.970 0.332196    
## imiss_j_2016          0.060271   0.138429   0.435 0.663280    
## imiss_k_2016         -0.181030   0.082726  -2.188 0.028646 *  
## imiss_l_2016          0.274689   0.106781   2.572 0.010098 *  
## imiss_m_2016         -0.124269   0.147888  -0.840 0.400746    
## imiss_n_2016         -0.441612   0.090040  -4.905 9.36e-07 ***
## imiss_o_2016          0.198635   0.143160   1.388 0.165286    
## imiss_p_2016          0.102987   0.105669   0.975 0.329751    
## imiss_q_2016          0.244567   0.119093   2.054 0.040017 *  
## imiss_r_2016          0.198839   0.121969   1.630 0.103050    
## imiss_s_2016         -0.067310   0.134465  -0.501 0.616666    
## imiss_t_2016         -0.116757   0.068143  -1.713 0.086639 .  
## imiss_u_2016          0.022902   0.097312   0.235 0.813939    
## imiss_x_2016         -0.017789   0.097349  -0.183 0.855003    
## imiss_y_2016          0.150205   0.094536   1.589 0.112092    
## ---
## Signif. codes:  0 '***' 0.001 '**' 0.01 '*' 0.05 '.' 0.1 ' ' 1
## 
## (Dispersion parameter for binomial family taken to be 1)
## 
##     Null deviance: 2224.3  on 6691  degrees of freedom
## Residual deviance: 2004.4  on 6650  degrees of freedom
## AIC: 2088.4
## 
## Number of Fisher Scoring iterations: 6
# Split data into training and testing sets
set.seed(1234)
in_train <- caret::createDataPartition(voters_select$turnout16_2016, p = 0.8, list = FALSE)
training <- voters_select[in_train, ]
testing <- voters_select[-in_train, ]


# Perform logistic regression with upsampling and no resampling
vote_glm_1 <- caret::train(turnout16_2016 ~ ., method = "glm", family = "binomial", data = training,
                           trControl = trainControl(method = "none", sampling = "up")
                           )

# Print vote_glm
vote_glm_1
## Generalized Linear Model 
## 
## 5355 samples
##   41 predictor
##    2 classes: 'Did not vote', 'Voted' 
## 
## No pre-processing
## Resampling: None 
## Addtional sampling using up-sampling
useSmall <- sort(sample(1:nrow(training), round(0.1*nrow(training)), replace=FALSE))
trainSmall <- training[useSmall, ]

# Logistic regression
vote_glm <- caret::train(turnout16_2016 ~ ., method = "glm", family = "binomial", data = trainSmall,
                         trControl = trainControl(method = "repeatedcv", repeats = 2, sampling = "up")
                         )
## Warning: glm.fit: fitted probabilities numerically 0 or 1 occurred

## Warning: glm.fit: fitted probabilities numerically 0 or 1 occurred

## Warning: glm.fit: fitted probabilities numerically 0 or 1 occurred

## Warning: glm.fit: fitted probabilities numerically 0 or 1 occurred

## Warning: glm.fit: fitted probabilities numerically 0 or 1 occurred

## Warning: glm.fit: fitted probabilities numerically 0 or 1 occurred

## Warning: glm.fit: fitted probabilities numerically 0 or 1 occurred

## Warning: glm.fit: fitted probabilities numerically 0 or 1 occurred

## Warning: glm.fit: fitted probabilities numerically 0 or 1 occurred

## Warning: glm.fit: fitted probabilities numerically 0 or 1 occurred

## Warning: glm.fit: fitted probabilities numerically 0 or 1 occurred

## Warning: glm.fit: fitted probabilities numerically 0 or 1 occurred

## Warning: glm.fit: fitted probabilities numerically 0 or 1 occurred

## Warning: glm.fit: fitted probabilities numerically 0 or 1 occurred

## Warning: glm.fit: fitted probabilities numerically 0 or 1 occurred

## Warning: glm.fit: fitted probabilities numerically 0 or 1 occurred

## Warning: glm.fit: fitted probabilities numerically 0 or 1 occurred

## Warning: glm.fit: fitted probabilities numerically 0 or 1 occurred

## Warning: glm.fit: fitted probabilities numerically 0 or 1 occurred
# Print vote_glm
vote_glm
## Generalized Linear Model 
## 
## 536 samples
##  41 predictor
##   2 classes: 'Did not vote', 'Voted' 
## 
## No pre-processing
## Resampling: Cross-Validated (10 fold, repeated 2 times) 
## Summary of sample sizes: 482, 482, 482, 483, 482, 483, ... 
## Addtional sampling using up-sampling
## 
## Resampling results:
## 
##   Accuracy   Kappa     
##   0.8713138  0.04298445
# Random forest
vote_rf <- caret::train(turnout16_2016 ~ ., method = "rf", data = trainSmall,
                        trControl = trainControl(method="repeatedcv", repeats=2, sampling = "up")
                        )

# Print vote_rf
vote_rf
## Random Forest 
## 
## 536 samples
##  41 predictor
##   2 classes: 'Did not vote', 'Voted' 
## 
## No pre-processing
## Resampling: Cross-Validated (10 fold, repeated 2 times) 
## Summary of sample sizes: 483, 482, 483, 482, 483, 483, ... 
## Addtional sampling using up-sampling
## 
## Resampling results across tuning parameters:
## 
##   mtry  Accuracy   Kappa       
##    2    0.9674179  -0.001265823
##   21    0.9627184  -0.006073829
##   41    0.9542628   0.019107234
## 
## Accuracy was used to select the optimal model using the largest value.
## The final value used for the model was mtry = 2.
# Confusion matrix for logistic regression model on training data
caret::confusionMatrix(predict(vote_glm, trainSmall), trainSmall$turnout16_2016)
## Confusion Matrix and Statistics
## 
##               Reference
## Prediction     Did not vote Voted
##   Did not vote           17    48
##   Voted                   0   471
##                                          
##                Accuracy : 0.9104         
##                  95% CI : (0.883, 0.9332)
##     No Information Rate : 0.9683         
##     P-Value [Acc > NIR] : 1              
##                                          
##                   Kappa : 0.3836         
##  Mcnemar's Test P-Value : 1.17e-11       
##                                          
##             Sensitivity : 1.00000        
##             Specificity : 0.90751        
##          Pos Pred Value : 0.26154        
##          Neg Pred Value : 1.00000        
##              Prevalence : 0.03172        
##          Detection Rate : 0.03172        
##    Detection Prevalence : 0.12127        
##       Balanced Accuracy : 0.95376        
##                                          
##        'Positive' Class : Did not vote   
## 
# Confusion matrix for random forest model on training data
caret::confusionMatrix(predict(vote_rf, trainSmall), trainSmall$turnout16_2016)
## Confusion Matrix and Statistics
## 
##               Reference
## Prediction     Did not vote Voted
##   Did not vote           17     0
##   Voted                   0   519
##                                       
##                Accuracy : 1           
##                  95% CI : (0.9931, 1) 
##     No Information Rate : 0.9683      
##     P-Value [Acc > NIR] : 3.143e-08   
##                                       
##                   Kappa : 1           
##  Mcnemar's Test P-Value : NA          
##                                       
##             Sensitivity : 1.00000     
##             Specificity : 1.00000     
##          Pos Pred Value : 1.00000     
##          Neg Pred Value : 1.00000     
##              Prevalence : 0.03172     
##          Detection Rate : 0.03172     
##    Detection Prevalence : 0.03172     
##       Balanced Accuracy : 1.00000     
##                                       
##        'Positive' Class : Did not vote
## 
# Confusion matrix for logistic regression model on testing data
caret::confusionMatrix(predict(vote_glm, testing), testing$turnout16_2016)
## Confusion Matrix and Statistics
## 
##               Reference
## Prediction     Did not vote Voted
##   Did not vote           14   166
##   Voted                  38  1119
##                                          
##                Accuracy : 0.8474         
##                  95% CI : (0.827, 0.8663)
##     No Information Rate : 0.9611         
##     P-Value [Acc > NIR] : 1              
##                                          
##                   Kappa : 0.0642         
##  Mcnemar's Test P-Value : <2e-16         
##                                          
##             Sensitivity : 0.26923        
##             Specificity : 0.87082        
##          Pos Pred Value : 0.07778        
##          Neg Pred Value : 0.96716        
##              Prevalence : 0.03889        
##          Detection Rate : 0.01047        
##    Detection Prevalence : 0.13463        
##       Balanced Accuracy : 0.57002        
##                                          
##        'Positive' Class : Did not vote   
## 
# Confusion matrix for random forest model on testing data
caret::confusionMatrix(predict(vote_rf, testing), testing$turnout16_2016)
## Confusion Matrix and Statistics
## 
##               Reference
## Prediction     Did not vote Voted
##   Did not vote            1     1
##   Voted                  51  1284
##                                           
##                Accuracy : 0.9611          
##                  95% CI : (0.9493, 0.9708)
##     No Information Rate : 0.9611          
##     P-Value [Acc > NIR] : 0.5368          
##                                           
##                   Kappa : 0.0343          
##  Mcnemar's Test P-Value : 1.083e-11       
##                                           
##             Sensitivity : 0.0192308       
##             Specificity : 0.9992218       
##          Pos Pred Value : 0.5000000       
##          Neg Pred Value : 0.9617978       
##              Prevalence : 0.0388930       
##          Detection Rate : 0.0007479       
##    Detection Prevalence : 0.0014959       
##       Balanced Accuracy : 0.5092263       
##                                           
##        'Positive' Class : Did not vote    
## 

Chapter 4 - Nuns

Catholic sisters survey from 1967 - https://curate.nd.edu/show/0r967368551 with codebook at https://curate.nd.edu/downloads/0v838051f6x

  • Responses from 130,000 sisters in ~400 congergations
  • There was significant change occuring during this time period, both in society at large and within the community of nuns
  • Age has been binned in groups of 10 years (has been recoded as a numeric at the top of the range, so 20 will mean 11-20 and 30 will mean 21-30 and the like)
  • Historical dataset, centered in the context of nuns in 1967
  • Good first step is to tidy the data, so that it is easier for exploratory data analysis
    • sisters67 %>% select(-sister) %>% gather(key, value, -age)

Exploratory data analysis with tidy data:

  • Easy to see levels of agreement (overall) using dplyr::count()
  • Agreement with specific questions by age
    • tidy_sisters %>% filter(key %in% paste0(“v”, 153:170)) %>% group_by(key, value) %>% summarise(age = mean(age)) %>% ggplot(aes(value, age, color = key)) + geom_line(alpha = 0.5, size = 1.5) + geom_point(size = 2) + facet_wrap(~key)
    • Can use the mix of responses to make estimates about the ages of the nuns
  • Data will be split in to training, validation, and test sets
    • The validation set will be used for model selection

Predicting age with supervised learning:

  • “rpart” - building a tree-based (CART) model
  • “xgbLinear” - extreme gradient boosting
  • “gbm” - gradient boosted ensembles
  • Validation datasets are useful for assessing hyper-parameters and model choices, leaving the test dataset pure for a final out-of-sample error estimate

Wrap up:

  • Train-Validation-Test to select the best models, tune the parameters, and estimate the out-of-sample error rates
  • Dealing with class imbalances; improving performance with resamples (bootstraps, cross-validation, etc.)
  • Hyper-parameter tuning can be valuable, but the time investment in other areas can often generate a greater return
  • Gradient boosting and random forests tend to perform very well, but there is always value in trying out multiple models
    • Start with EDA and begin with a very simple model

Example code includes:

sisters67 <- readr::read_csv("./RInputFiles/sisters.csv")
## Parsed with column specification:
## cols(
##   .default = col_integer()
## )
## See spec(...) for full column specifications.
str(sisters67, give.attr = FALSE)
## Classes 'tbl_df', 'tbl' and 'data.frame':    19278 obs. of  67 variables:
##  $ age   : int  40 30 40 30 40 30 70 30 60 80 ...
##  $ sister: int  11545 16953 73323 75339 36303 95318 22474 114526 20707 91062 ...
##  $ v116  : int  5 4 2 4 4 2 4 4 4 5 ...
##  $ v117  : int  2 1 2 3 2 4 5 1 5 1 ...
##  $ v118  : int  2 4 5 3 3 5 5 4 5 2 ...
##  $ v119  : int  2 4 5 4 5 5 5 5 4 1 ...
##  $ v120  : int  4 1 3 3 1 1 5 1 5 2 ...
##  $ v121  : int  4 1 4 4 4 5 4 1 5 5 ...
##  $ v122  : int  4 1 2 2 4 1 1 2 2 1 ...
##  $ v123  : int  5 5 3 4 4 3 1 5 2 5 ...
##  $ v124  : int  1 1 5 2 3 1 5 3 5 4 ...
##  $ v125  : int  4 2 5 3 4 2 5 2 5 5 ...
##  $ v126  : int  2 1 1 3 1 1 5 1 5 2 ...
##  $ v127  : int  1 4 5 2 2 1 1 1 4 1 ...
##  $ v128  : int  2 1 4 3 4 4 5 2 5 3 ...
##  $ v129  : int  4 4 5 4 5 4 5 5 4 1 ...
##  $ v130  : int  2 4 4 3 3 1 5 1 5 4 ...
##  $ v131  : int  1 2 2 3 5 5 2 3 3 2 ...
##  $ v132  : int  5 5 5 4 5 2 2 5 4 5 ...
##  $ v133  : int  2 4 5 3 5 1 4 2 4 4 ...
##  $ v134  : int  2 4 4 3 4 4 1 4 4 2 ...
##  $ v135  : int  5 5 4 3 5 4 1 5 5 2 ...
##  $ v136  : int  1 4 4 2 4 4 1 4 4 2 ...
##  $ v137  : int  1 1 1 1 1 1 2 1 2 4 ...
##  $ v138  : int  2 1 3 1 3 1 4 1 2 1 ...
##  $ v139  : int  3 1 3 3 1 1 4 1 5 4 ...
##  $ v140  : int  1 2 1 2 4 4 5 2 5 2 ...
##  $ v141  : int  5 5 4 3 3 3 4 5 4 4 ...
##  $ v142  : int  1 1 2 2 2 1 2 1 4 3 ...
##  $ v143  : int  2 1 5 4 4 5 4 5 4 1 ...
##  $ v144  : int  1 2 1 2 1 1 3 1 4 2 ...
##  $ v145  : int  4 4 5 3 4 1 5 2 5 4 ...
##  $ v146  : int  4 4 5 4 5 5 4 5 2 4 ...
##  $ v147  : int  2 2 1 2 3 1 2 1 2 2 ...
##  $ v148  : int  1 1 4 1 1 4 4 1 5 1 ...
##  $ v149  : int  4 2 4 2 1 1 2 1 5 4 ...
##  $ v150  : int  2 1 2 3 1 4 2 1 5 2 ...
##  $ v151  : int  4 1 5 4 4 1 5 1 4 3 ...
##  $ v152  : int  2 1 1 3 1 1 2 1 4 4 ...
##  $ v153  : int  5 5 5 5 5 5 5 5 5 2 ...
##  $ v154  : int  1 1 4 2 1 3 5 1 4 2 ...
##  $ v155  : int  5 4 4 3 5 5 4 5 4 4 ...
##  $ v156  : int  1 1 2 2 1 1 5 1 5 2 ...
##  $ v157  : int  4 1 4 3 1 1 2 1 3 4 ...
##  $ v158  : int  4 4 5 2 5 5 2 5 5 4 ...
##  $ v159  : int  1 4 4 1 2 1 4 1 4 2 ...
##  $ v160  : int  2 5 5 4 4 4 5 5 5 4 ...
##  $ v161  : int  2 4 3 3 1 1 4 1 2 4 ...
##  $ v162  : int  5 4 5 4 4 4 5 5 5 4 ...
##  $ v163  : int  2 1 2 3 1 1 2 1 4 1 ...
##  $ v164  : int  4 1 5 2 4 1 5 1 5 4 ...
##  $ v165  : int  2 1 3 2 1 1 1 1 2 2 ...
##  $ v166  : int  2 4 5 2 1 1 5 2 5 4 ...
##  $ v167  : int  2 4 5 3 4 4 2 4 5 2 ...
##  $ v168  : int  5 5 5 4 5 5 5 5 4 5 ...
##  $ v169  : int  1 1 1 2 1 1 5 1 4 4 ...
##  $ v170  : int  5 1 4 3 2 4 4 1 2 4 ...
##  $ v171  : int  5 5 5 4 1 2 5 5 5 5 ...
##  $ v172  : int  2 1 5 5 2 2 5 1 5 3 ...
##  $ v173  : int  2 2 4 2 2 1 4 1 1 4 ...
##  $ v174  : int  2 4 2 3 4 1 5 5 4 2 ...
##  $ v175  : int  1 1 4 2 2 1 2 1 5 4 ...
##  $ v176  : int  4 4 4 3 1 4 4 3 3 2 ...
##  $ v177  : int  4 4 5 3 4 2 4 4 4 4 ...
##  $ v178  : int  4 1 4 2 1 1 2 1 4 4 ...
##  $ v179  : int  4 4 4 3 4 2 4 4 5 4 ...
##  $ v180  : int  4 2 5 3 3 1 1 1 1 2 ...
# View sisters67
glimpse(sisters67)
## Observations: 19,278
## Variables: 67
## $ age    <int> 40, 30, 40, 30, 40, 30, 70, 30, 60, 80, 90, 40, 60, 80,...
## $ sister <int> 11545, 16953, 73323, 75339, 36303, 95318, 22474, 114526...
## $ v116   <int> 5, 4, 2, 4, 4, 2, 4, 4, 4, 5, 2, 5, 4, 4, 3, 4, 5, 3, 4...
## $ v117   <int> 2, 1, 2, 3, 2, 4, 5, 1, 5, 1, 3, 2, 5, 4, 1, 1, 1, 1, 2...
## $ v118   <int> 2, 4, 5, 3, 3, 5, 5, 4, 5, 2, 4, 4, 4, 5, 2, 4, 4, 4, 2...
## $ v119   <int> 2, 4, 5, 4, 5, 5, 5, 5, 4, 1, 4, 5, 3, 4, 5, 5, 5, 5, 4...
## $ v120   <int> 4, 1, 3, 3, 1, 1, 5, 1, 5, 2, 3, 1, 5, 4, 4, 1, 1, 1, 2...
## $ v121   <int> 4, 1, 4, 4, 4, 5, 4, 1, 5, 5, 4, 1, 3, 4, 3, 2, 5, 3, 3...
## $ v122   <int> 4, 1, 2, 2, 4, 1, 1, 2, 2, 1, 4, 5, 1, 2, 4, 2, 1, 4, 2...
## $ v123   <int> 5, 5, 3, 4, 4, 3, 1, 5, 2, 5, 3, 4, 3, 4, 5, 5, 4, 5, 4...
## $ v124   <int> 1, 1, 5, 2, 3, 1, 5, 3, 5, 4, 4, 1, 3, 2, 1, 1, 3, 2, 2...
## $ v125   <int> 4, 2, 5, 3, 4, 2, 5, 2, 5, 5, 5, 5, 5, 5, 1, 1, 5, 1, 2...
## $ v126   <int> 2, 1, 1, 3, 1, 1, 5, 1, 5, 2, 4, 1, 5, 1, 3, 1, 5, 1, 2...
## $ v127   <int> 1, 4, 5, 2, 2, 1, 1, 1, 4, 1, 4, 1, 3, 5, 2, 1, 1, 2, 2...
## $ v128   <int> 2, 1, 4, 3, 4, 4, 5, 2, 5, 3, 2, 5, 5, 4, 1, 1, 4, 1, 1...
## $ v129   <int> 4, 4, 5, 4, 5, 4, 5, 5, 4, 1, 5, 1, 5, 5, 5, 1, 5, 5, 5...
## $ v130   <int> 2, 4, 4, 3, 3, 1, 5, 1, 5, 4, 5, 5, 1, 4, 1, 1, 4, 3, 2...
## $ v131   <int> 1, 2, 2, 3, 5, 5, 2, 3, 3, 2, 3, 4, 3, 4, 2, 4, 3, 4, 4...
## $ v132   <int> 5, 5, 5, 4, 5, 2, 2, 5, 4, 5, 4, 5, 5, 5, 4, 5, 3, 5, 5...
## $ v133   <int> 2, 4, 5, 3, 5, 1, 4, 2, 4, 4, 5, 1, 1, 1, 2, 4, 3, 1, 2...
## $ v134   <int> 2, 4, 4, 3, 4, 4, 1, 4, 4, 2, 3, 5, 2, 4, 4, 4, 3, 3, 4...
## $ v135   <int> 5, 5, 4, 3, 5, 4, 1, 5, 5, 2, 4, 5, 3, 5, 2, 5, 3, 5, 5...
## $ v136   <int> 1, 4, 4, 2, 4, 4, 1, 4, 4, 2, 4, 4, 4, 4, 2, 2, 4, 2, 2...
## $ v137   <int> 1, 1, 1, 1, 1, 1, 2, 1, 2, 4, 5, 1, 3, 1, 1, 1, 1, 1, 1...
## $ v138   <int> 2, 1, 3, 1, 3, 1, 4, 1, 2, 1, 3, 2, 1, 3, 2, 1, 4, 3, 1...
## $ v139   <int> 3, 1, 3, 3, 1, 1, 4, 1, 5, 4, 4, 1, 2, 4, 1, 1, 2, 1, 1...
## $ v140   <int> 1, 2, 1, 2, 4, 4, 5, 2, 5, 2, 2, 1, 5, 2, 1, 4, 1, 2, 2...
## $ v141   <int> 5, 5, 4, 3, 3, 3, 4, 5, 4, 4, 5, 5, 5, 5, 5, 4, 4, 3, 5...
## $ v142   <int> 1, 1, 2, 2, 2, 1, 2, 1, 4, 3, 4, 2, 2, 3, 2, 2, 1, 3, 1...
## $ v143   <int> 2, 1, 5, 4, 4, 5, 4, 5, 4, 1, 4, 5, 5, 2, 5, 5, 3, 3, 5...
## $ v144   <int> 1, 2, 1, 2, 1, 1, 3, 1, 4, 2, 2, 1, 1, 1, 1, 1, 1, 1, 1...
## $ v145   <int> 4, 4, 5, 3, 4, 1, 5, 2, 5, 4, 4, 1, 4, 5, 2, 2, 1, 2, 2...
## $ v146   <int> 4, 4, 5, 4, 5, 5, 4, 5, 2, 4, 4, 4, 4, 4, 2, 5, 3, 5, 4...
## $ v147   <int> 2, 2, 1, 2, 3, 1, 2, 1, 2, 2, 3, 1, 2, 1, 2, 2, 3, 2, 4...
## $ v148   <int> 1, 1, 4, 1, 1, 4, 4, 1, 5, 1, 4, 1, 3, 1, 1, 1, 2, 1, 1...
## $ v149   <int> 4, 2, 4, 2, 1, 1, 2, 1, 5, 4, 4, 2, 5, 1, 1, 2, 5, 2, 1...
## $ v150   <int> 2, 1, 2, 3, 1, 4, 2, 1, 5, 2, 5, 2, 2, 2, 3, 1, 5, 1, 1...
## $ v151   <int> 4, 1, 5, 4, 4, 1, 5, 1, 4, 3, 4, 1, 2, 5, 2, 4, 5, 1, 4...
## $ v152   <int> 2, 1, 1, 3, 1, 1, 2, 1, 4, 4, 4, 1, 4, 3, 4, 1, 1, 1, 2...
## $ v153   <int> 5, 5, 5, 5, 5, 5, 5, 5, 5, 2, 3, 2, 5, 5, 4, 5, 5, 5, 4...
## $ v154   <int> 1, 1, 4, 2, 1, 3, 5, 1, 4, 2, 5, 1, 5, 5, 1, 1, 4, 1, 1...
## $ v155   <int> 5, 4, 4, 3, 5, 5, 4, 5, 4, 4, 3, 4, 3, 5, 2, 5, 5, 5, 1...
## $ v156   <int> 1, 1, 2, 2, 1, 1, 5, 1, 5, 2, 5, 1, 1, 4, 1, 1, 3, 1, 1...
## $ v157   <int> 4, 1, 4, 3, 1, 1, 2, 1, 3, 4, 2, 1, 2, 3, 3, 2, 3, 1, 1...
## $ v158   <int> 4, 4, 5, 2, 5, 5, 2, 5, 5, 4, 4, 5, 4, 2, 5, 4, 4, 3, 4...
## $ v159   <int> 1, 4, 4, 1, 2, 1, 4, 1, 4, 2, 4, 1, 3, 2, 1, 1, 2, 1, 1...
## $ v160   <int> 2, 5, 5, 4, 4, 4, 5, 5, 5, 4, 5, 2, 5, 5, 5, 4, 5, 2, 4...
## $ v161   <int> 2, 4, 3, 3, 1, 1, 4, 1, 2, 4, 5, 1, 4, 5, 1, 1, 3, 1, 1...
## $ v162   <int> 5, 4, 5, 4, 4, 4, 5, 5, 5, 4, 4, 5, 5, 5, 3, 4, 5, 5, 5...
## $ v163   <int> 2, 1, 2, 3, 1, 1, 2, 1, 4, 1, 4, 1, 1, 1, 1, 2, 3, 3, 1...
## $ v164   <int> 4, 1, 5, 2, 4, 1, 5, 1, 5, 4, 4, 1, 1, 5, 1, 4, 3, 1, 4...
## $ v165   <int> 2, 1, 3, 2, 1, 1, 1, 1, 2, 2, 5, 2, 1, 5, 2, 3, 3, 2, 4...
## $ v166   <int> 2, 4, 5, 2, 1, 1, 5, 2, 5, 4, 5, 1, 2, 4, 2, 4, 5, 3, 4...
## $ v167   <int> 2, 4, 5, 3, 4, 4, 2, 4, 5, 2, 4, 4, 2, 5, 2, 4, 3, 2, 4...
## $ v168   <int> 5, 5, 5, 4, 5, 5, 5, 5, 4, 5, 5, 4, 5, 5, 3, 4, 3, 4, 5...
## $ v169   <int> 1, 1, 1, 2, 1, 1, 5, 1, 4, 4, 5, 1, 1, 1, 1, 1, 1, 1, 1...
## $ v170   <int> 5, 1, 4, 3, 2, 4, 4, 1, 2, 4, 3, 3, 3, 5, 4, 3, 5, 3, 4...
## $ v171   <int> 5, 5, 5, 4, 1, 2, 5, 5, 5, 5, 5, 1, 5, 5, 3, 4, 5, 4, 5...
## $ v172   <int> 2, 1, 5, 5, 2, 2, 5, 1, 5, 3, 5, 1, 5, 5, 2, 2, 3, 5, 2...
## $ v173   <int> 2, 2, 4, 2, 2, 1, 4, 1, 1, 4, 4, 1, 2, 5, 4, 4, 3, 1, 4...
## $ v174   <int> 2, 4, 2, 3, 4, 1, 5, 5, 4, 2, 4, 5, 3, 4, 2, 4, 3, 3, 4...
## $ v175   <int> 1, 1, 4, 2, 2, 1, 2, 1, 5, 4, 3, 1, 2, 4, 1, 4, 3, 1, 1...
## $ v176   <int> 4, 4, 4, 3, 1, 4, 4, 3, 3, 2, 5, 5, 3, 5, 3, 1, 3, 3, 2...
## $ v177   <int> 4, 4, 5, 3, 4, 2, 4, 4, 4, 4, 5, 2, 5, 5, 3, 2, 5, 4, 4...
## $ v178   <int> 4, 1, 4, 2, 1, 1, 2, 1, 4, 4, 4, 1, 2, 4, 1, 2, 3, 1, 2...
## $ v179   <int> 4, 4, 4, 3, 4, 2, 4, 4, 5, 4, 5, 2, 5, 5, 3, 1, 5, 3, 4...
## $ v180   <int> 4, 2, 5, 3, 3, 1, 1, 1, 1, 2, 4, 2, 2, 5, 1, 1, 3, 3, 2...
# Plot the histogram
ggplot(sisters67, aes(x = age)) +
    geom_histogram(binwidth = 10)

# Tidy the data set
tidy_sisters <- sisters67 %>%
    select(-sister) %>%
    gather(key, value, -age)

# Print the structure of tidy_sisters
glimpse(tidy_sisters)
## Observations: 1,253,070
## Variables: 3
## $ age   <int> 40, 30, 40, 30, 40, 30, 70, 30, 60, 80, 90, 40, 60, 80, ...
## $ key   <chr> "v116", "v116", "v116", "v116", "v116", "v116", "v116", ...
## $ value <int> 5, 4, 2, 4, 4, 2, 4, 4, 4, 5, 2, 5, 4, 4, 3, 4, 5, 3, 4,...
# Overall agreement with all questions varied by age
tidy_sisters %>%
    group_by(age) %>%
    summarize(value = mean(value, na.rm = TRUE))
## # A tibble: 9 x 2
##     age value
##   <int> <dbl>
## 1    20  2.82
## 2    30  2.81
## 3    40  2.82
## 4    50  2.95
## 5    60  3.10
## 6    70  3.25
## 7    80  3.39
## 8    90  3.55
## 9   100  3.93
# Number of respondents agreed or disagreed overall
tidy_sisters %>%
    count(value)
## # A tibble: 5 x 2
##   value      n
##   <int>  <int>
## 1     1 326386
## 2     2 211534
## 3     3 160961
## 4     4 277062
## 5     5 277127
# Visualize agreement with age
tidy_sisters %>%
    filter(key %in% paste0("v", 153:170)) %>%
    group_by(key, value) %>%
    summarize(age = mean(age, na.rm = TRUE)) %>%
    ggplot(aes(value, age, color = key)) +
    geom_line(show.legend = FALSE) +
    facet_wrap(~key, nrow = 3)

# Remove the sister column
sisters_select <- sisters67 %>% 
    select(-sister)

# Build a simple linear regression model
simple_lm <- lm(age ~ ., 
                data = sisters_select)

# Print the summary of the model
summary(simple_lm)
## 
## Call:
## lm(formula = age ~ ., data = sisters_select)
## 
## Residuals:
##     Min      1Q  Median      3Q     Max 
## -46.663  -9.586  -1.207   8.991  53.286 
## 
## Coefficients:
##             Estimate Std. Error t value Pr(>|t|)    
## (Intercept) 27.59542    1.07173  25.748  < 2e-16 ***
## v116        -0.69014    0.07727  -8.931  < 2e-16 ***
## v117        -0.15914    0.08869  -1.794 0.072786 .  
## v118        -0.74668    0.08473  -8.813  < 2e-16 ***
## v119        -0.35314    0.08321  -4.244 2.21e-05 ***
## v120        -0.13875    0.07513  -1.847 0.064813 .  
## v121         0.04265    0.07794   0.547 0.584247    
## v122         0.05237    0.08086   0.648 0.517208    
## v123        -0.96372    0.09061 -10.636  < 2e-16 ***
## v124         0.44543    0.08681   5.131 2.91e-07 ***
## v125         0.50420    0.07425   6.791 1.15e-11 ***
## v126         0.44358    0.08579   5.170 2.36e-07 ***
## v127        -0.04781    0.07915  -0.604 0.545810    
## v128         0.04459    0.07595   0.587 0.557162    
## v129         0.03044    0.07881   0.386 0.699351    
## v130         0.51028    0.08064   6.328 2.54e-10 ***
## v131        -0.54431    0.08417  -6.467 1.02e-10 ***
## v132        -0.02527    0.09337  -0.271 0.786703    
## v133        -0.67041    0.07563  -8.864  < 2e-16 ***
## v134        -0.12144    0.09060  -1.340 0.180130    
## v135         0.45773    0.10886   4.205 2.63e-05 ***
## v136        -0.08790    0.07438  -1.182 0.237293    
## v137         0.74412    0.10230   7.274 3.63e-13 ***
## v138         0.31534    0.10601   2.974 0.002939 ** 
## v139         1.36585    0.10514  12.990  < 2e-16 ***
## v140        -0.73675    0.07371  -9.995  < 2e-16 ***
## v141         0.50515    0.09355   5.400 6.75e-08 ***
## v142        -0.22168    0.08357  -2.653 0.007992 ** 
## v143         0.08320    0.08375   0.993 0.320536    
## v144         1.09413    0.10870  10.066  < 2e-16 ***
## v145        -0.46821    0.08217  -5.698 1.23e-08 ***
## v146        -0.50063    0.08094  -6.185 6.32e-10 ***
## v147        -0.28499    0.09800  -2.908 0.003640 ** 
## v148         1.47288    0.09165  16.070  < 2e-16 ***
## v149        -0.29683    0.08562  -3.467 0.000528 ***
## v150        -0.33882    0.08396  -4.036 5.46e-05 ***
## v151         0.79497    0.08901   8.931  < 2e-16 ***
## v152        -0.02073    0.08179  -0.253 0.799906    
## v153        -0.53982    0.09110  -5.925 3.17e-09 ***
## v154         0.98930    0.07843  12.614  < 2e-16 ***
## v155         0.96066    0.09897   9.706  < 2e-16 ***
## v156         1.07836    0.09176  11.752  < 2e-16 ***
## v157         0.07577    0.08249   0.918 0.358378    
## v158         0.05330    0.08419   0.633 0.526696    
## v159        -0.28846    0.08321  -3.467 0.000528 ***
## v160         0.28066    0.08559   3.279 0.001043 ** 
## v161         0.67235    0.08759   7.677 1.71e-14 ***
## v162        -0.29388    0.10063  -2.920 0.003501 ** 
## v163        -1.38883    0.09242 -15.027  < 2e-16 ***
## v164        -0.44411    0.07017  -6.329 2.52e-10 ***
## v165        -0.49356    0.09033  -5.464 4.71e-08 ***
## v166         0.24787    0.08329   2.976 0.002924 ** 
## v167        -0.06290    0.08185  -0.768 0.442236    
## v168         0.33712    0.09425   3.577 0.000349 ***
## v169         1.44938    0.08634  16.786  < 2e-16 ***
## v170         1.01626    0.09083  11.189  < 2e-16 ***
## v171         0.90086    0.08359  10.777  < 2e-16 ***
## v172         0.07702    0.07176   1.073 0.283135    
## v173         0.76461    0.06936  11.025  < 2e-16 ***
## v174         0.22074    0.07851   2.812 0.004934 ** 
## v175         0.18369    0.07930   2.316 0.020553 *  
## v176         1.03334    0.08996  11.487  < 2e-16 ***
## v177        -0.07908    0.09643  -0.820 0.412153    
## v178        -0.08005    0.08250  -0.970 0.331906    
## v179         0.29778    0.09251   3.219 0.001289 ** 
## v180         0.11524    0.08566   1.345 0.178538    
## ---
## Signif. codes:  0 '***' 0.001 '**' 0.01 '*' 0.05 '.' 0.1 ' ' 1
## 
## Residual standard error: 13.13 on 19212 degrees of freedom
## Multiple R-squared:  0.3332, Adjusted R-squared:  0.3309 
## F-statistic: 147.7 on 65 and 19212 DF,  p-value: < 2.2e-16
# Split the data into training and validation/test sets
set.seed(1234)
in_train <- caret::createDataPartition(sisters_select$age, p = 0.6, list = FALSE)
training <- sisters_select[in_train, ]
validation_test <- sisters_select[-in_train, ]

# Split the validation and test sets
set.seed(1234)
in_test <- caret::createDataPartition(validation_test$age, p = 0.5, list = FALSE)
testing <- validation_test[in_test, ]
validation <- validation_test[-in_test, ]


# Fit a CART model
sisters_cart <- caret::train(age ~ ., method = "rpart", data = training)
## Warning in nominalTrainWorkflow(x = x, y = y, wts = weights, info =
## trainInfo, : There were missing values in resampled performance measures.
# Print the CART model
sisters_cart
## CART 
## 
## 11569 samples
##    65 predictor
## 
## No pre-processing
## Resampling: Bootstrapped (25 reps) 
## Summary of sample sizes: 11569, 11569, 11569, 11569, 11569, 11569, ... 
## Resampling results across tuning parameters:
## 
##   cp          RMSE      Rsquared   MAE     
##   0.02304336  14.61359  0.1724244  12.00686
##   0.04935303  14.89119  0.1403800  12.41303
##   0.11481230  15.54485  0.1046127  13.19914
## 
## RMSE was used to select the optimal model using the smallest value.
## The final value used for the model was cp = 0.02304336.
inSmall <- sample(1:nrow(training), 500, replace=FALSE)
smallSisters <- training[sort(inSmall), ]

sisters_xgb <- caret::train(age ~ ., method = "xgbTree", data = smallSisters)
sisters_gbm <- caret::train(age ~ ., method = "gbm", data = smallSisters, verbose=FALSE)

# Make predictions on the three models
modeling_results <- validation %>%
    mutate(CART = predict(sisters_cart, validation),
           XGB = predict(sisters_xgb, validation),
           GBM = predict(sisters_gbm, validation))

# View the predictions
modeling_results %>% 
    select(CART, XGB, GBM)
## # A tibble: 3,854 x 3
##     CART   XGB   GBM
##    <dbl> <dbl> <dbl>
##  1  49.5  46.2  44.3
##  2  49.5  61.1  56.5
##  3  58.0  59.9  65.6
##  4  58.0  60.0  61.9
##  5  58.0  71.6  74.6
##  6  49.5  50.9  53.4
##  7  49.5  58.6  55.0
##  8  49.5  42.2  38.0
##  9  41.3  41.7  38.2
## 10  58.0  51.6  50.0
## # ... with 3,844 more rows
# Compare performace
yardstick::metrics(modeling_results, truth = age, estimate = CART)
## # A tibble: 1 x 2
##    rmse   rsq
##   <dbl> <dbl>
## 1  14.6 0.163
yardstick::metrics(modeling_results, truth = age, estimate = XGB)
## # A tibble: 1 x 2
##    rmse   rsq
##   <dbl> <dbl>
## 1  13.5 0.287
yardstick::metrics(modeling_results, truth = age, estimate = GBM)
## # A tibble: 1 x 2
##    rmse   rsq
##   <dbl> <dbl>
## 1  13.6 0.286
# Calculate RMSE
testing %>%
    mutate(prediction = predict(sisters_gbm, testing)) %>%
    yardstick::rmse(truth = age, estimate = prediction)
## [1] 13.87981

Business Process Analytics in R

Chapter 1 - Introduction to Process Analysis

Introduction and overview:

  • Efficient processes are core to many businesses, and improved data makes further analysis possible
  • The “internet of things” has created significant amounts of event data - why, what, and who
    • Why is the purpose
    • What is the steps in the process
    • Who is the person responsible for the activity (can be machines or IS or the like; referred to as “resources”)
  • Process workflow is iterative across Extraction-Processing-Analysis

Activities as cornerstones of processes:

  • Data from an online learning platform; activities are captured and can be used for further analysis
  • Activities describe the flow of the process, and are one of the most important components of the process
    • bupaR::activities_labels() is like names() for activities data
    • bupaR::activities() is like summary() for activities data
  • Each case is described by the sequence of activities, known as its “trace”
    • bupaR::traces() will create a frequency table of the traces
    • bupaR::trace_explorer() will visualize the cases

Components of process data:

  • Cases are the objects flowing through the process, while activities are the actions performed on them
    • An activity instance is the occurrence of an activity (which can be a series of events) - specific action, case, time, etc.
    • The “lifecycle status” is an area like Scheduled, Started, Completed, and the like
    • The “event log” is the journal of the events
    • The “resources” are the actors in the process
  • Can create an event log using the eventlog() function
    • event_data %>% eventlog(case_id = “patient”, activity_id = “handling”, activity_instance_id = “handling_id”, timestamp = “time”, lifecycle_id = “registration_type”, resource = “employee”)

Example code includes:

# Load the processmapR package using library
library(processmapR)
## 
## Attaching package: 'processmapR'
## The following object is masked from 'package:stats':
## 
##     frequency
library(bupaR)
## Loading required package: edeaR
## Loading required package: eventdataR
## Loading required package: xesreadR
## Loading required package: processmonitR
## Warning in library(package, lib.loc = lib.loc, character.only = TRUE,
## logical.return = TRUE, : there is no package called 'processmonitR'
## Loading required package: petrinetR
## Warning in library(package, lib.loc = lib.loc, character.only = TRUE,
## logical.return = TRUE, : there is no package called 'petrinetR'
## 
## Attaching package: 'bupaR'
## The following object is masked from 'package:stats':
## 
##     filter
## The following object is masked from 'package:utils':
## 
##     timestamp
handling <- c('Registration', 'Registration', 'Registration', 'Registration', 'Registration', 'Registration', 'Registration', 'Registration', 'Registration', 'Registration', 'Registration', 'Registration', 'Triage and Assessment', 'Triage and Assessment', 'Triage and Assessment', 'Triage and Assessment', 'Triage and Assessment', 'Triage and Assessment', 'Triage and Assessment', 'Triage and Assessment', 'Triage and Assessment', 'Triage and Assessment', 'Triage and Assessment', 'Triage and Assessment', 'Blood test', 'Blood test', 'Blood test', 'Blood test', 'Blood test', 'Blood test', 'Blood test', 'Blood test', 'MRI SCAN', 'MRI SCAN', 'MRI SCAN', 'MRI SCAN', 'MRI SCAN', 'MRI SCAN', 'MRI SCAN', 'MRI SCAN', 'X-Ray', 'X-Ray', 'X-Ray', 'X-Ray', 'Discuss Results', 'Discuss Results', 'Discuss Results', 'Discuss Results', 'Discuss Results', 'Discuss Results', 'Discuss Results', 'Discuss Results', 'Discuss Results', 'Discuss Results', 'Discuss Results', 'Discuss Results', 'Check-out', 'Check-out', 'Check-out', 'Check-out', 'Check-out', 'Check-out', 'Check-out', 'Check-out', 'Check-out', 'Check-out', 'Check-out', 'Check-out', 'Registration', 'Registration', 'Registration', 'Registration', 'Registration', 'Registration', 'Registration', 'Registration', 'Registration', 'Registration', 'Registration', 'Registration', 'Triage and Assessment', 'Triage and Assessment', 'Triage and Assessment', 'Triage and Assessment', 'Triage and Assessment', 'Triage and Assessment', 'Triage and Assessment', 'Triage and Assessment', 'Triage and Assessment', 'Triage and Assessment', 'Triage and Assessment', 'Triage and Assessment', 'Blood test', 'Blood test', 'Blood test', 'Blood test', 'Blood test', 'Blood test', 'Blood test', 'Blood test', 'MRI SCAN', 'MRI SCAN', 'MRI SCAN', 'MRI SCAN', 'MRI SCAN', 'MRI SCAN', 'MRI SCAN', 'MRI SCAN', 'X-Ray', 'X-Ray', 'X-Ray', 'X-Ray', 'Discuss Results', 'Discuss Results', 'Discuss Results', 'Discuss Results', 'Discuss Results', 'Discuss Results', 'Discuss Results', 'Discuss Results', 'Discuss Results', 'Discuss Results', 'Discuss Results', 'Discuss Results', 'Check-out', 'Check-out', 'Check-out', 'Check-out', 'Check-out', 'Check-out', 'Check-out', 'Check-out', 'Check-out', 'Check-out', 'Check-out', 'Check-out')
patient <- c('43', '155', '156', '170', '172', '184', '221', '278', '348', '420', '455', '493', '43', '155', '156', '170', '172', '184', '221', '278', '348', '420', '455', '493', '43', '156', '170', '172', '184', '278', '348', '420', '43', '156', '170', '172', '184', '278', '348', '420', '155', '221', '455', '493', '43', '155', '156', '170', '172', '184', '221', '278', '348', '420', '455', '493', '43', '155', '156', '170', '172', '184', '221', '278', '348', '420', '455', '493', '43', '155', '156', '170', '172', '184', '221', '278', '348', '420', '455', '493', '43', '155', '156', '170', '172', '184', '221', '278', '348', '420', '455', '493', '43', '156', '170', '172', '184', '278', '348', '420', '43', '156', '170', '172', '184', '278', '348', '420', '155', '221', '455', '493', '43', '155', '156', '170', '172', '184', '221', '278', '348', '420', '455', '493', '43', '155', '156', '170', '172', '184', '221', '278', '348', '420', '455', '493')
employee <- c('r1', 'r1', 'r1', 'r1', 'r1', 'r1', 'r1', 'r1', 'r1', 'r1', 'r1', 'r1', 'r2', 'r2', 'r2', 'r2', 'r2', 'r2', 'r2', 'r2', 'r2', 'r2', 'r2', 'r2', 'r3', 'r3', 'r3', 'r3', 'r3', 'r3', 'r3', 'r3', 'r4', 'r4', 'r4', 'r4', 'r4', 'r4', 'r4', 'r4', 'r5', 'r5', 'r5', 'r5', 'r6', 'r6', 'r6', 'r6', 'r6', 'r6', 'r6', 'r6', 'r6', 'r6', 'r6', 'r6', 'r7', 'r7', 'r7', 'r7', 'r7', 'r7', 'r7', 'r7', 'r7', 'r7', 'r7', 'r7', 'r1', 'r1', 'r1', 'r1', 'r1', 'r1', 'r1', 'r1', 'r1', 'r1', 'r1', 'r1', 'r2', 'r2', 'r2', 'r2', 'r2', 'r2', 'r2', 'r2', 'r2', 'r2', 'r2', 'r2', 'r3', 'r3', 'r3', 'r3', 'r3', 'r3', 'r3', 'r3', 'r4', 'r4', 'r4', 'r4', 'r4', 'r4', 'r4', 'r4', 'r5', 'r5', 'r5', 'r5', 'r6', 'r6', 'r6', 'r6', 'r6', 'r6', 'r6', 'r6', 'r6', 'r6', 'r6', 'r6', 'r7', 'r7', 'r7', 'r7', 'r7', 'r7', 'r7', 'r7', 'r7', 'r7', 'r7', 'r7')
handling_id <- c('43', '155', '156', '170', '172', '184', '221', '278', '348', '420', '455', '493', '543', '655', '656', '670', '672', '684', '721', '778', '848', '920', '955', '993', '1020', '1072', '1081', '1082', '1088', '1127', '1163', '1199', '1257', '1309', '1318', '1319', '1325', '1364', '1400', '1436', '1557', '1587', '1710', '1730', '1777', '1889', '1890', '1904', '1906', '1918', '1955', '2012', '2082', '2154', '2189', '2227', '2272', '2384', '2385', '2399', '2401', '2413', '2450', '2507', '2577', '2649', '2684', '2720', '43', '155', '156', '170', '172', '184', '221', '278', '348', '420', '455', '493', '543', '655', '656', '670', '672', '684', '721', '778', '848', '920', '955', '993', '1020', '1072', '1081', '1082', '1088', '1127', '1163', '1199', '1257', '1309', '1318', '1319', '1325', '1364', '1400', '1436', '1557', '1587', '1710', '1730', '1777', '1889', '1890', '1904', '1906', '1918', '1955', '2012', '2082', '2154', '2189', '2227', '2272', '2384', '2385', '2399', '2401', '2413', '2450', '2507', '2577', '2649', '2684', '2720')
registration_type <- c('start', 'start', 'start', 'start', 'start', 'start', 'start', 'start', 'start', 'start', 'start', 'start', 'start', 'start', 'start', 'start', 'start', 'start', 'start', 'start', 'start', 'start', 'start', 'start', 'start', 'start', 'start', 'start', 'start', 'start', 'start', 'start', 'start', 'start', 'start', 'start', 'start', 'start', 'start', 'start', 'start', 'start', 'start', 'start', 'start', 'start', 'start', 'start', 'start', 'start', 'start', 'start', 'start', 'start', 'start', 'start', 'start', 'start', 'start', 'start', 'start', 'start', 'start', 'start', 'start', 'start', 'start', 'start', 'complete', 'complete', 'complete', 'complete', 'complete', 'complete', 'complete', 'complete', 'complete', 'complete', 'complete', 'complete', 'complete', 'complete', 'complete', 'complete', 'complete', 'complete', 'complete', 'complete', 'complete', 'complete', 'complete', 'complete', 'complete', 'complete', 'complete', 'complete', 'complete', 'complete', 'complete', 'complete', 'complete', 'complete', 'complete', 'complete', 'complete', 'complete', 'complete', 'complete', 'complete', 'complete', 'complete', 'complete', 'complete', 'complete', 'complete', 'complete', 'complete', 'complete', 'complete', 'complete', 'complete', 'complete', 'complete', 'complete', 'complete', 'complete', 'complete', 'complete', 'complete', 'complete', 'complete', 'complete', 'complete', 'complete', 'complete', 'complete')
rTime <- c('2017-02-19 04:38:51', '2017-06-03 10:05:28', '2017-06-03 10:05:28', '2017-06-17 15:10:30', '2017-06-17 23:00:33', '2017-06-27 07:48:22', '2017-08-03 17:05:27', '2017-09-26 20:22:49', '2017-11-24 08:28:44', '2018-02-08 03:39:21', '2018-03-14 21:04:28', '2018-04-29 04:55:10', '2017-02-19 07:28:53', '2017-06-04 06:27:00', '2017-06-03 13:23:14', '2017-06-17 16:31:58', '2017-06-18 18:29:13', '2017-06-28 00:14:50', '2017-08-04 07:22:06', '2017-09-27 22:57:03', '2017-11-24 10:33:00', '2018-02-08 17:33:12', '2018-03-15 15:12:41', '2018-04-30 19:40:22', '2017-02-20 19:59:18', '2017-06-04 15:18:50', '2017-06-18 22:51:07', '2017-06-21 02:43:27', '2017-07-01 23:55:10', '2017-09-28 22:58:23', '2017-11-25 12:06:18', '2018-02-12 09:01:38', '2017-02-21 06:49:49', '2017-06-04 23:23:28', '2017-06-19 06:44:30', '2017-06-21 11:16:30', '2017-07-02 11:16:08', '2017-09-29 07:28:10', '2017-11-25 21:54:56', '2018-02-12 19:43:42', '2017-06-05 00:12:24', '2017-08-05 08:25:17', '2018-03-17 10:30:24', '2018-05-02 07:32:45', '2017-02-21 14:50:43', '2017-06-05 14:03:19', '2017-06-05 10:26:16', '2017-06-19 22:46:10', '2017-06-22 04:39:35', '2017-07-03 01:28:49', '2017-08-05 22:06:23', '2017-09-29 19:13:51', '2017-11-26 06:52:23', '2018-02-17 02:44:58', '2018-03-18 00:20:51', '2018-05-02 18:14:11', '2017-02-24 14:58:43', '2017-06-05 15:58:53', '2017-06-05 15:58:53', '2017-06-20 03:48:37', '2017-06-22 08:40:55', '2017-07-03 03:39:51', '2017-08-08 23:17:45', '2017-09-29 21:16:01', '2017-11-27 04:56:53', '2018-02-20 09:49:29', '2018-03-18 08:12:07', '2018-05-03 00:11:10', '2017-02-19 07:28:53', '2017-06-03 14:19:00', '2017-06-03 13:23:14', '2017-06-17 16:31:58', '2017-06-18 01:07:42', '2017-06-27 12:22:51', '2017-08-03 19:25:12', '2017-09-26 22:17:18', '2017-11-24 10:33:00', '2018-02-08 06:01:38', '2018-03-15 00:34:01', '2018-04-29 07:39:14', '2017-02-19 21:58:08', '2017-06-04 14:23:26', '2017-06-04 06:27:00', '2017-06-18 04:14:55', '2017-06-19 00:40:19', '2017-06-28 12:48:20', '2017-08-04 21:09:17', '2017-09-28 12:00:12', '2017-11-25 00:44:30', '2018-02-09 07:05:52', '2018-03-16 04:08:03', '2018-05-01 10:37:51', '2017-02-21 03:12:26', '2017-06-04 19:35:51', '2017-06-19 03:01:11', '2017-06-21 08:02:20', '2017-07-02 07:43:48', '2017-09-29 04:58:49', '2017-11-25 18:30:43', '2018-02-12 13:57:13', '2017-02-21 09:57:05', '2017-06-05 02:46:59', '2017-06-19 11:40:53', '2017-06-21 16:09:26', '2017-07-02 16:03:16', '2017-09-29 12:44:39', '2017-11-26 02:40:30', '2018-02-12 23:53:46', '2017-06-05 04:39:38', '2017-08-05 13:56:39', '2018-03-17 14:09:40', '2018-05-02 12:24:41', '2017-02-21 17:57:58', '2017-06-05 15:58:53', '2017-06-05 14:03:19', '2017-06-20 01:44:29', '2017-06-22 08:40:55', '2017-07-03 03:39:51', '2017-08-05 23:53:27', '2017-09-29 21:16:01', '2017-11-26 09:44:37', '2018-02-17 06:17:57', '2018-03-18 03:22:17', '2018-05-02 21:17:12', '2017-02-24 16:03:49', '2017-06-05 17:22:16', '2017-06-05 17:15:30', '2017-06-20 05:36:40', '2017-06-22 10:59:58', '2017-07-03 05:00:48', '2017-08-09 00:13:39', '2017-09-29 23:42:48', '2017-11-27 06:53:23', '2018-02-20 12:04:00', '2018-03-18 10:48:34', '2018-05-03 02:11:42')
rOrder <- c(43, 155, 156, 170, 172, 184, 221, 278, 348, 420, 455, 493, 543, 655, 656, 670, 672, 684, 721, 778, 848, 920, 955, 993, 1020, 1072, 1081, 1082, 1088, 1127, 1163, 1199, 1257, 1309, 1318, 1319, 1325, 1364, 1400, 1436, 1557, 1587, 1710, 1730, 1777, 1889, 1890, 1904, 1906, 1918, 1955, 2012, 2082, 2154, 2189, 2227, 2272, 2384, 2385, 2399, 2401, 2413, 2450, 2507, 2577, 2649, 2684, 2720, 2764, 2876, 2877, 2891, 2893, 2905, 2942, 2999, 3069, 3141, 3176, 3214, 3264, 3376, 3377, 3391, 3393, 3405, 3442, 3499, 3569, 3641, 3676, 3714, 3741, 3793, 3802, 3803, 3809, 3848, 3884, 3920, 3978, 4030, 4039, 4040, 4046, 4085, 4121, 4157, 4278, 4308, 4431, 4451, 4498, 4610, 4611, 4625, 4627, 4639, 4676, 4733, 4803, 4875, 4910, 4948, 4993, 5105, 5106, 5120, 5122, 5134, 5171, 5228, 5298, 5370, 5405, 5441)

pFrame <- tibble(handling=factor(handling, levels=c('Blood test', 'Check-out', 'Discuss Results', 'MRI SCAN', 'Registration', 'Triage and Assessment', 'X-Ray')), 
                 patient=patient, 
                 employee=factor(employee, levels=c('r1', 'r2', 'r3', 'r4', 'r5', 'r6', 'r7')), 
                 handling_id=handling_id, 
                 registration_type=factor(registration_type, levels=c("complete", "start")), 
                 time=as.POSIXct(rTime), 
                 .order=rOrder
                 )

patients <- eventlog(pFrame,
    case_id = "patient",
    activity_id = "handling",
    activity_instance_id = "handling_id",
    lifecycle_id = "registration_type",
    timestamp = "time",
    resource_id = "employee")


# The function slice can be used to take a slice of cases out of the eventdata. slice(1:10) will select the first ten cases in the event log, where first is defined by the current ordering of the data.

# How many patients are there?
n_cases(patients)
## [1] 12
# Print the summary of the data
summary(patients)
## Number of events:  136
## Number of cases:  12
## Number of traces:  2
## Number of distinct activities:  7
## Average trace length:  11.33333
## 
## Start eventlog:  2017-02-19 04:38:51
## End eventlog:  2018-05-03 02:11:42
##                   handling    patient          employee handling_id       
##  Blood test           :16   Length:136         r1:24    Length:136        
##  Check-out            :24   Class :character   r2:24    Class :character  
##  Discuss Results      :24   Mode  :character   r3:16    Mode  :character  
##  MRI SCAN             :16                      r4:16                      
##  Registration         :24                      r5: 8                      
##  Triage and Assessment:24                      r6:24                      
##  X-Ray                : 8                      r7:24                      
##  registration_type      time                         .order      
##  complete:68       Min.   :2017-02-19 04:38:51   Min.   :  1.00  
##  start   :68       1st Qu.:2017-06-14 15:43:26   1st Qu.: 34.75  
##                    Median :2017-07-03 03:39:51   Median : 68.50  
##                    Mean   :2017-09-06 11:31:32   Mean   : 68.50  
##                    3rd Qu.:2017-11-26 14:32:41   3rd Qu.:102.25  
##                    Max.   :2018-05-03 02:11:42   Max.   :136.00  
## 
# Show the journey of the first patient
slice(patients, 1)
## Event log consisting of:
## 12 events
## 1 traces
## 1 cases
## 6 activities
## 6 activity instances
## 
## # A tibble: 12 x 7
##    handling patient employee handling_id registration_ty~
##    <fct>    <chr>   <fct>    <chr>       <fct>           
##  1 Registr~ 43      r1       43          start           
##  2 Triage ~ 43      r2       543         start           
##  3 Blood t~ 43      r3       1020        start           
##  4 MRI SCAN 43      r4       1257        start           
##  5 Discuss~ 43      r6       1777        start           
##  6 Check-o~ 43      r7       2272        start           
##  7 Registr~ 43      r1       43          complete        
##  8 Triage ~ 43      r2       543         complete        
##  9 Blood t~ 43      r3       1020        complete        
## 10 MRI SCAN 43      r4       1257        complete        
## 11 Discuss~ 43      r6       1777        complete        
## 12 Check-o~ 43      r7       2272        complete        
## # ... with 2 more variables: time <dttm>, .order <int>
# How many distinct activities are there?
n_activities(patients)
## [1] 7
# What are the names of the activities?
activity_labels(patients)
## [1] Registration          Triage and Assessment Blood test           
## [4] MRI SCAN              X-Ray                 Discuss Results      
## [7] Check-out            
## 7 Levels: Blood test Check-out Discuss Results MRI SCAN ... X-Ray
# Create a list of activities
activities(patients)
## # A tibble: 7 x 3
##   handling              absolute_frequency relative_frequency
##   <fct>                              <int>              <dbl>
## 1 Check-out                             12             0.176 
## 2 Discuss Results                       12             0.176 
## 3 Registration                          12             0.176 
## 4 Triage and Assessment                 12             0.176 
## 5 Blood test                             8             0.118 
## 6 MRI SCAN                               8             0.118 
## 7 X-Ray                                  4             0.0588
# Have a look at the different traces
traces(patients)
## # A tibble: 2 x 3
##   trace                                 absolute_frequen~ relative_freque~
##   <chr>                                             <int>            <dbl>
## 1 Registration,Triage and Assessment,B~                 8            0.667
## 2 Registration,Triage and Assessment,X~                 4            0.333
# How many are there?
n_traces(patients)
## [1] 2
# Visualize the traces using trace_explorer
trace_explorer(patients, coverage=1)

# Draw process map
process_map(patients)
## Warning: Prefixing `UQ()` with the rlang namespace is deprecated as of rlang 0.3.0.
## Please use the non-prefixed form or `!!` instead.
## 
##   # Bad:
##   rlang::expr(mean(rlang::UQ(var) * 100))
## 
##   # Ok:
##   rlang::expr(mean(UQ(var) * 100))
## 
##   # Good:
##   rlang::expr(mean(!!var * 100))
## 
## This warning is displayed once per session.
claims <- tibble(id=c("claim1", "claim1", "claim2", "claim2", "claim2"), 
                 action=c(10002L, 10011L, 10015L, 10024L, 10024L), 
                 action_type=c("Check Contract", "Pay Back Decision", "Check Contract", "Pay Back Decision", "Pay Back Decision"), 
                 date=as.Date(c("2008-01-12", "2008-03-22", "2008-01-13", "2008-03-23", "2008-04-14")), 
                 originator=c("Assistant 1", "Manager 2", "Assistant 6", "Manager 2", "Manager 2"), 
                 status=as.factor(c("start", "start", "start", "start", "complete"))
                 )
claims
## # A tibble: 5 x 6
##   id     action action_type       date       originator  status  
##   <chr>   <int> <chr>             <date>     <chr>       <fct>   
## 1 claim1  10002 Check Contract    2008-01-12 Assistant 1 start   
## 2 claim1  10011 Pay Back Decision 2008-03-22 Manager 2   start   
## 3 claim2  10015 Check Contract    2008-01-13 Assistant 6 start   
## 4 claim2  10024 Pay Back Decision 2008-03-23 Manager 2   start   
## 5 claim2  10024 Pay Back Decision 2008-04-14 Manager 2   complete
#create eventlog claims_log 
claims_log <- eventlog(claims,
    case_id = "id",
    activity_id = "action_type",
    activity_instance_id = "action",
    lifecycle_id = "status",
    timestamp = "date",
    resource_id = "originator")

# Print summary
summary(claims_log)
## Number of events:  5
## Number of cases:  2
## Number of traces:  1
## Number of distinct activities:  2
## Average trace length:  2.5
## 
## Start eventlog:  2008-01-12
## End eventlog:  2008-04-14
##       id               action                     action_type
##  Length:5           Length:5           Check Contract   :2   
##  Class :character   Class :character   Pay Back Decision:3   
##  Mode  :character   Mode  :character                         
##                                                              
##                                                              
##                                                              
##       date                  originator      status      .order 
##  Min.   :2008-01-12   Assistant 1:1    complete:1   Min.   :1  
##  1st Qu.:2008-01-13   Assistant 6:1    start   :4   1st Qu.:2  
##  Median :2008-03-22   Manager 2  :3                 Median :3  
##  Mean   :2008-02-28                                 Mean   :3  
##  3rd Qu.:2008-03-23                                 3rd Qu.:4  
##  Max.   :2008-04-14                                 Max.   :5
# Check activity labels
activity_labels(claims_log)
## [1] Check Contract    Pay Back Decision
## Levels: Check Contract Pay Back Decision
# Once you have an eventlog, you can access its complete metadata using the function mapping or the functions case_id, activity_id etc., to inspect individual identifiers.

Chapter 2 - Analysis Techniques

Organizational analysis:

  • Processes are always dependent on resources, even if automated (machines and algorithms can be resources)
    • Who executes the task, how specialized is the knowledge, etc.
    • resource_labels(log_hospital) # will pull out the resources
    • resources(log_hospital) # will pull out frequencies by resource
  • Can create a resource-activity matrix
    • A person who performs only a few activities is considered to be specialized in that activity
    • If only one person ever performs a specific activity, then there is a high risk of “brain drain”
    • The plot() function, applied to an event_log, will create the resource-activity matrix
    • resource_map(log_hospital) # shows arrows between the work flows

Structuredness:

  • Control-flow refers to the succession of activities
    • Each unique flow is referred to as a trace
    • Metrics include entry/exit points, length of cases, presence of activities, rework, etc.
    • log_healthcare %>% start_activities(“activity”) %>% plot()
    • log_healthcare %>% end_activities(“activity”) %>% plot()
  • Rework is when the same activity is done multiple times for the same case
    • Repetitions are when the activity is repeated after some intervening steps
    • Sel-loops are when the activity is repeated immediately after itself
  • The precedence matrix shows the relationships between the activities in a more structured manner
    • eventlog %>% precedence_matrix(type = “absolute”) %>% plot # can be type=“relative” also

Performance analysis:

  • Visuals can include performance process maps and dotted charts; metrics can include throughput time, processing time, idle time
    • eventlog %>% process_map(type = frequency()) # normal process map
    • eventlog %>% process_map(type = performance()) # performance process map
  • The dotted chart shows the freqency of activities over time; basically, a form of scatter plot
    • throughput_time is total time, processing_time is the sum of activity time, idle_time is the sume of when nothing is happening

Linking perspectives:

  • Granularity can help give the statistics at the desired levels
    • (level = “log”, “trace”, “case”, “activity”, “resource”, “resource-activity”)
  • Categorical data can be leveraged using the group_by() functionality - each group will then be calculated separately
    • eventlog %>% group_by(priority) %>% number_of_repetitions(level = “resource”) %>% plot()

Example code includes:

data(sepsis, package="eventdataR")
str(sepsis)
## Classes 'eventlog', 'tbl_df', 'tbl' and 'data.frame':    15214 obs. of  34 variables:
##  $ case_id                  : chr  "A" "A" "A" "A" ...
##  $ activity                 : Factor w/ 16 levels "Admission IC",..: 4 10 3 9 6 5 8 7 2 3 ...
##  $ lifecycle                : Factor w/ 1 level "complete": 1 1 1 1 1 1 1 1 1 1 ...
##  $ resource                 : Factor w/ 26 levels "?","A","B","C",..: 2 3 3 3 4 2 2 2 5 3 ...
##  $ timestamp                : POSIXct, format: "2014-10-22 11:15:41" "2014-10-22 11:27:00" ...
##  $ age                      : int  85 NA NA NA NA NA NA NA NA NA ...
##  $ crp                      : num  NA NA 210 NA NA NA NA NA NA 1090 ...
##  $ diagnose                 : chr  "A" NA NA NA ...
##  $ diagnosticartastrup      : chr  "true" NA NA NA ...
##  $ diagnosticblood          : chr  "true" NA NA NA ...
##  $ diagnosticecg            : chr  "true" NA NA NA ...
##  $ diagnosticic             : chr  "true" NA NA NA ...
##  $ diagnosticlacticacid     : chr  "true" NA NA NA ...
##  $ diagnosticliquor         : chr  "false" NA NA NA ...
##  $ diagnosticother          : chr  "false" NA NA NA ...
##  $ diagnosticsputum         : chr  "false" NA NA NA ...
##  $ diagnosticurinaryculture : chr  "true" NA NA NA ...
##  $ diagnosticurinarysediment: chr  "true" NA NA NA ...
##  $ diagnosticxthorax        : chr  "true" NA NA NA ...
##  $ disfuncorg               : chr  "true" NA NA NA ...
##  $ hypotensie               : chr  "true" NA NA NA ...
##  $ hypoxie                  : chr  "false" NA NA NA ...
##  $ infectionsuspected       : chr  "true" NA NA NA ...
##  $ infusion                 : chr  "true" NA NA NA ...
##  $ lacticacid               : chr  NA NA NA "2.2" ...
##  $ leucocytes               : chr  NA "9.6" NA NA ...
##  $ oligurie                 : chr  "false" NA NA NA ...
##  $ sirscritheartrate        : chr  "true" NA NA NA ...
##  $ sirscritleucos           : chr  "false" NA NA NA ...
##  $ sirscrittachypnea        : chr  "true" NA NA NA ...
##  $ sirscrittemperature      : chr  "true" NA NA NA ...
##  $ sirscriteria2ormore      : chr  "true" NA NA NA ...
##  $ activity_instance_id     : chr  "1" "2" "3" "4" ...
##  $ .order                   : int  1 2 3 4 5 6 7 8 9 10 ...
##  - attr(*, "case_id")= chr "case_id"
##  - attr(*, "activity_id")= chr "activity"
##  - attr(*, "activity_instance_id")= chr "activity_instance_id"
##  - attr(*, "lifecycle_id")= chr "lifecycle"
##  - attr(*, "resource_id")= chr "resource"
##  - attr(*, "timestamp")= chr "timestamp"
# Print list of resources
resource_frequency(sepsis, level="resource")
## # A tibble: 26 x 3
##    resource absolute relative
##    <fct>       <int>    <dbl>
##  1 B            8111  0.533  
##  2 A            3462  0.228  
##  3 C            1053  0.0692 
##  4 E             782  0.0514 
##  5 ?             294  0.0193 
##  6 F             216  0.0142 
##  7 L             213  0.0140 
##  8 O             186  0.0122 
##  9 G             148  0.00973
## 10 I             126  0.00828
## # ... with 16 more rows
# Number of resources per activity
resource_frequency(sepsis, level = "activity")
## # A tibble: 16 x 11
##    activity nr_of_resources   min    q1   mean median     q3   max st_dev
##    <fct>              <int> <int> <dbl>  <dbl>  <dbl>  <dbl> <int>  <dbl>
##  1 Admissi~               4     1    7    29.2   31     53.2    54   28.2
##  2 Admissi~              20     1   17    59.1   40.5   68.2   216   62.7
##  3 CRP                    1  3262 3262  3262   3262   3262    3262   NA  
##  4 ER Regi~               2    65  295   525    525    755     985  651. 
##  5 ER Seps~               2    65  295.  524.   524.   754.    984  650. 
##  6 ER Tria~               1  1053 1053  1053   1053   1053    1053   NA  
##  7 IV Anti~               2    45  228.  412.   412.   595.    778  518. 
##  8 IV Liqu~               2    38  207.  376.   376.   546.    715  479. 
##  9 LacticA~               1  1466 1466  1466   1466   1466    1466   NA  
## 10 Leucocy~               1  3383 3383  3383   3383   3383    3383   NA  
## 11 Release~               1   671  671   671    671    671     671   NA  
## 12 Release~               1    56   56    56     56     56      56   NA  
## 13 Release~               1    25   25    25     25     25      25   NA  
## 14 Release~               1    24   24    24     24     24      24   NA  
## 15 Release~               1     6    6     6      6      6       6   NA  
## 16 Return ~               1   294  294   294    294    294     294   NA  
## # ... with 2 more variables: iqr <dbl>, total <int>
# Plot Number of executions per resource-activity
resource_frequency(sepsis, level = "resource-activity") %>% plot()

# Calculate resource involvement
resource_involvement(sepsis, level="resource")
## # A tibble: 26 x 3
##    resource absolute relative
##    <fct>       <int>    <dbl>
##  1 C            1050   1     
##  2 B            1013   0.965 
##  3 A             985   0.938 
##  4 E             782   0.745 
##  5 ?             294   0.28  
##  6 F             200   0.190 
##  7 O             179   0.170 
##  8 G             147   0.14  
##  9 I             118   0.112 
## 10 M              82   0.0781
## # ... with 16 more rows
# Show graphically 
sepsis %>% resource_involvement(level = "resource") %>% plot

# Compare with resource frequency
resource_frequency(sepsis, level="resource")
## # A tibble: 26 x 3
##    resource absolute relative
##    <fct>       <int>    <dbl>
##  1 B            8111  0.533  
##  2 A            3462  0.228  
##  3 C            1053  0.0692 
##  4 E             782  0.0514 
##  5 ?             294  0.0193 
##  6 F             216  0.0142 
##  7 L             213  0.0140 
##  8 O             186  0.0122 
##  9 G             148  0.00973
## 10 I             126  0.00828
## # ... with 16 more rows
# Min, max and average number of repetitions
sepsis %>% number_of_repetitions(level = "log")
## Using default type: all
##      min       q1   median     mean       q3      max   st_dev      iqr 
## 0.000000 0.000000 2.000000 1.640000 3.000000 5.000000 1.280461 3.000000 
## attr(,"type")
## [1] "all"
# Plot repetitions per activity
sepsis %>% number_of_repetitions(level = "activity") %>% plot
## Using default type: all

# Number of repetitions per resources
sepsis %>% number_of_repetitions(level = "resource")
## Using default type: all
## # resource_metric [26 x 3]
##    first_resource absolute relative
##    <fct>             <dbl>    <dbl>
##  1 ?                     0  0      
##  2 A                     0  0      
##  3 B                  1536  0.189  
##  4 C                     3  0.00285
##  5 D                     0  0      
##  6 E                     0  0      
##  7 F                    16  0.0741 
##  8 G                    67  0.453  
##  9 H                     6  0.109  
## 10 I                    12  0.0952 
## # ... with 16 more rows
eci <- c('21', '21', '21', '21', '21', '21', '21', '21', '21', '31', '31', '31', '31', '31', '31', '31', '31', '31', '31', '41', '41', '41', '41', '41', '41', '41', '51', '51', '51', '51', '51', '51', '51', '61', '61', '61', '61', '61', '61', '91', '91', '91', '91', '91', '91', '101', '101', '101', '101', '101', '101', '111', '111', '111', '111', '121', '121', '121', '121', '121', '121', '121', '121', '121', '131', '131', '131', '131', '131', '131', '131', '131', '161', '161', '171', '171', '171', '171', '181', '181', '181', '181', '181', '181', '201', '201', '201', '201', '201', '201', '201', '12', '12', '12', '12', '12', '22', '22', '22', '22', '22', '22', '32', '32', '32', '32', '32', '32', '42', '42', '42', '42', '52', '52', '52', '52', '52', '82', '82', '82', '82', '82', '92', '92', '92', '92', '92', '102', '102', '102', '102', '102', '112', '112', '122', '122', '21', '21', '21', '21', '21', '21', '21', '21', '21', '31', '31', '31', '31', '31', '31', '31', '31', '31', '31', '41', '41', '41', '41', '41', '41', '41', '51', '51', '51', '51', '51', '51', '51', '61', '61', '61', '61', '61', '61', '91', '91', '91', '91', '91', '91', '101', '101', '101', '101', '101', '101', '111', '111', '111', '111', '121', '121', '121', '121', '121', '121', '121', '121', '121', '131', '131', '131', '131', '131', '131', '131', '131', '161', '161', '171', '171', '171', '171', '181', '181', '181', '181', '181', '181', '201', '201', '201', '201', '201', '201', '201', '12', '12', '12', '12', '12', '22', '22', '22', '22', '22', '22', '32', '32', '32', '32', '32', '32', '42', '42', '42', '42', '52', '52', '52', '52', '52', '82', '82', '82', '82', '82', '92', '92', '92', '92', '92', '102', '102', '102', '102', '102', '112', '112', '122', '122')
ea1 <- c('prepareBreakfast', 'eatingBreakfast', 'snack', 'prepareLunch', 'eatingLunch', 'snack', 'snack', 'prepareDinner', 'eatingDinner', 'prepareBreakfast', 'eatingBreakfast', 'snack', 'snack', 'prepareLunch', 'eatingLunch', 'snack', 'snack', 'prepareDinner', 'eatingDinner', 'prepareBreakfast', 'eatingBreakfast', 'prepareBreakfast', 'eatingBreakfast', 'prepareDinner', 'eatingDinner', 'snack', 'prepareBreakfast', 'eatingBreakfast', 'snack', 'prepareLunch', 'eatingLunch', 'prepareDinner', 'eatingDinner', 'prepareBreakfast', 'eatingBreakfast', 'snack', 'prepareLunch', 'eatingLunch', 'snack', 'prepareBreakfast', 'eatingBreakfast', 'snack', 'prepareDinner', 'eatingDinner', 'snack', 'prepareBreakfast', 'eatingBreakfast', 'snack', 'snack', 'prepareLunch', 'eatingLunch', 'prepareBreakfast', 'prepareLunch', 'eatingLunch', 'snack', 'snack', 'prepareBreakfast', 'eatingBreakfast', 'snack', 'snack', 'prepareLunch', 'eatingLunch', 'snack', 'snack', 'snack', 'eatingBreakfast', 'prepareBreakfast', 'snack', 'prepareLunch', 'eatingLunch', 'snack', 'snack', 'eatingBreakfast', 'prepareBreakfast', 'prepareBreakfast', 'eatingBreakfast', 'snack', 'snack', 'prepareBreakfast', 'eatingBreakfast', 'snack', 'snack', 'snack', 'eatingDinner', 'prepareBreakfast', 'eatingBreakfast', 'prepareLunch', 'eatingLunch', 'snack', 'prepareDinner', 'eatingDinner', 'prepareBreakfast', 'eatingBreakfast', 'prepareLunch', 'eatingLunch', 'snack', 'prepareBreakfast', 'eatingBreakfast', 'snack', 'prepareLunch', 'eatingLunch', 'snack', 'prepareBreakfast', 'eatingBreakfast', 'snack', 'prepareLunch', 'eatingLunch', 'snack', 'eatingLunch', 'prepareBreakfast', 'eatingBreakfast', 'prepareLunch', 'prepareBreakfast', 'eatingBreakfast', 'prepareLunch', 'eatingLunch', 'snack', 'prepareBreakfast', 'eatingBreakfast', 'prepareLunch', 'eatingLunch', 'snack', 'prepareBreakfast', 'eatingBreakfast', 'prepareLunch', 'eatingLunch', 'snack', 'prepareBreakfast', 'eatingBreakfast', 'prepareLunch', 'eatingLunch', 'snack', 'prepareBreakfast', 'eatingBreakfast', 'prepareBreakfast')
ea2 <- c('eatingBreakfast', 'prepareBreakfast', 'eatingBreakfast', 'snack', 'prepareLunch', 'eatingLunch', 'snack', 'snack', 'prepareDinner', 'eatingDinner', 'prepareBreakfast', 'eatingBreakfast', 'snack', 'snack', 'prepareLunch', 'eatingLunch', 'snack', 'snack', 'prepareDinner', 'eatingDinner', 'prepareBreakfast', 'eatingBreakfast', 'prepareBreakfast', 'eatingBreakfast', 'prepareDinner', 'eatingDinner', 'snack', 'prepareBreakfast', 'eatingBreakfast', 'snack', 'prepareLunch', 'eatingLunch', 'prepareDinner', 'eatingDinner', 'prepareBreakfast', 'eatingBreakfast', 'snack', 'prepareLunch', 'eatingLunch', 'snack', 'prepareBreakfast', 'eatingBreakfast', 'snack', 'prepareDinner', 'eatingDinner', 'snack', 'prepareBreakfast', 'eatingBreakfast', 'snack', 'snack', 'prepareLunch', 'eatingLunch', 'prepareBreakfast', 'prepareLunch', 'eatingLunch', 'snack', 'snack', 'prepareBreakfast', 'eatingBreakfast', 'snack', 'snack', 'prepareLunch', 'eatingLunch', 'snack', 'snack', 'snack', 'eatingBreakfast', 'prepareBreakfast', 'snack', 'prepareLunch', 'eatingLunch', 'snack', 'snack', 'eatingBreakfast', 'prepareBreakfast', 'prepareBreakfast', 'eatingBreakfast', 'snack', 'snack', 'prepareBreakfast', 'eatingBreakfast', 'snack', 'snack', 'snack', 'eatingDinner', 'prepareBreakfast', 'eatingBreakfast', 'prepareLunch', 'eatingLunch', 'snack', 'prepareDinner', 'eatingDinner', 'prepareBreakfast', 'eatingBreakfast', 'prepareLunch', 'eatingLunch', 'snack', 'prepareBreakfast', 'eatingBreakfast', 'snack', 'prepareLunch', 'eatingLunch', 'snack', 'prepareBreakfast', 'eatingBreakfast', 'snack', 'prepareLunch', 'eatingLunch', 'snack', 'eatingLunch', 'prepareBreakfast', 'eatingBreakfast', 'prepareLunch', 'prepareBreakfast', 'eatingBreakfast', 'prepareLunch', 'eatingLunch', 'snack', 'prepareBreakfast', 'eatingBreakfast', 'prepareLunch', 'eatingLunch', 'snack', 'prepareBreakfast', 'eatingBreakfast', 'prepareLunch', 'eatingLunch', 'snack', 'prepareBreakfast', 'eatingBreakfast', 'prepareLunch', 'eatingLunch', 'snack', 'prepareBreakfast', 'eatingBreakfast', 'prepareBreakfast', 'eatingBreakfast')
eaii <- c('9', '10', '19', '23', '24', '26', '36', '40', '41', '51', '52', '58', '60', '62', '63', '67', '69', '72', '73', '86', '87', '89', '90', '104', '105', '107', '119', '120', '128', '132', '133', '138', '139', '149', '150', '156', '159', '160', '164', '174', '175', '192', '194', '195', '198', '205', '206', '208', '211', '213', '214', '229', '236', '237', '239', '245', '251', '252', '253', '255', '259', '260', '262', '264', '271', '276', '281', '287', '292', '293', '297', '299', '310', '312', '331', '332', '336', '347', '363', '364', '374', '376', '387', '389', '434', '435', '447', '448', '450', '453', '454', '462', '463', '471', '472', '475', '483', '484', '487', '491', '492', '496', '508', '509', '512', '517', '518', '522', '536', '540', '541', '543', '562', '563', '565', '566', '572', '584', '585', '589', '590', '598', '615', '616', '618', '619', '627', '639', '640', '642', '643', '653', '665', '666', '682', '683', '9', '10', '19', '23', '24', '26', '36', '40', '41', '51', '52', '58', '60', '62', '63', '67', '69', '72', '73', '86', '87', '89', '90', '104', '105', '107', '119', '120', '128', '132', '133', '138', '139', '149', '150', '156', '159', '160', '164', '174', '175', '192', '194', '195', '198', '205', '206', '208', '211', '213', '214', '229', '236', '237', '239', '245', '251', '252', '253', '255', '259', '260', '262', '264', '271', '276', '281', '287', '292', '293', '297', '299', '310', '312', '331', '332', '336', '347', '363', '364', '374', '376', '387', '389', '434', '435', '447', '448', '450', '453', '454', '462', '463', '471', '472', '475', '483', '484', '487', '491', '492', '496', '508', '509', '512', '517', '518', '522', '536', '540', '541', '543', '562', '563', '565', '566', '572', '584', '585', '589', '590', '598', '615', '616', '618', '619', '627', '639', '640', '642', '643', '653', '665', '666', '682', '683')
elci <- c('start', 'start', 'start', 'start', 'start', 'start', 'start', 'start', 'start', 'start', 'start', 'start', 'start', 'start', 'start', 'start', 'start', 'start', 'start', 'start', 'start', 'start', 'start', 'start', 'start', 'start', 'start', 'start', 'start', 'start', 'start', 'start', 'start', 'start', 'start', 'start', 'start', 'start', 'start', 'start', 'start', 'start', 'start', 'start', 'start', 'start', 'start', 'start', 'start', 'start', 'start', 'start', 'start', 'start', 'start', 'start', 'start', 'start', 'start', 'start', 'start', 'start', 'start', 'start', 'start', 'start', 'start', 'start', 'start', 'start', 'start', 'start', 'start', 'start', 'start', 'start', 'start', 'start', 'start', 'start', 'start', 'start', 'start', 'start', 'start', 'start', 'start', 'start', 'start', 'start', 'start', 'start', 'start', 'start', 'start', 'start', 'start', 'start', 'start', 'start', 'start', 'start', 'start', 'start', 'start', 'start', 'start', 'start', 'start', 'start', 'start', 'start', 'start', 'start', 'start', 'start', 'start', 'start', 'start', 'start', 'start', 'start', 'start', 'start', 'start', 'start', 'start', 'start', 'start', 'start', 'start', 'start', 'start', 'start', 'start', 'start', 'complete', 'complete', 'complete', 'complete', 'complete', 'complete', 'complete', 'complete', 'complete', 'complete', 'complete', 'complete', 'complete', 'complete', 'complete', 'complete', 'complete', 'complete', 'complete', 'complete', 'complete', 'complete', 'complete', 'complete', 'complete', 'complete', 'complete', 'complete', 'complete', 'complete', 'complete', 'complete', 'complete', 'complete', 'complete', 'complete', 'complete', 'complete', 'complete', 'complete', 'complete', 'complete', 'complete', 'complete', 'complete', 'complete', 'complete', 'complete', 'complete', 'complete', 'complete', 'complete', 'complete', 'complete', 'complete', 'complete', 'complete', 'complete', 'complete', 'complete', 'complete', 'complete', 'complete', 'complete', 'complete', 'complete', 'complete', 'complete', 'complete', 'complete', 'complete', 'complete', 'complete', 'complete', 'complete', 'complete', 'complete', 'complete', 'complete', 'complete', 'complete', 'complete', 'complete', 'complete', 'complete', 'complete', 'complete', 'complete', 'complete', 'complete', 'complete', 'complete', 'complete', 'complete', 'complete', 'complete', 'complete', 'complete', 'complete', 'complete', 'complete', 'complete', 'complete', 'complete', 'complete', 'complete', 'complete', 'complete', 'complete', 'complete', 'complete', 'complete', 'complete', 'complete', 'complete', 'complete', 'complete', 'complete', 'complete', 'complete', 'complete', 'complete', 'complete', 'complete', 'complete', 'complete', 'complete', 'complete', 'complete', 'complete', 'complete', 'complete', 'complete', 'complete', 'complete', 'complete')
ets1 <- c('2012-11-12 09:42:02', '2012-11-12 09:52:33', '2012-11-12 11:05:44', '2012-11-12 13:45:49', '2012-11-12 13:48:49', '2012-11-12 15:23:00', '2012-11-12 18:47:29', '2012-11-12 22:35:21', '2012-11-12 22:35:21', '2012-11-13 08:56:37', '2012-11-13 09:04:54', '2012-11-13 10:14:04', '2012-11-13 13:47:45', '2012-11-13 14:08:24', '2012-11-13 14:19:01', '2012-11-13 17:34:23', '2012-11-13 18:51:51', '2012-11-13 23:05:07', '2012-11-13 23:17:07', '2012-11-14 09:06:08', '2012-11-14 09:17:48', '2012-11-14 10:38:16', '2012-11-14 10:44:16', '2012-11-14 21:30:09', '2012-11-14 21:37:09', '2012-11-14 22:14:23', '2012-11-15 09:37:15', '2012-11-15 09:47:12', '2012-11-15 10:11:08', '2012-11-15 14:35:27', '2012-11-15 14:41:27', '2012-11-15 22:07:26', '2012-11-15 22:26:02', '2012-11-16 10:39:14', '2012-11-16 10:52:56', '2012-11-16 12:09:10', '2012-11-16 14:13:00', '2012-11-16 14:19:00', '2012-11-16 18:11:36', '2012-11-19 10:13:23', '2012-11-19 10:25:00', '2012-11-19 15:55:22', '2012-11-19 21:47:27', '2012-11-19 21:59:27', '2012-11-19 22:31:06', '2012-11-20 10:20:00', '2012-11-20 10:21:02', '2012-11-20 11:00:16', '2012-11-20 13:03:28', '2012-11-20 14:25:11', '2012-11-20 14:41:22', '2012-11-21 10:01:00', '2012-11-21 15:02:08', '2012-11-21 15:15:08', '2012-11-21 17:50:29', '2012-11-22 01:40:42', '2012-11-22 10:19:15', '2012-11-22 10:26:15', '2012-11-22 11:02:27', '2012-11-22 11:56:06', '2012-11-22 15:05:51', '2012-11-22 15:12:55', '2012-11-22 16:43:08', '2012-11-22 18:15:32', '2012-11-23 00:36:00', '2012-11-23 01:03:00', '2012-11-23 09:49:00', '2012-11-23 12:53:06', '2012-11-23 14:01:08', '2012-11-23 14:23:08', '2012-11-23 16:57:24', '2012-11-23 17:58:00', '2012-11-26 09:06:12', '2012-11-26 09:57:12', '2012-11-27 10:20:26', '2012-11-27 10:30:50')
ets2 <- c('2012-11-27 11:54:15', '2012-11-27 19:46:15', '2012-11-28 09:27:15', '2012-11-28 09:34:15', '2012-11-28 12:28:02', '2012-11-28 13:16:33', '2012-11-28 19:30:08', '2012-11-28 22:15:02', '2012-11-30 10:43:19', '2012-11-30 10:46:19', '2012-11-30 14:51:36', '2012-11-30 15:08:36', '2012-11-30 17:30:40', '2012-11-30 22:12:05', '2012-11-30 22:16:07', '2011-11-28 10:38:00', '2011-11-28 10:43:00', '2011-11-28 14:31:06', '2011-11-28 14:42:00', '2011-11-28 20:20:55', '2011-11-29 12:09:09', '2011-11-29 12:11:01', '2011-11-29 13:25:29', '2011-11-29 15:15:14', '2011-11-29 15:23:00', '2011-11-29 16:32:20', '2011-11-30 10:23:46', '2011-11-30 10:28:46', '2011-11-30 13:05:27', '2011-11-30 14:39:42', '2011-11-30 14:56:00', '2011-11-30 16:41:05', '2011-11-30 14:37:00', '2011-12-01 11:17:05', '2011-12-01 11:20:05', '2011-12-01 14:29:37', '2011-12-02 12:29:08', '2011-12-02 12:32:08', '2011-12-02 14:47:18', '2011-12-02 14:51:00', '2011-12-02 19:40:44', '2011-12-05 12:15:45', '2011-12-05 12:18:05', '2011-12-05 15:00:55', '2011-12-05 15:14:00', '2011-12-05 19:24:11', '2011-12-06 11:30:19', '2011-12-06 11:33:02', '2011-12-06 14:41:16', '2011-12-06 14:56:00', '2011-12-06 19:22:50', '2011-12-07 11:12:17', '2011-12-07 11:17:22', '2011-12-07 14:04:32', '2011-12-07 14:14:00', '2011-12-07 19:23:55', '2011-12-08 11:25:12', '2011-12-08 11:29:01', '2011-12-09 11:00:13', '2011-12-09 11:03:33', '2012-11-12 09:50:02', '2012-11-12 09:55:29', '2012-11-12 12:39:42', '2012-11-12 14:48:14', '2012-11-12 14:53:14', '2012-11-12 15:31:53', '2012-11-12 19:00:56', '2012-11-12 22:37:55', '2012-11-12 22:40:55', '2012-11-13 09:00:26', '2012-11-13 09:10:12', '2012-11-13 10:51:55', '2012-11-13 14:03:31', '2012-11-13 14:18:36', '2012-11-13 14:42:36', '2012-11-13 17:36:34', '2012-11-13 19:45:03', '2012-11-13 23:15:33', '2012-11-13 23:37:33', '2012-11-14 09:09:41', '2012-11-14 09:21:43', '2012-11-14 11:43:23', '2012-11-14 11:06:23', '2012-11-14 21:35:17', '2012-11-14 21:47:18', '2012-11-14 22:17:47', '2012-11-15 09:44:06', '2012-11-15 09:48:08', '2012-11-15 10:23:49', '2012-11-15 15:40:32', '2012-11-15 15:46:32', '2012-11-15 22:22:44', '2012-11-15 22:31:00', '2012-11-16 10:42:13') 
ets3 <- c('2012-11-16 10:52:58', '2012-11-16 12:09:57', '2012-11-16 14:58:55', '2012-11-16 14:55:55', '2012-11-16 18:14:49', '2012-11-19 10:17:12', '2012-11-19 10:33:59', '2012-11-19 16:07:49', '2012-11-19 21:59:01', '2012-11-19 22:24:58', '2012-11-19 22:31:59', '2012-11-20 10:21:02', '2012-11-20 10:37:51', '2012-11-20 11:14:44', '2012-11-20 13:28:35', '2012-11-20 14:40:16', '2012-11-20 15:10:16', '2012-11-21 10:06:50', '2012-11-21 15:14:47', '2012-11-21 15:30:55', '2012-11-21 17:55:48', '2012-11-22 01:45:42', '2012-11-22 10:25:45', '2012-11-22 10:59:45', '2012-11-22 11:10:30', '2012-11-22 12:09:07', '2012-11-22 15:12:19', '2012-11-22 15:26:18', '2012-11-22 16:51:54', '2012-11-22 18:17:25', '2012-11-23 00:41:13', '2012-11-23 10:28:57', '2012-11-23 10:01:57', '2012-11-23 12:57:33', '2012-11-23 14:20:47', '2012-11-23 14:38:47', '2012-11-23 16:57:43', '2012-11-23 18:06:38', '2012-11-26 10:37:28', '2012-11-26 10:05:28', '2012-11-27 10:30:43', '2012-11-27 10:44:43', '2012-11-27 11:54:59', '2012-11-27 19:46:56', '2012-11-28 09:33:52', '2012-11-28 09:44:52', '2012-11-28 12:57:42', '2012-11-28 13:38:45', '2012-11-28 19:45:20', '2012-11-28 22:18:43', '2012-11-30 11:45:40', '2012-11-30 11:51:40', '2012-11-30 15:05:54', '2012-11-30 15:20:00', '2012-11-30 17:42:59', '2012-11-30 22:15:48', '2012-11-30 22:39:48', '2011-11-28 10:42:55', '2011-11-28 10:49:00', '2011-11-28 14:41:54', '2011-11-28 15:04:00', '2011-11-28 20:20:59', '2011-11-29 12:10:37', '2011-11-29 12:19:00', '2011-11-29 13:25:32', '2011-11-29 15:22:57', '2011-11-29 15:49:00', '2011-11-29 16:32:23', '2011-11-30 10:27:58', '2011-11-30 10:38:58', '2011-11-30 13:05:31', '2011-11-30 14:55:24', '2011-11-30 15:11:00', '2011-11-30 16:41:09', '2011-11-30 15:08:00', '2011-12-01 11:19:43', '2011-12-01 11:29:43', '2011-12-01 14:36:38', '2011-12-02 12:31:10', '2011-12-02 12:37:10', '2011-12-02 14:50:19', '2011-12-02 15:24:00', '2011-12-02 19:40:50', '2011-12-05 12:17:58', '2011-12-05 12:26:02', '2011-12-05 15:13:55', '2011-12-05 15:42:00', '2011-12-05 19:24:16', '2011-12-06 11:32:49', '2011-12-06 11:38:51', '2011-12-06 14:55:18', '2011-12-06 15:18:18', '2011-12-06 19:22:55', '2011-12-07 11:17:14', '2011-12-07 11:22:35', '2011-12-07 14:13:34', '2011-12-07 14:41:00', '2011-12-07 20:38:18', '2011-12-08 11:28:24', '2011-12-08 11:35:55', '2011-12-09 11:03:09', '2011-12-09 11:09:08')
etsF <- c(ets1, ets2, ets3)

eatData <- tibble(case_id=eci, 
                  activity=factor(c(ea1, ea2)), 
                  activity_instance_id=eaii, 
                  lifecycle_id=factor(elci), 
                  resource=factor("UNDEFINED"), 
                  timestamp=as.POSIXct(etsF)
                  )

eat_patterns <- eventlog(eatData,
    case_id = "case_id",
    activity_id = "activity",
    activity_instance_id = "activity_instance_id",
    lifecycle_id = "lifecycle_id",
    timestamp = "timestamp",
    resource_id = "resource")


# Create performance map
eat_patterns %>% process_map(type = performance(FUN = median, units = "hours"))
# Inspect variation in activity durations graphically
eat_patterns %>% processing_time(level = "activity") %>% plot()

# Draw dotted chart
eat_patterns %>% dotted_chart(x = "relative_day", sort = "start_day", units = "secs")

# Time per activity
# daily_activities %>% processing_time(level = "activity") %>% plot

# Average duration of recordings
# daily_activities %>% throughput_time(level="log", units = "hours")

# Missing activities
# daily_activities %>% idle_time(level="log", units = "hours")


# Distribution throughput time
# vacancies %>% throughput_time(units="days")

# Distribution throughput time per department
# vacancies %>% group_by(vacancy_department) %>% throughput_time(units="days") %>% plot()

# Repetitions of activities
# vacancies %>% number_of_repetitions(level = "activity") %>% arrange(-relative)

Chapter 3 - Event Data Processing

Filtering cases:

  • Sometimes there are too many cases, too many activities, missing data, and the like
    • Can filter by either cases or events (time periods or specific activity types)
    • Three levels of cases - performance, control-flow, and time frame
  • Look at long cases for what went wrong, and short cases for what to mimic
    • filter_throughput_time(log, interval = c(5,10)) # absolute case length is 5-10 days
    • filter_throughput_time(log, percentage = 0.5) # shortest 50% of the cases
    • filter_throughput_time(log, interval = c(5,10), units = “days”, reverse =TRUE) # cases that are NOT 5-10 days
    • filter_throughput_time(log, interval = c(5,NA), units = “days”) # cases longer than 5 days
  • Control-flow filters can be based on activity presence/absence, timing, and the like

Filtering events - trim, frequency, label, general attribute:

  • Can trim to a time period based on start or end
    • filter_time_period(log, interval = ymd(c(“20180110”,“20180122”)), filter_method = “trim”) # discards everything else
  • Can trim based on a specific start and end activities
    • filter_trim(start_activities = “blues”) # traces that have no blues will be discarded
    • filter_trim(start_activities = “blues”, end_activities = “greens”) # traces that do not have blues followed by greens will be discarded
    • Can set reverse=TRUE to get the opposites of these
  • Can filter by frequencies by either activity or resource
    • filter_activity_frequency(log, interval = c(50,100))
    • filter_activity_frequency(log, percentage = 0.8)
    • filter_resource_frequency(log, interval = c(60,900))
    • filter_resource_frequency(log, percentage = 0.6)
  • Can filter by labels
    • filter_activity(log, activities = c(“reds”,“oranges”,“purples”)))
    • dplyr::filter(log, cost > 1000, priority == “High”, …)

Aggregating events - Is-A and Part-of:

  • The Is-A is when there are many subtypes of activity that are really all part of a main activity
    • act_unite(log, “New name” = c(“Old Variant 1”,“Old Variant 2”,“Old Variant 3”), …) # same number of activity instances, just fewer names
  • The Part-of is when there are clearly distinct activities that can also be considered components of a higher-level activity
    • act_collapse(log, “Sub process” = c(“Part 1”,“Part 2”,“Part 3”), …) # fewer number of activity instances, as they are collapsed to a single activity

Enriching events - mutation (adding calculated variables):

  • The dplyr::mutate() can be used to directly add variables such as the cost
    • log %>% group_by_case() %>% mutate(total_cost = sum(cost, na.rm = TRUE) # group_by_case() is a function applied to event logs
    • log %>% group_by_case() %>% mutate(total_cost = sum(cost, na.rm = TRUE) %>% mutate(impact = case_when(cost <= 1000 ~ “Low”, cost <= 5000 ~ “Medium”, TRUE ~ “High”))
    • log %>% group_by_case() %>% mutate(refund_made = any(str_detect(activity, “Pay Claim”)))
  • Metric functions can be used directly, with apped=TRUE, to both calculate the metric and add to the event log
    • log %>% througput_time(level = “case”, units = “days”, append = TRUE) %>% mutate(on_time = processing_time_case <= 7)

Example code includes:

# Select top 20% of cases according to trace frequency
happy_path <- filter_trace_frequency(vacancies, percentage = 0.2)

# Visualize using process map
happy_path %>% process_map(type=requency(value = "absolute_case"))

# Compute throughput time
happy_path %>% throughput_time(units="days")


# Find no_declines
no_declines <- filter_activity_presence(vacancies, activities = "Decline Candidate", reverse=TRUE)

# What is the average number of  
first_hit <- filter_activity_presence(vacancies, activities = c("Send Offer", "Offer Accepted"), method="all")

# Create a performance map
first_hit %>% process_map(type=performance())

# Compute throughput time
first_hit %>% throughput_time()


# Create not_refused
not_refused <- vacancies %>% filter_precedence(antecedents = "Receive Response", consequents = "Review Non Acceptance", precedence_type = "directly_follows", filter_method = "none") 

# Select longest_cases
worst_cases <- not_refused %>% filter_throughput_time(interval=c(300, NA))

# Show the different traces
worst_cases %>% trace_explorer(coverage=1)


# Select activities
disapprovals <- vacancies %>% filter_activity(activities=c("Construct Offer", "Disapprove Offer", "Revise Offer","Disapprove Revision", "Restart Procedure"))

# Explore traces
disapprovals %>% trace_explorer(coverage=0.8)

# Performance map
disapprovals %>% process_map(type = performance(FUN = sum, units = "weeks"))


# Select cases
high_paid <- vacancies %>% filter(vacancy_department=="R&D", vacancy_salary_range==">100000")

# Most active resources
high_paid %>% resource_frequency(level="resource")

# Create a dotted chart
high_paid %>% dotted_chart(x="absolute", sort="start")

# Filtered dotted chart
library(lubridate)
high_paid %>% filter_time_period(interval = ymd(c("20180321","20180620")), filter_method = "trim") %>% dotted_chart(x="absolute", sort="start")


# Count activities and instances
n_activities(vacancies)
n_activity_instances(vacancies)

# Combine activities
united_vacancies <- vacancies %>% 
    act_unite("Disapprove Contract Offer" = c("Disapprove Offer","Disapprove Revision"),
              "Approve Contract Offer" = c("Approve Offer","Approve Revision"), 
              "Construct Contract Offer" = c("Construct Offer","Revise Offer")
              )
              
# Count activities and instances
n_activities(united_vacancies)
n_activity_instances(united_vacancies)


# Aggregate sub processes
aggregated_vacancies <- act_collapse(united_vacancies, 
                            "Interviews" = c("First Interview","Second Interview","Third Interview"),
                            "Prepare Recruitment" = c("Publish Position","File Applications","Check References"),
                            "Create Offer" = c("Construct Contract Offer", "Disapprove Contract Offer", "Approve Contract Offer")
                            )

# Calculated number of activities and activity instances
n_activities(aggregated_vacancies)
n_activity_instances(aggregated_vacancies)

# Create performance map
aggregated_vacancies %>% process_map(type=performance())


# Add total_cost
vacancies_cost <- vacancies %>% 
    group_by_case() %>% 
    mutate(total_cost = sum(activity_cost, na.rm = TRUE))

# Add cost_impact
vacancies_impact <- vacancies_cost %>%




# Compute throughput time per impact
vacancies_impact %>% group_by(cost_impact) %>% throughput_time(units = "weeks") %>% plot()


# Create cost_profile
vacancies_profile <- vacancies_impact %>%
    mutate(cost_profile = case_when(cost_impact == "High" & urgency < 7 ~ "Disproportionate",
                                    cost_impact == "Medium" & urgency < 5 ~ "Excessive",
                                    cost_impact == "Low" & urgency > 6 ~ "Lacking",
                                    TRUE ~ "Appropriate")) 

# Compare number of cases 
vacancies_profile %>% 
    group_by(cost_profile) %>%
    n_cases()
    
# Explore lacking traces
vacancies_profile %>%
  filter(cost_profile == "Lacking") %>%
  process_map()

Chapter 4 - Case Study

Preparing the event data - example includes data from Sales, Purchasing, Manufacturing, Packaging & Delivery, Accounting:

  • While all departments need to work together, it is common for each department to have different data, business rules, relational data, etc.
  • Need to create event data first prior to running anything in the bupar package
  • Various field names (ends in _at or _by) may indicate the timing and resource levels
  • The tidyverse tools are helpful for creating the initial data

Getting to know the process:

  • Identify data sources, transform so that each row is an event, harmonize them, create an eventlog
  • Start with high-level understanding of the process - summary(otc)
    • activity_presence(otc) %>% plot()
    • trace_length(otc) %>% plot()
    • start_activities(otc, “activity”) %>% plot()
    • end_activities(otc, “activity”) %>% plot()

Roles and rules:

  • Parallel activities can be run in any order, which can cause an explosion in the number of traces - collapsing can help with abstraction
  • Research questions may be related to performance, compliance, etc.
  • The “4-eye” pricniple says that certain activities should not be performed by the same person

Fast production, fast delivery:

  • Dotted charts can show the progression of the cases - request for quotation may be declined, or the offer may only be sent (no response)
  • May want to look at the performance by stages (sub-groups of activities), for more fair comparisons

Course recap:

  • Process maps
  • Process analytics
  • Data preprocessing
  • Analysis and use cases

Example code includes:

quotations <- readRDS("./RInputFiles/otc_quotations.RDS")

# Inspect quotations
str(quotations)
## Classes 'tbl_df', 'tbl' and 'data.frame':    1833 obs. of  17 variables:
##  $ quotation_id            : chr  "quo-1003" "quo-1004" "quo-1006" "quo-1008" ...
##  $ cancelled_at            : chr  "2017-05-22 13:28:04" NA NA NA ...
##  $ cancelled_by            : Factor w/ 20 levels "Amy","Andrea",..: 10 NA NA NA 8 NA NA NA NA NA ...
##  $ manufactContacted_at    : chr  "2017-04-22 17:58:11" "2017-06-18 13:47:50" "2017-10-28 13:55:51" NA ...
##  $ manufactContacted_by    : Factor w/ 20 levels "Amy","Andrea",..: 11 11 11 NA NA NA 11 14 NA NA ...
##  $ received_at             : chr  "2017-04-16 20:34:12" "2017-06-09 11:19:31" "2017-10-14 18:55:47" "2017-09-08 13:29:05" ...
##  $ received_by             : Factor w/ 20 levels "Amy","Andrea",..: 2 8 8 8 8 8 10 8 2 2 ...
##  $ reminded_at             : chr  "2017-05-14 19:06:41" NA NA NA ...
##  $ reminded_by             : Factor w/ 20 levels "Amy","Andrea",..: 8 NA NA NA 8 NA 8 8 NA NA ...
##  $ send_at                 : chr  "2017-05-08 14:20:30" "2017-07-02 18:50:58" "2017-11-09 11:27:11" NA ...
##  $ send_by                 : Factor w/ 20 levels "Amy","Andrea",..: 10 2 2 NA 2 NA 2 2 NA 2 ...
##  $ supplierContacted_at    : chr  "2017-04-29 13:43:18" "2017-06-20 12:19:31" "2017-10-26 18:06:29" NA ...
##  $ supplierContacted_by    : Factor w/ 20 levels "Amy","Andrea",..: 14 11 11 NA 11 NA 11 14 NA 14 ...
##  $ supplierOfferReceived_at: chr  "2017-05-03 19:09:21" "2017-06-23 19:33:10" "2017-10-30 10:36:44" NA ...
##  $ supplierOfferReceived_by: Factor w/ 20 levels "Amy","Andrea",..: 14 11 14 NA 14 NA 14 14 NA 14 ...
##  $ warehouseContacted_at   : chr  "2017-04-24 19:36:10" "2017-06-15 19:30:07" "2017-10-22 17:57:26" NA ...
##  $ warehouseContacted_by   : Factor w/ 20 levels "Amy","Andrea",..: 11 11 11 NA 14 NA 11 14 NA 14 ...
# Create offer_history
offer_history <- quotations %>%
    gather(key, value, -quotation_id) %>%
    separate(key, into = c("activity", "info"))
## Warning: attributes are not identical across measure variables;
## they will be dropped
# Recode the key variable
offer_history <- offer_history %>%
    mutate(info = fct_recode(info,  "timestamp" = 'at',  "resource" = 'by'))

# Spread the info variable
offer_history <- offer_history %>%
    spread(info, value)


validations <- readRDS("./RInputFiles/otc_validations.RDS")

# Inspect validations
str(validations)
## Classes 'tbl_df', 'tbl' and 'data.frame':    1833 obs. of  4 variables:
##  $ quotation_id: chr  "quo-1003" "quo-1004" "quo-1006" "quo-1008" ...
##  $ resource    : chr  "Jonathan" "Andrea" "Katherine" "Andrea" ...
##  $ started     : chr  "2017-04-17 14:59:08" "2017-06-11 13:10:45" "2017-10-16 15:59:18" "2017-09-09 17:58:39" ...
##  $ completed   : chr  "2017-04-19 18:32:57" "2017-06-13 12:18:57" "2017-10-18 16:21:56" "2017-09-12 20:58:14" ...
# Create validate_history
validate_history <- validations %>%
    mutate(
        activity = "Validate",
        action = paste(quotation_id, "validate",  sep = "-"))

# Gather the timestamp columns
validate_history <- validate_history  %>%
    gather(lifecycle, timestamp, started, completed)


# Recode the lifecycle column of validate_history
validate_history <- validate_history %>%
    mutate(lifecycle = fct_recode(lifecycle,
                "start" = "started",
                "complete" = "completed"))


# Add lifecycle and action column to offer_history
offer_history <- offer_history %>%
    mutate(
        lifecycle = "complete",
        action = paste(quotation_id, 1:n(), sep = "-"))

# Create sales_history
sales_history <- bind_rows(validate_history, offer_history)
## Warning in bind_rows_(x, .id): binding factor and character vector,
## coercing into character vector
## Warning in bind_rows_(x, .id): binding character and factor vector,
## coercing into character vector
sales_history <- readRDS("./RInputFiles/otc_sales_history.RDS")
order_history <- readRDS("./RInputFiles/otc_order_history.RDS")
# sales_quotations <- readRDS("./RInputFiles/otc_sales_quotation.RDS")

str(sales_history)
## Classes 'tbl_df', 'tbl' and 'data.frame':    14695 obs. of  7 variables:
##  $ quotation_id  : chr  "quo-1003" "quo-1004" "quo-1006" "quo-1008" ...
##  $ resource      : chr  "Jonathan" "Andrea" "Katherine" "Andrea" ...
##  $ activity      : chr  "Validate" "Validate" "Validate" "Validate" ...
##  $ action        : chr  "quo-1003-validate" "quo-1004-validate" "quo-1006-validate" "quo-1008-validate" ...
##  $ lifecycle     : chr  "start" "start" "start" "start" ...
##  $ timestamp     : chr  "2017-04-17 14:59:08" "2017-06-11 13:10:45" "2017-10-16 15:59:18" "2017-09-09 17:58:39" ...
##  $ sales_order_id: chr  NA "order-17-56548" "order-17-56550" NA ...
str(order_history)
## Classes 'tbl_df', 'tbl' and 'data.frame':    60804 obs. of  8 variables:
##  $ sales_order_id: chr  "order-17-56542" "order-17-56542" "order-17-56543" "order-17-56543" ...
##  $ action        : chr  "order-17-56542-0000001" "order-17-56542-0000002" "order-17-56543-0000003" "order-17-56543-0000004" ...
##  $ activity      : Factor w/ 37 levels "Assemble Order",..: 24 35 24 35 24 35 24 35 24 35 ...
##  $ resource      : Factor w/ 20 levels "Amy","Andrea",..: 10 8 2 8 2 8 10 8 2 8 ...
##  $ status        : Factor w/ 2 levels "complete","start": 2 2 2 2 2 2 2 2 2 2 ...
##  $ time          : POSIXct, format: "2017-10-17 12:37:22" "2017-10-19 15:30:40" ...
##  $ activity_cost : num  NaN NaN NaN NaN NaN NaN NaN NaN NaN NaN ...
##  $ quotation_id  : chr  NA NA NA NA ...
# str(sales_quotations)

order_history <- order_history %>% 
    rename(timestamp=time, lifecycle=status) %>%
    select(-activity_cost) %>%
    mutate(activity=as.character(activity), 
           resource=as.character(activity), 
           lifecycle=as.character(lifecycle)
           )
sales_history <- sales_history %>%
    mutate(timestamp=lubridate::as_datetime(timestamp))

# sales_history <- sales_history %>% left_join(sales_quotations)
otc <- bind_rows(sales_history, order_history)


# Create the eventlog object 
otc <- otc %>%
    mutate(case_id = paste(quotation_id, sales_order_id, sep = "-")) %>%
    eventlog(
        case_id = "case_id",
        activity_id = "activity",
        activity_instance_id = "action",
        timestamp = "timestamp",
        resource_id = "resource",
        lifecycle_id = "lifecycle"
        )

# Create trace coverage graph
trace_coverage(otc, level="trace") %>% plot()

# Explore traces
otc %>%
    trace_explorer(coverage = 0.25)

# Collapse activities
otc_high_level <- act_collapse(otc, "Delivery" = c(
  "Handover To Deliverer",
  "Order Delivered",
  "Present For Collection",
  "Order Fetched")
  )

# Draw a process map
process_map(otc_high_level)
# Redraw the trace coverage graph
otc_high_level %>% trace_coverage(level="trace") %>% plot()

# Compute activity wise processing time
otc_high_level %>% processing_time(level="activity", units="days")
## # A tibble: 34 x 11
##    activity          min    q1  mean median    q3   max st_dev   iqr total
##    <fct>           <dbl> <dbl> <dbl>  <dbl> <dbl> <dbl>  <dbl> <dbl> <dbl>
##  1 Packaging       0      0     0      0     0      0     0     0        0
##  2 Prepare Invoice 0      0     0      0     0      0     0     0        0
##  3 Produce Order   0      0     0      0     0      0     0     0        0
##  4 Quality Control 0      0     0      0     0      0     0     0        0
##  5 Assemble Order  0      0     0      0     0      0     0     0        0
##  6 Delivery        0.583  1.99  5.11   3.11  8.06  17.0   3.86  6.07 15452
##  7 Order Materials 0      0     0      0     0      0     0     0        0
##  8 Receive Materi~ 0      0     0      0     0      0     0     0        0
##  9 Receive Sales ~ 0      0     0      0     0      0     0     0        0
## 10 Schedule Job    0      0     0      0     0      0     0     0        0
## # ... with 24 more rows, and 1 more variable: relative_frequency <dbl>
# Plot a resource activity matrix of otc
otc %>% resource_frequency(level = "resource-activity") %>% plot()

# Create otc_selection
otc_selection <- otc %>% filter_activity(activities = c("Send Quotation","Send Invoice"))

# Explore traces
otc %>% trace_explorer(coverage=1)

# Draw a resource map
otc_selection %>% resource_map()
# Create otc_returned
otc_returned <- otc %>% filter_activity_presence("Return Goods")

# Compute percentage of returned orders
n_cases(otc_returned)/n_cases(otc)
## [1] 0.2130923
# Trim cases and visualize
otc_returned %>% filter_trim(start_activities="Return Goods") %>% process_map()
# Time from order to delivery
# otc %>% filter_trim(start_activities="Receive Sales Order", end_activities="Order Delivered") %>% 
#     processing_time(units="days")


# Plot processing time by type
# otc %>%
#     group_by(type) %>%
#     throughput_time() %>%
#     plot()

Network Science in R - A Tidy Approach

Chapter 1 - Hubs of the Network

Network science - include social networks, neural networks, etc.:

  • Nodes and edges (connections between nodes, aka “ties”) make up a network
    • In a directed network, ties have a direction (for example, followers and follwing)
    • In an undirected network, ties do not have a direction (for example, mutual friendship)
    • In a weighted network, the ties have an associated weight (such as bandwidth, duration of friendship, etc.)
  • Chapter will focus on the terrorism network associated with the Madrid train bombing of 2004
    • Ties include friendhsip, training camps, previous attacks, and other terrorists
  • The network is reflected in tidy fashion, using one data frame for nodes and another for ties
    • g <- igraph::graph_from_data_frame(d = ties, directed = FALSE, vertices = nodes)
    • V(g); vcount(g)
    • E(g); ecount(g)
  • And, then working with attributes of the network
    • g\(name <- "Madrid network"; g\)name
    • V(g)$id <- 1:vcount(g)
    • E(g)$weight

Visualizing networks:

  • The ggraph package can help with visualizing networks
    • ggraph(g, layout = “with_kk”) + geom_edge_link(aes(alpha = weight)) + geom_node_point()
    • Much like the language of ggplot2

Centrality measures:

  • Objective is to find the most important nodes - connections among members of the networks
  • Network science is a spinoff of data science, with the goal of measuring networks
  • The agree of “degree” measures the number of ties (edges) that a node has
    • degree(g) # gives the number of edges per node
    • strength(g) # sumes the weights of the edges per node

Example code includes:

# read the nodes file into the variable nodes
nodes <- readr::read_csv("./RInputFiles/nodes.csv")
nodes

# read the ties file into the variable ties
ties <- readr::read_csv("./RInputFiles/ties.csv")
ties


library(igraph)
library(ggraph)


# make the network from the data frame ties and print it
g <- graph_from_data_frame(ties, directed = FALSE, vertices = nodes)
g

# explore the set of nodes
V(g)

# print the number of nodes
vcount(g)

# explore the set of ties
E(g)

# print the number of ties
ecount(g)


# give the name "Madrid network" to the network and print the network `name` attribute
g$name <- "Madrid network"
g$name

# add node attribute id and print the node `id` attribute
V(g)$id <- 1:vcount(g)
V(g)$id

# print the tie `weight` attribute
E(g)$weight

# print the network and spot the attributes
g


# visualize the network with layout Kamada-Kawai
ggraph(g, layout = "with_kk") + 
  geom_edge_link(aes(alpha = weight)) + 
  geom_node_point()


# add an id label to nodes
ggraph(g, layout = "with_kk") +
  geom_edge_link(aes(alpha = weight)) +
  geom_node_point()  + 
  geom_node_text(aes(label = id), repel=TRUE)


# visualize the network with circular layout. Set tie transparency proportional to its weight
ggraph(g, layout = "in_circle") + 
  geom_edge_link(aes(alpha = weight)) + 
  geom_node_point()


# visualize the network with grid layout. Set tie transparency proportional to its weight
ggraph(g, layout = "grid") + 
  geom_edge_link(aes(alpha = weight)) + 
  geom_node_point()


# compute the degrees of the nodes
dgr <- degree(g)

# add the degrees to the data frame object
nodes <- mutate(nodes, degree = dgr)

# add the degrees to the network object
V(g)$degree <- dgr

# arrange the terrorists in decreasing order of degree
arrange(nodes, -degree)


# compute node strengths
stg <- strength(g)

# add strength to the data frame object using mutate
nodes <- mutate(nodes, strength = stg)

# add the variable stg to the network object as strength
V(g)$strength <- stg

# arrange terrorists in decreasing order of strength and then in decreasing order of degree
arrange(nodes, -degree)
arrange(nodes, -strength)

Chapter 2 - Weakness and strength

Tie betweenness:

  • Betweeness is the number of shortest paths that go through a specific tie (edge) - these removals would be the most disruptive
  • In a weighted network, the shortest path is defined as the lowest sum of weights, rather than the fewest edges
    • Often need to inverse the weights prior to running, since a “high” weight usually means a close connection and thus an easy path
    • dist_weight = 1 / E(g)$weight
    • edge_betweenness(g, weights = dist_weight)

Visualizing centrality measures:

  • Visualizing betweenness can be done within the igraph package
    • ggraph(g, layout = “with_kk”) + geom_edge_link(aes(alpha = betweenness)) + geom_node_point()
    • ggraph(g, layout = “with_kk”) + geom_edge_link(aes(alpha = weight)) + geom_node_point(aes(size = degree))

The strength of weak ties:

  • “The strength of weak ties” is a research paper written about network strengths
    • Argument is that the “weak ties” in a network are often the most important - relationships between diverse communities, leading to diverse ideas
    • The “strong ties” are the relationships between people who are frequently together - can lead to group-think and stasis
    • Noted that the Madrid group (and similar) tended to be highly dispersed and thus having many weak ties
    • ties %>% group_by(weight) %>% summarise(n = n(), p = n / nrow(ties)) %>% arrange(-n)

Example code includes:

# save the inverse of tie weights as dist_weight
dist_weight <- 1 / E(g)$weight

# compute weighted tie betweenness
btw <- edge_betweenness(g, weights = dist_weight)

# mutate the data frame ties adding a variable betweenness using btw
ties <- mutate(ties, betweenness=btw)

# add the tie attribute betweenness to the network
E(g)$betweenness <- btw


# join ties with nodes
ties_joined <- ties %>% 
  left_join(nodes, c("from" = "id")) %>% 
  left_join(nodes, c("to" = "id")) 

# select only relevant variables and save to ties
ties_selected <- ties_joined %>% 
  select(from, to, name_from = name.x, name_to = name.y, betweenness)

# arrange named ties in decreasing order of betweenness
arrange(ties_selected, -betweenness)


# set (alpha) proportional to weight and node size proportional to degree
ggraph(g, layout = "with_kk") + 
  geom_edge_link(aes(alpha=weight)) + 
  geom_node_point(aes(size=degree))

# produce the same visualization but set node size proportional to strength
ggraph(g, layout = "with_kk") + 
  geom_edge_link(aes(alpha = weight)) + 
  geom_node_point(aes(size = strength))


# visualize the network with tie transparency proportional to betweenness
ggraph(g, layout = "with_kk") + 
  geom_edge_link(aes(alpha = betweenness)) + 
  geom_node_point()

# add node size proportional to degree
ggraph(g, layout = "with_kk") + 
  geom_edge_link(aes(alpha = betweenness)) + 
  geom_node_point(aes(size = degree))


# find median betweenness
q = median(E(g)$betweenness)

# filter ties with betweenness larger than the median
ggraph(g, layout = "with_kk") + 
  geom_edge_link(aes(alpha = betweenness, filter = (betweenness > q))) + 
  geom_node_point() + 
  theme(legend.position="none")


# find number and percentage of weak ties
ties %>%
  group_by(weight) %>%
  summarise(number = n(), percentage=n()/nrow(.)) %>%
  arrange(-number)


# build vector weakness containing TRUE for weak ties
weakness <- ifelse(ties$weight == 1, TRUE, FALSE)

# check that weakness contains the correct number of weak ties
sum(weakness)


# visualize the network by coloring the weak and strong ties
ggraph(g, layout = "with_kk") + 
  geom_edge_link(aes(color = weakness)) + 
  geom_node_point()


# visualize the network with only weak ties using the filter aesthetic
ggraph(g, layout = "with_kk") + 
  geom_edge_link(aes(filter=weakness), alpha = 0.5) + 
  geom_node_point()

Chapter 3 - Connection patterns

Connection patterns:

  • The adjacency matrix can be calculated using as_adjacency_matrix(g)
    • For each match of row/column, there will be a 1 for adjacency and a 0 for non-adjacency
    • Alternately, can have the weight of the tie as the entry for each row/column (with 0 as before meaning non-adjacency)
    • A = as_adjacency_matrix(g, attr = “weight”)
    • diag(A)
  • Can use the adjacency matrix to assess similarity of nodes in the matrix
    • The Pearson similarity measures the correlation between the columns in the matrix

Pearson correlation coefficient:

  • Can visualize the correlations using scatterplots
  • Can compute the correlations analytically as well
    • cor(nodes\(degree, nodes\)strength)

Most similar and most dissimilar terrorists:

  • Can use named graphs with weighted ties for a graphical representation of nodes and paths
  • Can use the adjacency matrix to reprsent the ties in a manner simplified for algebra
  • Can use the data frame format (one for nodes, and one for ties) for use with dplur and ggplot2
    • as_data_frame(g, what = “both”)
  • Can easily switch back and forth between the representations of the network
    • as_adjacency_matrix(g)
    • graph_from_adjacency_matrix(A)
    • as_data_frame(g, what = “both”)
    • graph_from_data_frame(df\(ties, vertices = df\)nodes)
    • as_data_frame(graph_from_adjacency_matrix(A), what = “both”)
    • as_adjacency_matrix(graph_from_data_frame(df\(ties, vertices = df\)nodes))

Example code includes:

# mutate ties data frame by swapping variables from and to 
ties_mutated <- mutate(ties, temp = to, to = from, from = temp) %>% select(-temp)

# append ties_mutated data frame to ties data frame
ties <- rbind(ties, ties_mutated)

# use a scatter plot to visualize node connection patterns in ties setting color aesthetic to weight
ggplot(ties, aes(x = from, y = to, color = factor(weight))) +
  geom_point() +
  labs(color = "weight")


# get the weighted adjacency matrix
A <- as_adjacency_matrix(g, attr = "weight", sparse = FALSE, names = FALSE)

# print the first row and first column of A
A[1, ]
A[, 1]

# print submatrix of the first 6 rows and columns
A[1:6, 1:6]


# obtain a vector of node strengths
rowSums(A)

# build a Boolean (0/1) matrix from the weighted matrix A
B <- ifelse(A > 0, 1, 0)

# obtain a vector of node degrees using the Boolean matrix
rowSums(B)


# compute the Pearson correlation on columns of A
S <- cor(A)

# set the diagonal of S to 0
diag(S) = 0

# print a summary of the similarities in matrix S
summary(c(S))

# plot a histogram of similarities in matrix S
hist(c(S), xlab = "Similarity", main = "Histogram of similarity")


# Scatter plot of degree and strength with regression line
ggplot(nodes, aes(x = degree, y = strength)) +
  geom_point() +
  geom_smooth(method = "lm", se = FALSE)

# Pearson correlation coefficient 
cor(nodes$degree, nodes$strength)


# build weighted similarity network and save to h
h <- graph_from_adjacency_matrix(S, mode = "undirected", weighted = TRUE)

# convert the similarity network h into a similarity data frame sim_df
sim_df <- as_data_frame(h, what = "edges")

# map the similarity data frame to a tibble and save it as sim_tib
sim_tib <- as_tibble(sim_df)

# print sim_tib
sim_tib


# left join similarity and nodes data frames and then select and rename relevant variables
sim2 <- sim_tib %>% 
  left_join(nodes, c("from" = "id")) %>% 
  left_join(nodes, c("to" = "id")) %>%
  select(from, to, name_from = name.x, name_to = name.y, similarity = weight, 
         degree_from = degree.x, degree_to = degree.y, strength_from = strength.x, strength_to = strength.y)
  
# print sim2
sim2


# arrange sim2 in decreasing order of similarity. 
sim2 %>% arrange(-similarity)

# filter sim2, allowing only pairs with a degree of least 10, arrange the result in decreasing order of similarity
sim2 %>%
  filter(degree_from >= 10, degree_to >= 10) %>%
  arrange(-similarity)

# Repeat the previous steps, but in increasing order of similarity
sim2 %>%
  filter(degree_from >= 10, degree_to >= 10) %>%
  arrange(similarity)


# filter the similarity data frame to similarities larger than or equal to 0.60
sim3 <- filter(sim2, similarity >= 0.6)

# build a similarity network called h2 from the filtered similarity data frame
h2 <- graph_from_data_frame(sim3, directed = FALSE)

# visualize the similarity network h2
ggraph(h2, layout = "with_kk") + 
  geom_edge_link(aes(alpha = similarity)) + 
  geom_node_point()

Chapter 4 - Similarity Clusters

Hierarchical clustering - find clusters of similar people:

  • Basic idea is to define a measure of similarity, then match the most similar entities to groups, proceeding until there is a single cluster containing everyone
  • The dendrogram (tree diagram) is helpful for viewing this data
  • The similarity measure between individual nodes (person similarity) exists, and needs to be extended to groups
    • Single-linkage - similarity is the maximum of the similarities of anyone in the groups
    • Complete-linkage - similarity is the minimum of the similarities of anyone in the groups
    • Average-linkage - similarity is the average of the simlarities of everyone in the groups
  • The clustering algorithm works as follows
    • Evaluate simlarity for all node pairs
    • Assign each node to its own group
    • Find the pair of groups with the highest simlarity, and join them
    • Calculate simlarity of this newly formed group to all previously existing entities (groups or individuals)
    • Repeat until there is just a single cluster remaining
  • The R implementation is hclust()
    • D <- 1-S
    • d <- as.dist(D)
    • cc <- hclust(d, method = “average”)
    • cls <- cutree(cc, k = 4)

Interactive visualizations with visNetwork:

  • visNetwork is an interactive package for viewing networks
    • Many different layouts are available, and you can interact with the nodes and the ties
    • Can select nodes and see their neighborhoods (nodes within a certain distance)
    • Can select nodes by name
    • Can partition nodes in to groups and color, highlight, etc.

Wrap up:

  • Analysis of networks with measures of centrality and similarity
  • Visualization of networks, including interactivity

Example code includes:

# compute a distance matrix
D <- 1 - S

# obtain a distance object 
d <- as.dist(D)

# run average-linkage clustering method and plot the dendrogram 
cc <- hclust(d, method = "average")
plot(cc)

# find the similarity of the first pair of nodes that have been merged 
S[40, 45]


# cut the dendrogram at 4 clusters
cls <- cutree(cc, k = 4)

# add cluster information to the nodes data frame
nodes <- mutate(nodes, cluster = cls)

# print the nodes data frame
nodes


# output the names of terrorists in the first cluster
filter(nodes, cluster == 1) %>% 
    select(name)

# for each cluster select the size of the cluster, the average node degree, and the average node strength and sorts by cluster size
group_by(nodes, cluster) %>%
  summarise(size = n(), 
            avg_degree = mean(degree),
            avg_strength = mean(strength)
            ) %>%
  arrange(-size)


# add cluster information to the network 
V(g)$cluster <- nodes$cluster

# visualize the original network with colored clusters
ggraph(g, layout = "with_kk") + 
  geom_edge_link(aes(alpha = weight), show.legend=FALSE) + 
  geom_node_point(aes(color = factor(cluster))) +
  labs(color = "cluster")

# facet the network with respect to cluster attribute
ggraph(g, layout = "with_kk") + 
  geom_edge_link(aes(alpha = weight), show.legend=FALSE) + 
  geom_node_point(aes(color = factor(cluster))) +
  facet_nodes(~cluster, scales="free")  +
  labs(color = "cluster")


# convert igraph to visNetwork
data <- visNetwork::toVisNetworkData(g)

# print head of nodes and ties
head(data$nodes)
head(data$edges)

# visualize the network
visNetwork::visNetwork(nodes = data$nodes, edges = data$edges, width = 300, height = 300)


# use the circle layout
visNetwork::visNetwork(nodes = data$nodes, edges = data$edges, width = 300, height = 300) %>%
  visNetwork::visIgraphLayout(layout = "layout_with_kk")

# use the circle layout
visNetwork::visNetwork(nodes = data$nodes, edges = data$edges, width = 300, height = 300) %>%
  visNetwork::visIgraphLayout(layout = "layout_in_circle")

# use the grid layout
visNetwork::visNetwork(nodes = data$nodes, edges = data$edges, width = 300, height = 300) %>%
  visNetwork::visIgraphLayout(layout = "layout_on_grid")


# highlight nearest nodes and ties of the selected node
visNetwork::visNetwork(nodes = data$nodes, edges = data$edges, width = 300, height = 300) %>%
  visNetwork::visIgraphLayout(layout = "layout_with_kk") %>%
  visNetwork::visOptions(highlightNearest = TRUE) 


# select nodes by id 
visNetwork::visNetwork(nodes = data$nodes, edges = data$edges, width = 300, height = 300) %>%
  visNetwork::visIgraphLayout(layout = "layout_with_kk") %>%
  visNetwork::visOptions(nodesIdSelection = TRUE)

# set color to cluster and generate network data
V(g)$color = V(g)$cluster
data <- visNetwork::toVisNetworkData(g)

# select by group (cluster)
visNetwork::visNetwork(nodes = data$nodes, edges = data$edges, width = 300, height = 300) %>%
  visNetwork::visIgraphLayout(layout = "layout_with_kk") %>%
  visNetwork::visOptions(selectedBy = "group")

Data Privacy and Anaonymization in R

Chapter 1 - Introduction to Data Privacy

Intro to Anonymization - Part I:

  • Need to implement better data privacy techniques - e.g., census data, healthcare data, etc.
  • Need to have data such as individualized health, but not in a manner that identifies specific individuals
  • Topics covered in this course will include
    • Remove identifiers, synthesize data
    • Laplace mechnaism for removing names
    • Differential privacy and post-processing
    • Release of data using the above techniques
  • Data sets will include White House salaries and male infertility data
    • One basic technique is removing identifiers, such as replacing names with numbers
    • Another basic technique is to round continuous values (such as to the nearest 1000)

Intro to Anonymization - Part II:

  • Additional approaches include generalization and top/bottom coding
    • Generalization creates larger buckets of data
    • Top/bottom is about setting outliers back to a pre-defined top and bottom of the range
  • Additional dplyr functions of interest
    • count() is used to find the number of observations for each distinct group
    • whitehouse %>% count(Status)
    • whitehouse %>% count(Status, Title, sort = TRUE) # sort=TRUE sorts by descending n
    • summarize_at() lets you get summary statistics for a key variable
    • whitehouse %>% summarise_at(vars(Salary), sum) # vars() holds the bare variables, while sum is the requested function
    • whitehouse %>% summarise_at(vars(Salary), funs(mean, sd)) # funs() holds the list of functions that you want to apply

Data Synthesis:

  • Fake datasets created based on sampling from a probability distribution
  • Goal is a fake dataset (by definition anaonymized) that is statistically similar to the real dataset
    • For 1/0 data, sampling from the binomial distribution can work well
    • For bell-shaped data, the normal or log-normal can often work well (though there can be issues with bounding)
    • Hard-bounding is setting values to a proper max/min, while another approach is to discard the record and sample again

Example code includes:

load("./RInputFiles/dataPriv.RData")


# Preview data
whitehouse
## # A tibble: 469 x 5
##    Name         Status  Salary Basis   Title                              
##    <chr>        <chr>    <dbl> <chr>   <chr>                              
##  1 Abrams, Ada~ Employ~  66300 Per An~ WESTERN REGIONAL COMMUNICATIONS DI~
##  2 Adams, Ian ~ Employ~  45000 Per An~ EXECUTIVE ASSISTANT TO THE DIRECTO~
##  3 Agnew, Davi~ Employ~  93840 Per An~ DEPUTY DIRECTOR OF INTERGOVERNMENT~
##  4 Albino, Jam~ Employ~  91800 Per An~ SENIOR PROGRAM MANAGER             
##  5 Aldy, Jr., ~ Employ~ 130500 Per An~ SPECIAL ASSISTANT TO THE PRESIDENT~
##  6 Alley, Hila~ Employ~  42000 Per An~ STAFF ASSISTANT                    
##  7 Amorsingh, ~ Employ~  56092 Per An~ SPECIAL ASSISTANT                  
##  8 Anderson, A~ Employ~  60000 Per An~ SPECIAL ASSISTANT TO THE CHIEF OF ~
##  9 Anderson, C~ Employ~  51000 Per An~ POLICY ASSISTANT                   
## 10 Andrias, Ka~ Employ~ 130500 Per An~ SPECIAL ASSISTANT TO THE PRESIDENT~
## # ... with 459 more rows
# Set seed
set.seed(42)

# Replace names with random numbers from 1 to 1000
whitehouse_no_names <- whitehouse %>%
    mutate(Name = sample(1:1000, nrow(.), replace=FALSE))

whitehouse_no_names
## # A tibble: 469 x 5
##     Name Status   Salary Basis   Title                                    
##    <int> <chr>     <dbl> <chr>   <chr>                                    
##  1   915 Employee  66300 Per An~ WESTERN REGIONAL COMMUNICATIONS DIRECTOR 
##  2   937 Employee  45000 Per An~ EXECUTIVE ASSISTANT TO THE DIRECTOR OF S~
##  3   286 Employee  93840 Per An~ DEPUTY DIRECTOR OF INTERGOVERNMENTAL AFF~
##  4   828 Employee  91800 Per An~ SENIOR PROGRAM MANAGER                   
##  5   640 Employee 130500 Per An~ SPECIAL ASSISTANT TO THE PRESIDENT FOR E~
##  6   517 Employee  42000 Per An~ STAFF ASSISTANT                          
##  7   733 Employee  56092 Per An~ SPECIAL ASSISTANT                        
##  8   134 Employee  60000 Per An~ SPECIAL ASSISTANT TO THE CHIEF OF STAFF  
##  9   652 Employee  51000 Per An~ POLICY ASSISTANT                         
## 10   699 Employee 130500 Per An~ SPECIAL ASSISTANT TO THE PRESIDENT AND A~
## # ... with 459 more rows
# Rounding Salary to the nearest ten thousand
whitehouse_no_identifiers <- whitehouse_no_names %>%
    mutate(Salary = round(Salary, -4))

whitehouse_no_identifiers
## # A tibble: 469 x 5
##     Name Status   Salary Basis   Title                                    
##    <int> <chr>     <dbl> <chr>   <chr>                                    
##  1   915 Employee  70000 Per An~ WESTERN REGIONAL COMMUNICATIONS DIRECTOR 
##  2   937 Employee  40000 Per An~ EXECUTIVE ASSISTANT TO THE DIRECTOR OF S~
##  3   286 Employee  90000 Per An~ DEPUTY DIRECTOR OF INTERGOVERNMENTAL AFF~
##  4   828 Employee  90000 Per An~ SENIOR PROGRAM MANAGER                   
##  5   640 Employee 130000 Per An~ SPECIAL ASSISTANT TO THE PRESIDENT FOR E~
##  6   517 Employee  40000 Per An~ STAFF ASSISTANT                          
##  7   733 Employee  60000 Per An~ SPECIAL ASSISTANT                        
##  8   134 Employee  60000 Per An~ SPECIAL ASSISTANT TO THE CHIEF OF STAFF  
##  9   652 Employee  50000 Per An~ POLICY ASSISTANT                         
## 10   699 Employee 130000 Per An~ SPECIAL ASSISTANT TO THE PRESIDENT AND A~
## # ... with 459 more rows
# Convert the salaries into three categories
whitehouse.gen <- whitehouse %>%
    mutate(Salary = ifelse(Salary < 50000, 0, 
                           ifelse(Salary >= 50000 & Salary < 100000, 1, 2)))

whitehouse.gen
## # A tibble: 469 x 5
##    Name         Status  Salary Basis   Title                              
##    <chr>        <chr>    <dbl> <chr>   <chr>                              
##  1 Abrams, Ada~ Employ~      1 Per An~ WESTERN REGIONAL COMMUNICATIONS DI~
##  2 Adams, Ian ~ Employ~      0 Per An~ EXECUTIVE ASSISTANT TO THE DIRECTO~
##  3 Agnew, Davi~ Employ~      1 Per An~ DEPUTY DIRECTOR OF INTERGOVERNMENT~
##  4 Albino, Jam~ Employ~      1 Per An~ SENIOR PROGRAM MANAGER             
##  5 Aldy, Jr., ~ Employ~      2 Per An~ SPECIAL ASSISTANT TO THE PRESIDENT~
##  6 Alley, Hila~ Employ~      0 Per An~ STAFF ASSISTANT                    
##  7 Amorsingh, ~ Employ~      1 Per An~ SPECIAL ASSISTANT                  
##  8 Anderson, A~ Employ~      1 Per An~ SPECIAL ASSISTANT TO THE CHIEF OF ~
##  9 Anderson, C~ Employ~      1 Per An~ POLICY ASSISTANT                   
## 10 Andrias, Ka~ Employ~      2 Per An~ SPECIAL ASSISTANT TO THE PRESIDENT~
## # ... with 459 more rows
# Bottom Coding
whitehouse.bottom <- whitehouse %>%
    mutate(Salary = pmax(Salary, 45000))

# Filter Results
whitehouse.bottom %>%
    filter(Salary <= 45000)
## # A tibble: 109 x 5
##    Name          Status  Salary Basis   Title                             
##    <chr>         <chr>    <dbl> <chr>   <chr>                             
##  1 Adams, Ian H. Employ~  45000 Per An~ EXECUTIVE ASSISTANT TO THE DIRECT~
##  2 Alley, Hilar~ Employ~  45000 Per An~ STAFF ASSISTANT                   
##  3 Asen, Jonath~ Employ~  45000 Per An~ SENIOR ANALYST                    
##  4 Ayling, Lind~ Employ~  45000 Per An~ ANALYST                           
##  5 Baggetto, Ma~ Employ~  45000 Per An~ STAFF ASSISTANT                   
##  6 Bates, Andre~ Employ~  45000 Per An~ MEDIA MONITOR                     
##  7 Belive, Laur~ Employ~  45000 Per An~ LEGISLATIVE ASSISTANT AND ASSISTA~
##  8 Bisi, Rachel~ Employ~  45000 Per An~ LEGISLATIVE ASSISTANT             
##  9 Block, Micha~ Employ~  45000 Per An~ STAFF ASSISTANT                   
## 10 Blount, Patr~ Employ~  45000 Per An~ RECORDS MANAGEMENT ANALYST        
## # ... with 99 more rows
# View fertility data
fertility
## # A tibble: 100 x 10
##    Season   Age Child_Disease Accident_Trauma Surgical_Interv~ High_Fevers
##     <dbl> <dbl>         <int>           <int>            <int>       <int>
##  1  -0.33  0.69             0               1                1           0
##  2  -0.33  0.94             1               0                1           0
##  3  -0.33  0.5              1               0                0           0
##  4  -0.33  0.75             0               1                1           0
##  5  -0.33  0.67             1               1                0           0
##  6  -0.33  0.67             1               0                1           0
##  7  -0.33  0.67             0               0                0          -1
##  8  -0.33  1                1               1                1           0
##  9   1     0.64             0               0                1           0
## 10   1     0.61             1               0                0           0
## # ... with 90 more rows, and 4 more variables: Alcohol_Freq <dbl>,
## #   Smoking <int>, Hours_Sitting <dbl>, Diagnosis <int>
# Number of participants with Surgical_Intervention and Diagnosis
fertility %>%
    summarise_at(vars(Surgical_Intervention, Diagnosis), sum)
## # A tibble: 1 x 2
##   Surgical_Intervention Diagnosis
##                   <int>     <int>
## 1                    51        12
# Mean and Standard Deviation of Age
fertility %>%
    summarise_at(vars(Age), funs(mean, sd))
## # A tibble: 1 x 2
##    mean    sd
##   <dbl> <dbl>
## 1 0.669 0.121
# Counts of the Groups in High_Fevers
fertility %>%
    count(High_Fevers)
## # A tibble: 3 x 2
##   High_Fevers     n
##         <int> <int>
## 1          -1     9
## 2           0    63
## 3           1    28
# Counts of the Groups in Child_Disease
fertility %>%
    count(Child_Disease, Accident_Trauma)
## # A tibble: 4 x 3
##   Child_Disease Accident_Trauma     n
##           <int>           <int> <int>
## 1             0               0    10
## 2             0               1     3
## 3             1               0    46
## 4             1               1    41
# Find proportions
fertility %>%
    summarise_at(vars(Accident_Trauma, Surgical_Intervention), mean)
## # A tibble: 1 x 2
##   Accident_Trauma Surgical_Intervention
##             <dbl>                 <dbl>
## 1            0.44                  0.51
# Set seed
set.seed(42)

# Generate Synthetic data
accident <- rbinom(100, 1, prob=0.440)
surgical <- rbinom(100, 1, prob=0.510)


# Square root Transformation of Salary
whitehouse.salary <- whitehouse %>%
    mutate(Salary = sqrt(Salary))

# Calculate the mean and standard deviation
stats <- whitehouse.salary %>%
    summarize(mean(Salary), sd(Salary))

stats
## # A tibble: 1 x 2
##   `mean(Salary)` `sd(Salary)`
##            <dbl>        <dbl>
## 1           279.         71.8
# Generate Synthetic data
set.seed(42)
salary_transformed <- rnorm(nrow(whitehouse), mean=279, sd=71.8)

# Power transformation
salary_original <- salary_transformed ** 2

# Hard bound
salary <- ifelse(salary_original < 0, 0, salary_original)

Chapter 2 - Introduction to Differential Privacy

Differential Privacy - quantification of privacy loss via a privacy budget:

  • The worst-case scenario is that no assumptions are made about data intruders
    • If an individual is from a small group, their data may be 100% available by looking at statistics in aggregate and statistics for the group that excludes them (everyone else)
  • The privacy budget is defined using epsilon - smaller numbers mean that less information will be made available
  • The general concept is to look at a dataset that includes the segment the individual is in, and a dataset that includes all other segments
    • The answer sent back to the query will have noise added to it depending on the privacy budget
  • Basically, the differential privacy algorithm finds the most “unique” person in the dataset, and then decides how much noise to add based on how identifiable they are by attribute

Global Sensitivity - usual decision-making factor for differential privacy:

  • The global sensitivity of a query is the most a variable could change based on removing one individual
    • By definition, count queries always have a global sensitivity of 1 (exclude 1 individual)
    • Therefore, proportion queries always have a global sensitity of 1/n
    • Mean queries always have a global sensitivity of (max - min) / n
    • Variance queries always have a global sensitivity of (max - min)^2 / n
  • The global sensitivity and the epsilon work together to determine the amount of noise
    • Measures like median are not very sensitive to outliers, and thus very little noise needs to be added
    • Measures like maximum are very sensitive to outliers (e.g., Bill Gates income), and thus very little noise needs to be added

Laplace Mechanism - adds noise based on the Laplace distribution with mean 0 and parameters global sensitivity and privacy budget:

  • fertility %>% summarise_at(vars(Child_Disease), sum)
  • library(smoothmest) # has function rdoublex(draws, mean, shaping) - set draws=1, mean=true_mean, shaping=globalSensitivity / epsilon

Example code includes:

# Number of observations
n <- nrow(fertility)

# Global sensitivity of counts
gs.count <- 1

# Global sensitivity of proportions
gs.prop <- 1/n


# Lower bound of Hours_Sitting
a <- 0

# Upper bound of Hours_Sitting
b <- 1

# Global sensitivity of mean for Hours_Sitting
gs.mean <- (b - a) / n

# Global sensitivity of proportions Hours_Sitting
gs.var <- (b - a)**2 / n


# How many participants had a Surgical_Intervention?
fertility %>%
   summarise_at(vars(Surgical_Intervention), sum)
## # A tibble: 1 x 1
##   Surgical_Intervention
##                   <int>
## 1                    51
# Set the seed
set.seed(42)

# Apply the Laplace mechanism
eps <- 0.1
smoothmest::rdoublex(1, 51, 1/eps)
## [1] 52.98337
# Proportion of Accident_Trauma
stats <- fertility %>%
   summarise_at(vars(Accident_Trauma), mean)

stats
## # A tibble: 1 x 1
##   Accident_Trauma
##             <dbl>
## 1            0.44
# Set the seed
set.seed(42)

# Apply the Laplace mechanism
eps <- 0.1
smoothmest::rdoublex(1, 0.440, (1/n)/eps)
## [1] 0.4598337
# Mean and Variance of Hours Sitting
fertility %>%
    summarise_at(vars(Hours_Sitting), funs(mean, var))
## # A tibble: 1 x 2
##    mean    var
##   <dbl>  <dbl>
## 1 0.407 0.0347
# Setup
set.seed(42)
eps <- 0.1

# Laplace mechanism to mean
smoothmest::rdoublex(1, 0.41, gs.mean/eps)
## [1] 0.4298337
# Laplace mechanism to variance
smoothmest::rdoublex(1, 0.03, gs.var/eps)
## [1] 0.0583491

Chapter 3 - Differentially Private Properties

Sequential Composition - method to require that someone cannot find the real answer by just sending multiple queries:

  • Idea is that the privacy budget is divided by the number of queries you plan to send
  • For example, if a query will be made for mean and another query will be made for maximum, then epsilon needs to be divided by two

Parallel Composition - method to account for queries to different parts of the database (no adjustment to epsilon needed):

  • Deciding between sequential and parallel is whether queries could be answered using completely different (MECE) splits of the dataset

Post-processing:

  • When new queries can be answered using data that has already been privatized, it can be synthesized to a noisy answer to this new query
    • The privacy budget need not be adjusted in this case
    • For example, if there are three groups, can just add noise to two of the groups and let the third group be total minus these two groups

Impossible and inconsistent answers:

  • Bounding can be introduced, such as making all negative numbers zero or anything greater than the total to the total
    • rdoublex(1, 12, gs.count / eps) %>% round() %>% max(0) # lower bound is zero
    • normalized <- (smoking/sum(smoking)) * (nrow(fertility)) # upper bound is the size of the dataset

Example code includes:

# Set Value of Epsilon
eps <- 0.1 / 2

# Number of observations
n <- nrow(fertility)

# Lower bound of Age
a <- 0

# Upper bound of Age
b <- 1

# GS of counts for Diagnosis
gs.count <- 1

# GS of mean for Age
gs.mean <- (b-a)/n


# Number of Participants with abnormal diagnosis
stats1 <- fertility %>% 
    summarize_at(vars(Diagnosis), sum)

stats1
## # A tibble: 1 x 1
##   Diagnosis
##       <int>
## 1        12
# Mean of age
stats2 <- fertility %>%
    summarize_at(vars(Age), mean)

stats2
## # A tibble: 1 x 1
##     Age
##   <dbl>
## 1 0.669
# Set seed
set.seed(42)

# Laplace mechanism to the count of abnormal diagnosis
smoothmest::rdoublex(1, 12, gs.count/eps)
## [1] 15.96674
# Laplace mechanism to the mean of age
smoothmest::rdoublex(1, 0.67, gs.mean/eps)
## [1] 0.7266982
# Set Value of Epsilon
eps <- 0.1

# Mean of Age per diagnosis level 
fertility %>%
  group_by(Diagnosis) %>%
  summarise_at(vars(Age), mean)
## # A tibble: 2 x 2
##   Diagnosis   Age
##       <int> <dbl>
## 1         0 0.664
## 2         1 0.707
# Set the seed
set.seed(42)

# Laplace mechanism to the mean age of participants with an abnormal diagnoisis
smoothmest::rdoublex(1, 0.71, gs.mean/eps)
## [1] 0.7298337
# Laplace mechanism to the mean age of participants with a normal diagnoisis
smoothmest::rdoublex(1, 0.66, gs.mean/eps)
## [1] 0.6883491
# Set Value of Epsilon
eps <- 0.5/3

# GS of Counts
gs.count <- 1

# Number of participants in each of the four seasons
fertility %>%
    group_by(Diagnosis) %>%
    summarise_at(vars(Age), mean)
## # A tibble: 2 x 2
##   Diagnosis   Age
##       <int> <dbl>
## 1         0 0.664
## 2         1 0.707
# Set the seed
set.seed(42)

# Laplace mechanism to the number of participants who were evaluated in the winter, spring, and summer
winter <- smoothmest::rdoublex(1, 28, gs.count / eps) %>%
    round()

spring <- smoothmest::rdoublex(1, 37, gs.count / eps) %>%
    round()

summer <- smoothmest::rdoublex(1, 4, gs.count / eps) %>%
    round()

# Post-process based on previous queries
fall <- nrow(fertility) - winter - spring - summer


# Set Value of Epsilon
eps <- 0.01

# GS of counts
gs.count <- 1

# Number of Participants with Child_Disease
fertility %>%
    summarise_at(vars(Child_Disease), sum)
## # A tibble: 1 x 1
##   Child_Disease
##           <int>
## 1            87
# Apply the Laplace mechanism
set.seed(42)
lap_childhood <- smoothmest::rdoublex(1, 87, gs.count / eps) %>%
    round()

# Total number of observations in fertility
max_value <- nrow(fertility)

# Bound the value such that the noisy answer does not exceed the total number of observations
ifelse(lap_childhood > max_value, max_value, lap_childhood)
## [1] 100
# Set the seed
set.seed(42)

# Apply the Laplace mechanism
fever1 <- smoothmest::rdoublex(1, 9, gs.count/eps) %>%
    max(0)
fever2 <- smoothmest::rdoublex(1, 63, gs.count/eps) %>%
    max(0)
fever3 <- smoothmest::rdoublex(1, 28, gs.count/eps) %>%
    max(0)

fever <- c(fever1, fever2, fever3)

# Normalize noise 
fever_normalized <- (fever/sum(fever)) * (nrow(fertility))

# Round the values
round(fever_normalized)
## [1] 24 76  0

Chapter 4 - Differentially Private Data Synthesis

Laplace Sanitizer - basic way to generate “noisy” categorical data:

  • Takes advantage of parallel - if the data can be binned or placed in a contingency table, assumes no more need to divide the privacy budget
    • Since the data is queries as a histogram, it can be considered disjoint (non-overlapping) and thus parallel composition
  • Can generate data using rep() for a single vector

Parametric Approaches:

  • Sampling from a binomial distribution (where appropriate), with a known proportion that has been modified by Laplace differential privacy guarantee
  • Sampling from a normal or log-normal distribution (where appropriate), with a known mean and variance that has been modified by Laplace differential privacy guarantee

Wrap up:

  • Basics of anonymyzing data, such as removing names
  • Basics of modifying data such as generalizing to categorical data
  • Basics of generating synthetic data using rbinom() and rnorm()
  • Basics of privacy budgets, global sensitivities, and the Laplace mechanism
  • Basics of differential privacy, such as sequential (split epsilon) or parallel (including through binning or continegnecy tables)
  • Basics of the Laplace sanitizer for both categorical data (rbinom) and continuous data (rnorm)
  • Next steps include managing data gaps, incorrect statistics distributions with hard bounding, etc.
    • Local differential privacy (Apple) and probabilistic differential privacy (US census)
    • Techniques specific to GPS data or PCA

Example code includes:

# Set Value of Epsilon
eps <- 0.1

# GS of Counts
gs.count <- 1

# Number of participants in each season
fertility %>%
    count(Season)
## # A tibble: 4 x 2
##   Season     n
##    <dbl> <int>
## 1  -1       28
## 2  -0.33    37
## 3   0.33     4
## 4   1       31
# Set the seed
set.seed(42)

# Apply the Laplace mechanism 
winter <- smoothmest::rdoublex(1, 28, gs.count/eps) %>% max(0)
spring <- smoothmest::rdoublex(1, 37, gs.count/eps) %>% max(0)
summer <- smoothmest::rdoublex(1, 4, gs.count/eps) %>% max(0)
fall <- smoothmest::rdoublex(1, 31, gs.count/eps) %>% max(0)


# Store noisy results
seasons <- c(winter = winter, spring = spring, summer = summer, fall = fall)

# Normalizing seasons
seasons_normalized <- (seasons/sum(seasons)) * nrow(fertility)

# Round the values
round(seasons_normalized)
## winter spring summer   fall 
##     29     38      0     33
# Generate synthetic data for winter
rep(-1, 29)
##  [1] -1 -1 -1 -1 -1 -1 -1 -1 -1 -1 -1 -1 -1 -1 -1 -1 -1 -1 -1 -1 -1 -1 -1
## [24] -1 -1 -1 -1 -1 -1
# Generate synthetic data for spring
rep(-0.33, 38)
##  [1] -0.33 -0.33 -0.33 -0.33 -0.33 -0.33 -0.33 -0.33 -0.33 -0.33 -0.33
## [12] -0.33 -0.33 -0.33 -0.33 -0.33 -0.33 -0.33 -0.33 -0.33 -0.33 -0.33
## [23] -0.33 -0.33 -0.33 -0.33 -0.33 -0.33 -0.33 -0.33 -0.33 -0.33 -0.33
## [34] -0.33 -0.33 -0.33 -0.33 -0.33
# Generate synthetic data for summer
rep(0.33, 0)
## numeric(0)
# Generate synthetic data for fall
rep(1, 33)
##  [1] 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1
# Calculate proportions
fertility %>%
    summarise_at(vars(Accident_Trauma, Surgical_Intervention), mean)
## # A tibble: 1 x 2
##   Accident_Trauma Surgical_Intervention
##             <dbl>                 <dbl>
## 1            0.44                  0.51
# Number of Observations
n <- nrow(fertility)

# Set Value of Epsilon
eps <- 0.1

# GS of Proportion
gs.prop <- (1/n)


# Apply the Laplace mechanism
set.seed(42)
smoothmest::rdoublex(1, 0.44, gs.prop/eps)
## [1] 0.4598337
smoothmest::rdoublex(1, 0.51, gs.prop/eps)
## [1] 0.5383491
# Generate Synthetic data
set.seed(42)
accident <- rbinom(n, 1, 0.46)
surgical <- rbinom(n, 1, 0.54)


# Set Value of Epsilon
eps <- 0.1 / 2

# Number of observations
n <- nrow(fertility)

# Upper and lower bounds of age
a <- 0
b <- 1

# GS of mean and variance for age
gs.mean <- (b-a) / n
gs.var <- (b-a)**2 / n


# Mean and Variance of Age
fertility %>%
    summarise_at(vars(Age), funs(mean, var))
## # A tibble: 1 x 2
##    mean    var
##   <dbl>  <dbl>
## 1 0.669 0.0147
# Apply the Laplace mechanism
set.seed(42)
smoothmest::rdoublex(1, 0.67, gs.mean/eps)
## [1] 0.7096674
smoothmest::rdoublex(1, 0.01, gs.var/eps)
## [1] 0.06669821
# Generate Synthetic data
set.seed(42)
age <- rnorm(n, mean=0.71, sd=sqrt(0.07))

# Hard Bounding the data
age[age < 0] <- 0
age[age > 1] <- 1

Marketing Analytics in R: Statistical Modeling

Chapter 1 - Modeling Customer Lifetime Value with Linear Regression

Introduction - Verena from INWT Statistics (consultancy in marketing analytics):

  • Customer Lifetime Value (CLV) is the expected value of forecasted customer value to the company
    • CLV is based on margin, and needs to use current information to predict future margins
    • Customers predicted to have higher CLV can then be targeted
  • Can inspect the data without seeing attributes using str(clvData1, give.attr = FALSE)
  • Can derive correlations using corrplot
    • library(corrplot)
    • clvData1 %>% select(nOrders, nItems, … ,margin, futureMargin) %>% cor() %>% corrplot()

Simple linear regression - one predictor variable to predict one response variable:

  • Can run linear regressions using basic stats modules
    • simpleLM <- lm(futureMargin ~ margin, data = clvData1)
    • summary(simpleLM)
  • Can plot previous margin vs. current margin, including a linear regression (smooth)
    • ggplot(clvData1, aes(margin, futureMargin)) + geom_point() + geom_smooth(method = lm, se = FALSE) + xlab(“Margin year 1”) + ylab(“Margin year 2”)
  • Several conditions must apply for linear regression to be the best method
    • Linear relationship between x and y
    • No measurement error in x (weak exogeneity)
    • Independence of errors
    • Expectation of errors is 0
    • Constant variance of prediction errors (homoscedasticity)
    • Normality of errors

Multiple linear regression:

  • Omitted variable bias is when a variable not in the regression is correlated with both the predictor and the response variables
    • Simpson’s Paradox is an example - upward sloping becomes downward sloping after properly splitting on the extra variable
  • Multicollinearity is a threat to a linear regression - leads to unstable regression coefficients, with associated under-reporting of standard errors
    • rms::vif(myLMModel) # above 5 is concerning, above 10 almost always needs to be addressed

Model validation, fit, and prediction:

  • The R-squared is the proportion of variance in the depedent variable that is explained by the regression
  • Can look at the p-value of the F-test to assess the overall statistical significance of the model
  • There is a risk of over-fitting, when the model is overly complex and learns artifacts of the training data rather than genuine patterns
    • Can use stats::AIC() or MASS::stepAIC(), with the goal being to minimize AIC (needs to be models of the same data)
    • AIC(multipleLM2)
  • Can predict outputs automatically, such as with
    • predMargin <- predict(multipleLM2, newdata = clvData2)

Example code includes:

salesData <- readr::read_csv("./RInputFiles/salesData.csv")
## Parsed with column specification:
## cols(
##   id = col_integer(),
##   nItems = col_integer(),
##   mostFreqStore = col_character(),
##   mostFreqCat = col_character(),
##   nCats = col_integer(),
##   preferredBrand = col_character(),
##   nBrands = col_integer(),
##   nPurch = col_integer(),
##   salesLast3Mon = col_double(),
##   salesThisMon = col_double(),
##   daysSinceLastPurch = col_integer(),
##   meanItemPrice = col_double(),
##   meanShoppingCartValue = col_double(),
##   customerDuration = col_integer()
## )
# Structure of dataset
str(salesData, give.attr = FALSE)
## Classes 'tbl_df', 'tbl' and 'data.frame':    5122 obs. of  14 variables:
##  $ id                   : int  1 2 3 4 5 6 7 8 9 10 ...
##  $ nItems               : int  1469 1463 262 293 108 216 174 122 204 308 ...
##  $ mostFreqStore        : chr  "Stockton" "Stockton" "Colorado Springs" "Colorado Springs" ...
##  $ mostFreqCat          : chr  "Alcohol" "Alcohol" "Shoes" "Bakery" ...
##  $ nCats                : int  72 73 55 50 32 41 36 31 41 52 ...
##  $ preferredBrand       : chr  "Veina" "Veina" "Bo" "Veina" ...
##  $ nBrands              : int  517 482 126 108 79 98 78 62 99 103 ...
##  $ nPurch               : int  82 88 56 43 18 35 34 12 26 33 ...
##  $ salesLast3Mon        : num  2742 2791 1530 1766 1180 ...
##  $ salesThisMon         : num  1284 1243 683 730 553 ...
##  $ daysSinceLastPurch   : int  1 1 1 1 12 2 2 4 14 1 ...
##  $ meanItemPrice        : num  1.87 1.91 5.84 6.03 10.93 ...
##  $ meanShoppingCartValue: num  33.4 31.7 27.3 41.1 65.6 ...
##  $ customerDuration     : int  821 657 548 596 603 673 612 517 709 480 ...
# Visualization of correlations
salesData %>% select_if(is.numeric) %>%
  select(-id) %>%
  cor() %>%
  corrplot::corrplot()

# Frequent stores
ggplot(salesData) +
    geom_boxplot(aes(x = mostFreqStore, y = salesThisMon))

# Preferred brand
ggplot(salesData) +
    geom_boxplot(aes(x = preferredBrand, y = salesThisMon))

# Model specification using lm
salesSimpleModel <- lm(salesThisMon ~ salesLast3Mon, data = salesData)

# Looking at model summary
summary(salesSimpleModel)
## 
## Call:
## lm(formula = salesThisMon ~ salesLast3Mon, data = salesData)
## 
## Residuals:
##     Min      1Q  Median      3Q     Max 
## -570.18  -68.26    3.21   72.98  605.58 
## 
## Coefficients:
##                Estimate Std. Error t value Pr(>|t|)    
## (Intercept)   99.690501   6.083886   16.39   <2e-16 ***
## salesLast3Mon  0.382696   0.004429   86.40   <2e-16 ***
## ---
## Signif. codes:  0 '***' 0.001 '**' 0.01 '*' 0.05 '.' 0.1 ' ' 1
## 
## Residual standard error: 117.5 on 5120 degrees of freedom
## Multiple R-squared:  0.5932, Adjusted R-squared:  0.5931 
## F-statistic:  7465 on 1 and 5120 DF,  p-value: < 2.2e-16
# Estimating the full model
salesModel1 <- lm(salesThisMon ~ . -id, data = salesData)

# Checking variance inflation factors
car::vif(salesModel1)
##                            GVIF Df GVIF^(1/(2*Df))
## nItems                11.772600  1        3.431122
## mostFreqStore          1.260469  9        1.012943
## mostFreqCat            1.527348  9        1.023809
## nCats                  8.402073  1        2.898633
## preferredBrand         1.682184  9        1.029316
## nBrands               14.150868  1        3.761764
## nPurch                 3.083952  1        1.756119
## salesLast3Mon          8.697663  1        2.949180
## daysSinceLastPurch     1.585057  1        1.258991
## meanItemPrice          1.987665  1        1.409846
## meanShoppingCartValue  2.247579  1        1.499193
## customerDuration       1.004664  1        1.002329
# Estimating new model by removing information on brand
salesModel2 <- lm(salesThisMon ~ . -id -preferredBrand -nBrands, data = salesData)

# Checking variance inflation factors
car::vif(salesModel2)
##                           GVIF Df GVIF^(1/(2*Df))
## nItems                6.987456  1        2.643380
## mostFreqStore         1.178251  9        1.009154
## mostFreqCat           1.269636  9        1.013351
## nCats                 5.813494  1        2.411119
## nPurch                3.069046  1        1.751869
## salesLast3Mon         8.412520  1        2.900435
## daysSinceLastPurch    1.579426  1        1.256752
## meanItemPrice         1.925494  1        1.387622
## meanShoppingCartValue 2.238410  1        1.496132
## customerDuration      1.002981  1        1.001489
salesData2_4 <- readr::read_csv("./RInputFiles/salesDataMon2To4.csv")
## Parsed with column specification:
## cols(
##   id = col_integer(),
##   nItems = col_integer(),
##   mostFreqStore = col_character(),
##   mostFreqCat = col_character(),
##   nCats = col_integer(),
##   preferredBrand = col_character(),
##   nBrands = col_integer(),
##   nPurch = col_integer(),
##   salesLast3Mon = col_double(),
##   daysSinceLastPurch = col_integer(),
##   meanItemPrice = col_double(),
##   meanShoppingCartValue = col_double(),
##   customerDuration = col_integer()
## )
# getting an overview of new data
summary(salesData2_4)
##        id           nItems       mostFreqStore      mostFreqCat       
##  Min.   :   1   Min.   :   1.0   Length:5173        Length:5173       
##  1st Qu.:1372   1st Qu.:  84.0   Class :character   Class :character  
##  Median :2733   Median : 155.0   Mode  :character   Mode  :character  
##  Mean   :2729   Mean   : 185.9                                        
##  3rd Qu.:4085   3rd Qu.: 257.0                                        
##  Max.   :5455   Max.   :1461.0                                        
##      nCats       preferredBrand        nBrands           nPurch     
##  Min.   : 1.00   Length:5173        Min.   :  1.00   Min.   : 1.00  
##  1st Qu.:27.00   Class :character   1st Qu.: 45.00   1st Qu.:11.00  
##  Median :37.00   Mode  :character   Median : 75.00   Median :17.00  
##  Mean   :36.23                      Mean   : 81.66   Mean   :20.02  
##  3rd Qu.:46.00                      3rd Qu.:110.00   3rd Qu.:27.00  
##  Max.   :74.00                      Max.   :484.00   Max.   :86.00  
##  salesLast3Mon  daysSinceLastPurch meanItemPrice     meanShoppingCartValue
##  Min.   : 189   Min.   : 1.000     Min.   :  1.879   Min.   :  17.58      
##  1st Qu.:1068   1st Qu.: 2.000     1st Qu.:  6.049   1st Qu.:  53.88      
##  Median :1331   Median : 4.000     Median :  8.556   Median :  75.77      
##  Mean   :1324   Mean   : 6.589     Mean   : 12.116   Mean   :  91.88      
##  3rd Qu.:1570   3rd Qu.: 7.000     3rd Qu.: 12.969   3rd Qu.: 109.74      
##  Max.   :2745   Max.   :87.000     Max.   :313.050   Max.   :1147.66      
##  customerDuration
##  Min.   :  31.0  
##  1st Qu.: 580.0  
##  Median : 682.0  
##  Mean   : 676.8  
##  3rd Qu.: 777.0  
##  Max.   :1386.0
# predicting sales
predSales5 <- predict(salesModel2, newdata = salesData2_4)

# calculating mean of future sales
mean(predSales5)
## [1] 625.1438

Chapter 2 - Logistic Regression for Churn Prevention

Churn prevention in online marketing:

  • Objective is to predict the likelihood of a customer repeating their business, assessed using logistic regression
    • Model the log-odds (defined as log (P(Y=1) / P(Y=0))) as a linear function of the inputs
    • Convert the log-odds to odds (defined as P(Y=1) / P(Y=0)) by exponentiation
    • Convert the odds to a probability of churning, using odds / (1 + odds)
  • Can begin with basic data exploration
    • ggplot(churnData, aes(x = returnCustomer)) + geom_histogram(stat = “count”)

Modeling and model selection:

  • The logit model can be run using the GLM provided in R
    • logitModelFull <- glm(returnCustomer ~ title + newsletter + websiteDesign + …, family = binomial, churnData)
  • Interpreting the coefficients is not easy - they are related to the log-odds
    • Can exponentiate the coefficients to get their impact on the odds
    • Can then interpret that greater than 1 means “more likely, all else equal”
  • Can use MASS::stepAIC() to help refine the modeling
    • library(MASS)
    • logitModelNew <- stepAIC(logitModelFull, trace = 0)
    • summary(logitModelNew)
    • Produces a model with fewer variables and a lower AIC

In-sample model fit and thresholding:

  • There are three types of pseudo-R-squared statistics available for the results of logistical regression
    • McFadden: R-squared = 1 - L(null) / L(full)
    • Cox-Snell: R-squared = 1 - (L(null) / L(full)) ** (2/n)
    • Nagelkerke: R-squared = [1 - (L(null) / L(full)) ** (2/n)] / [1 - L(null) ** (2/n)]
    • Generally, anything above 0.2 is reasonably good
    • descr::LogRegR2(logitModelNew)
    • library(SDMTools)
    • churnData$predNew <- predict(logitModelNew, type = “response”, na.action = na.exclude) # get the prediction probabilities
    • data %>% select(returnCustomer, predNew) %>% tail()
    • confMatrixNew <- confusion.matrix(churnData\(returnCustomer, churnData\)predNew, threshold = 0.5) # this is the version from SDMTools
  • Can give different weights to the different errors (false negatives, false positives, etc.)
    • Can instead look at a payoff, defined based on scalars for the various quadrants

Out-of-sample validation and cross validation:

  • Begin by randomly splitting data in to training (roughly two-thirds) and holding back the remainder for validation (roughly one-third)
    • set.seed(534381)
    • churnData$isTrain <- rbinom(nrow(churnData), 1, 0.66)
    • train <- subset(churnData, churnData$isTrain == 1)
    • test <- subset(churnData, churnData$isTrain == 0)
    • test$predNew <- predict(logitTrainNew, type = “response”, newdata = test) # make predictions only on the test dataset
  • Cross-validation is an even more powerful tool for assessing out-of-sample error
    • Split the data in to k subsets, and run the model k times with k-1 training data and the last subset used as the validation data
    • Acc03 <- function(r, pi = 0) {
    • cm <- confusion.matrix(r, pi, threshold = 0.3)
    • acc <- sum(diag(cm)) / sum(cm) return(acc)
    • }
    • set.seed(534381)
    • boot::cv.glm(churnData, logitModelNew, cost = Acc03, K = 6)$delta
  • Can continually tweak the model to see if transforms, variable additions, etc., might tend to improve the out-of-sample error rate

Example code includes:

defaultData <- readr::read_delim("./RInputFiles/defaultData.csv", delim=";")
## Parsed with column specification:
## cols(
##   .default = col_integer()
## )
## See spec(...) for full column specifications.
# Summary of data
summary(defaultData)
##        ID           limitBal            sex          education    
##  Min.   :    1   Min.   :  10000   Min.   :1.000   Min.   :0.000  
##  1st Qu.: 4501   1st Qu.:  50000   1st Qu.:1.000   1st Qu.:1.000  
##  Median : 9000   Median : 130000   Median :2.000   Median :2.000  
##  Mean   : 9000   Mean   : 162902   Mean   :1.588   Mean   :1.835  
##  3rd Qu.:13500   3rd Qu.: 230000   3rd Qu.:2.000   3rd Qu.:2.000  
##  Max.   :18000   Max.   :1000000   Max.   :2.000   Max.   :6.000  
##     marriage         age             pay1               pay2        
##  Min.   :0.00   Min.   :21.00   Min.   :-2.00000   Min.   :-2.0000  
##  1st Qu.:1.00   1st Qu.:28.00   1st Qu.:-1.00000   1st Qu.:-1.0000  
##  Median :2.00   Median :34.00   Median : 0.00000   Median : 0.0000  
##  Mean   :1.56   Mean   :35.48   Mean   : 0.02783   Mean   :-0.1017  
##  3rd Qu.:2.00   3rd Qu.:41.00   3rd Qu.: 0.00000   3rd Qu.: 0.0000  
##  Max.   :3.00   Max.   :75.00   Max.   : 8.00000   Max.   : 8.0000  
##       pay3              pay4              pay5             pay6        
##  Min.   :-2.0000   Min.   :-2.0000   Min.   :-2.000   Min.   :-2.0000  
##  1st Qu.:-1.0000   1st Qu.:-1.0000   1st Qu.:-1.000   1st Qu.:-1.0000  
##  Median : 0.0000   Median : 0.0000   Median : 0.000   Median : 0.0000  
##  Mean   :-0.1294   Mean   :-0.1974   Mean   :-0.228   Mean   :-0.2567  
##  3rd Qu.: 0.0000   3rd Qu.: 0.0000   3rd Qu.: 0.000   3rd Qu.: 0.0000  
##  Max.   : 8.0000   Max.   : 8.0000   Max.   : 8.000   Max.   : 8.0000  
##     billAmt1          billAmt2         billAmt3          billAmt4      
##  Min.   :-165580   Min.   :-33350   Min.   : -34041   Min.   :-170000  
##  1st Qu.:   3675   1st Qu.:  3149   1st Qu.:   2655   1st Qu.:   2245  
##  Median :  22450   Median : 21425   Median :  20035   Median :  18703  
##  Mean   :  50030   Mean   : 48131   Mean   :  45607   Mean   :  41074  
##  3rd Qu.:  65001   3rd Qu.: 62157   3rd Qu.:  58457   3rd Qu.:  50540  
##  Max.   : 964511   Max.   :983931   Max.   :1664089   Max.   : 891586  
##     billAmt5         billAmt6          payAmt1          payAmt2       
##  Min.   :-37594   Min.   :-339603   Min.   :     0   Min.   :      0  
##  1st Qu.:  1684   1st Qu.:   1150   1st Qu.:   949   1st Qu.:    696  
##  Median : 18046   Median :  16780   Median :  2087   Median :   2000  
##  Mean   : 39398   Mean   :  38009   Mean   :  5532   Mean   :   5731  
##  3rd Qu.: 49355   3rd Qu.:  48442   3rd Qu.:  5000   3rd Qu.:   5000  
##  Max.   :927171   Max.   : 961664   Max.   :505000   Max.   :1684259  
##     payAmt3          payAmt4          payAmt5            payAmt6      
##  Min.   :     0   Min.   :     0   Min.   :     0.0   Min.   :     0  
##  1st Qu.:   307   1st Qu.:   228   1st Qu.:   209.8   1st Qu.:     2  
##  Median :  1500   Median :  1486   Median :  1500.0   Median :  1400  
##  Mean   :  4629   Mean   :  4757   Mean   :  4763.7   Mean   :  5135  
##  3rd Qu.:  4000   3rd Qu.:  4000   3rd Qu.:  4000.0   3rd Qu.:  4000  
##  Max.   :896040   Max.   :497000   Max.   :417990.0   Max.   :528666  
##  PaymentDefault  
##  Min.   :0.0000  
##  1st Qu.:0.0000  
##  Median :0.0000  
##  Mean   :0.2306  
##  3rd Qu.:0.0000  
##  Max.   :1.0000
# Look at data structure
str(defaultData, give.attr=FALSE)
## Classes 'tbl_df', 'tbl' and 'data.frame':    18000 obs. of  25 variables:
##  $ ID            : int  1 2 3 4 5 6 7 8 9 10 ...
##  $ limitBal      : int  20000 120000 90000 50000 50000 50000 500000 100000 140000 20000 ...
##  $ sex           : int  2 2 2 2 1 1 1 2 2 1 ...
##  $ education     : int  2 2 2 2 2 1 1 2 3 3 ...
##  $ marriage      : int  1 2 2 1 1 2 2 2 1 2 ...
##  $ age           : int  24 26 34 37 57 37 29 23 28 35 ...
##  $ pay1          : int  2 -1 0 0 -1 0 0 0 0 -2 ...
##  $ pay2          : int  2 2 0 0 0 0 0 -1 0 -2 ...
##  $ pay3          : int  -1 0 0 0 -1 0 0 -1 2 -2 ...
##  $ pay4          : int  -1 0 0 0 0 0 0 0 0 -2 ...
##  $ pay5          : int  -2 0 0 0 0 0 0 0 0 -1 ...
##  $ pay6          : int  -2 2 0 0 0 0 0 -1 0 -1 ...
##  $ billAmt1      : int  3913 2682 29239 46990 8617 64400 367965 11876 11285 0 ...
##  $ billAmt2      : int  3102 1725 14027 48233 5670 57069 412023 380 14096 0 ...
##  $ billAmt3      : int  689 2682 13559 49291 35835 57608 445007 601 12108 0 ...
##  $ billAmt4      : int  0 3272 14331 28314 20940 19394 542653 221 12211 0 ...
##  $ billAmt5      : int  0 3455 14948 28959 19146 19619 483003 -159 11793 13007 ...
##  $ billAmt6      : int  0 3261 15549 29547 19131 20024 473944 567 3719 13912 ...
##  $ payAmt1       : int  0 0 1518 2000 2000 2500 55000 380 3329 0 ...
##  $ payAmt2       : int  689 1000 1500 2019 36681 1815 40000 601 0 0 ...
##  $ payAmt3       : int  0 1000 1000 1200 10000 657 38000 0 432 0 ...
##  $ payAmt4       : int  0 1000 1000 1100 9000 1000 20239 581 1000 13007 ...
##  $ payAmt5       : int  0 0 1000 1069 689 1000 13750 1687 1000 1122 ...
##  $ payAmt6       : int  0 2000 5000 1000 679 800 13770 1542 1000 0 ...
##  $ PaymentDefault: int  1 1 0 0 0 0 0 0 0 0 ...
# Analyze the balancedness of dependent variable
ggplot(defaultData, aes(x = PaymentDefault)) +
  geom_histogram(stat = "count") 
## Warning: Ignoring unknown parameters: binwidth, bins, pad

# Build logistic regression model
logitModelFull <- glm(PaymentDefault ~ limitBal + sex + education + marriage +
                   age + pay1 + pay2 + pay3 + pay4 + pay5 + pay6 + billAmt1 + 
                   billAmt2 + billAmt3 + billAmt4 + billAmt5 + billAmt6 + payAmt1 + 
                   payAmt2 + payAmt3 + payAmt4 + payAmt5 + payAmt6, 
                family = "binomial", data = defaultData)

# Take a look at the model
summary(logitModelFull)
## 
## Call:
## glm(formula = PaymentDefault ~ limitBal + sex + education + marriage + 
##     age + pay1 + pay2 + pay3 + pay4 + pay5 + pay6 + billAmt1 + 
##     billAmt2 + billAmt3 + billAmt4 + billAmt5 + billAmt6 + payAmt1 + 
##     payAmt2 + payAmt3 + payAmt4 + payAmt5 + payAmt6, family = "binomial", 
##     data = defaultData)
## 
## Deviance Residuals: 
##     Min       1Q   Median       3Q      Max  
## -3.0893  -0.7116  -0.5615  -0.2794   4.2501  
## 
## Coefficients:
##               Estimate Std. Error z value Pr(>|z|)    
## (Intercept) -5.711e-01  1.505e-01  -3.795 0.000148 ***
## limitBal    -4.825e-07  1.985e-07  -2.431 0.015052 *  
## sex         -8.251e-02  3.880e-02  -2.127 0.033457 *  
## education   -1.217e-01  2.745e-02  -4.434 9.23e-06 ***
## marriage    -1.711e-01  4.016e-02  -4.259 2.05e-05 ***
## age          4.824e-03  2.257e-03   2.137 0.032570 *  
## pay1         5.743e-01  2.221e-02  25.864  < 2e-16 ***
## pay2         5.156e-02  2.552e-02   2.020 0.043336 *  
## pay3         7.811e-02  2.863e-02   2.728 0.006375 ** 
## pay4        -1.191e-02  3.285e-02  -0.363 0.716838    
## pay5         1.080e-01  3.381e-02   3.193 0.001406 ** 
## pay6        -1.956e-02  2.750e-02  -0.711 0.476852    
## billAmt1    -7.948e-06  1.582e-06  -5.023 5.09e-07 ***
## billAmt2     4.911e-06  2.006e-06   2.448 0.014350 *  
## billAmt3     4.203e-07  1.698e-06   0.247 0.804572    
## billAmt4    -1.587e-08  1.872e-06  -0.008 0.993234    
## billAmt5     9.703e-07  2.154e-06   0.451 0.652293    
## billAmt6     6.758e-07  1.591e-06   0.425 0.670955    
## payAmt1     -1.878e-05  3.252e-06  -5.777 7.61e-09 ***
## payAmt2     -6.406e-06  2.364e-06  -2.710 0.006731 ** 
## payAmt3     -3.325e-06  2.401e-06  -1.385 0.166153    
## payAmt4     -3.922e-06  2.342e-06  -1.675 0.093970 .  
## payAmt5     -2.383e-06  2.168e-06  -1.099 0.271635    
## payAmt6     -1.916e-06  1.618e-06  -1.184 0.236521    
## ---
## Signif. codes:  0 '***' 0.001 '**' 0.01 '*' 0.05 '.' 0.1 ' ' 1
## 
## (Dispersion parameter for binomial family taken to be 1)
## 
##     Null deviance: 19438  on 17999  degrees of freedom
## Residual deviance: 17216  on 17976  degrees of freedom
## AIC: 17264
## 
## Number of Fisher Scoring iterations: 5
# Take a look at the odds
coefsexp <- coef(logitModelFull) %>% exp() %>% round(2)
coefsexp
## (Intercept)    limitBal         sex   education    marriage         age 
##        0.56        1.00        0.92        0.89        0.84        1.00 
##        pay1        pay2        pay3        pay4        pay5        pay6 
##        1.78        1.05        1.08        0.99        1.11        0.98 
##    billAmt1    billAmt2    billAmt3    billAmt4    billAmt5    billAmt6 
##        1.00        1.00        1.00        1.00        1.00        1.00 
##     payAmt1     payAmt2     payAmt3     payAmt4     payAmt5     payAmt6 
##        1.00        1.00        1.00        1.00        1.00        1.00
# The old (full) model
logitModelFull <- glm(PaymentDefault ~ limitBal + sex + education + marriage +
                   age + pay1 + pay2 + pay3 + pay4 + pay5 + pay6 + billAmt1 + 
                   billAmt2 + billAmt3 + billAmt4 + billAmt5 + billAmt6 + payAmt1 + 
                   payAmt2 + payAmt3 + payAmt4 + payAmt5 + payAmt6, 
                 family = binomial, defaultData)

#Build the new model
logitModelNew <- MASS::stepAIC(logitModelFull, trace=0) 

#Look at the model
summary(logitModelNew) 
## 
## Call:
## glm(formula = PaymentDefault ~ limitBal + sex + education + marriage + 
##     age + pay1 + pay2 + pay3 + pay5 + billAmt1 + billAmt2 + billAmt5 + 
##     payAmt1 + payAmt2 + payAmt3 + payAmt4, family = binomial, 
##     data = defaultData)
## 
## Deviance Residuals: 
##     Min       1Q   Median       3Q      Max  
## -3.0839  -0.7119  -0.5611  -0.2839   4.1800  
## 
## Coefficients:
##               Estimate Std. Error z value Pr(>|z|)    
## (Intercept) -5.699e-01  1.504e-01  -3.790 0.000151 ***
## limitBal    -5.201e-07  1.954e-07  -2.661 0.007791 ** 
## sex         -8.206e-02  3.878e-02  -2.116 0.034338 *  
## education   -1.212e-01  2.744e-02  -4.418 9.96e-06 ***
## marriage    -1.724e-01  4.014e-02  -4.295 1.75e-05 ***
## age          4.863e-03  2.256e-03   2.156 0.031092 *  
## pay1         5.740e-01  2.218e-02  25.882  < 2e-16 ***
## pay2         4.979e-02  2.552e-02   1.951 0.051048 .  
## pay3         7.197e-02  2.573e-02   2.798 0.005146 ** 
## pay5         8.859e-02  2.249e-02   3.938 8.20e-05 ***
## billAmt1    -8.130e-06  1.580e-06  -5.144 2.69e-07 ***
## billAmt2     5.238e-06  1.775e-06   2.951 0.003165 ** 
## billAmt5     1.790e-06  8.782e-07   2.038 0.041554 *  
## payAmt1     -1.931e-05  3.258e-06  -5.928 3.06e-09 ***
## payAmt2     -6.572e-06  2.092e-06  -3.142 0.001681 ** 
## payAmt3     -3.693e-06  2.187e-06  -1.689 0.091241 .  
## payAmt4     -4.611e-06  2.062e-06  -2.237 0.025306 *  
## ---
## Signif. codes:  0 '***' 0.001 '**' 0.01 '*' 0.05 '.' 0.1 ' ' 1
## 
## (Dispersion parameter for binomial family taken to be 1)
## 
##     Null deviance: 19438  on 17999  degrees of freedom
## Residual deviance: 17220  on 17983  degrees of freedom
## AIC: 17254
## 
## Number of Fisher Scoring iterations: 5
# Save the formula of the new model (it will be needed for the out-of-sample part) 
formulaLogit <- as.formula(summary(logitModelNew)$call)
formulaLogit
## PaymentDefault ~ limitBal + sex + education + marriage + age + 
##     pay1 + pay2 + pay3 + pay5 + billAmt1 + billAmt2 + billAmt5 + 
##     payAmt1 + payAmt2 + payAmt3 + payAmt4
# Make predictions using the full Model
defaultData$predFull <- predict(logitModelFull, type = "response", na.action = na.exclude)

# Construct the in-sample confusion matrix
confMatrixModelFull <- SDMTools::confusion.matrix(defaultData$PaymentDefault, 
                                                  defaultData$predFull, 
                                                  threshold = 0.5
                                                  )
confMatrixModelFull
##     obs
## pred     0    1
##    0 13441 3154
##    1   409  996
## attr(,"class")
## [1] "confusion.matrix"
# Calculate the accuracy for the full Model
accuracyFull <- sum(diag(confMatrixModelFull)) / sum(confMatrixModelFull)
accuracyFull
## [1] 0.8020556
# Calculate the accuracy for 'logitModelNew'
# Make prediction
defaultData$predNew <- predict(logitModelNew, type = "response", na.action = na.exclude)

# Construct the in-sample confusion matrix
confMatrixModelNew <- SDMTools::confusion.matrix(defaultData$PaymentDefault, 
                                                 defaultData$predNew, 
                                                 threshold = 0.5
                                                 )
confMatrixModelNew
##     obs
## pred     0    1
##    0 13443 3152
##    1   407  998
## attr(,"class")
## [1] "confusion.matrix"
# Calculate the accuracy...
accuracyNew <- sum(diag(confMatrixModelNew)) / sum(confMatrixModelNew)
accuracyNew
## [1] 0.8022778
# and compare it to the full model's accuracy
accuracyFull
## [1] 0.8020556
accuracyNew
## [1] 0.8022778
# Prepare data frame with threshold values and empty payoff column
payoffMatrix <- data.frame(threshold = seq(from = 0.1, to = 0.5, by = 0.1), payoff = NA) 
payoffMatrix
##   threshold payoff
## 1       0.1     NA
## 2       0.2     NA
## 3       0.3     NA
## 4       0.4     NA
## 5       0.5     NA
for(i in 1:length(payoffMatrix$threshold)) {
  # Calculate confusion matrix with varying threshold
  confMatrix <- SDMTools::confusion.matrix(defaultData$PaymentDefault, 
                                           defaultData$predNew, 
                                           threshold = payoffMatrix$threshold[i]
                                           )
  # Calculate payoff and save it to the corresponding row
  payoffMatrix$payoff[i] <- confMatrix[1, 1]*250 + confMatrix[1, 2]*(-1000)
}
payoffMatrix
##   threshold payoff
## 1       0.1 306750
## 2       0.2 752750
## 3       0.3 888000
## 4       0.4 641250
## 5       0.5 208750
# Split data in train and test set
set.seed(534381) 
defaultData$isTrain <- rbinom(nrow(defaultData), 1, 0.66)
train <- subset(defaultData, isTrain == 1)
test <- subset(defaultData, isTrain  == 0)

logitTrainNew <- glm(formulaLogit, family = binomial, data = train) # Modeling
test$predNew <- predict(logitTrainNew, type = "response", newdata = test) # Predictions

# Out-of-sample confusion matrix and accuracy
confMatrixModelNew <- SDMTools::confusion.matrix(test$PaymentDefault, test$predNew, threshold = 0.3) 
sum(diag(confMatrixModelNew)) / sum(confMatrixModelNew) # Compare this value to the in-sample accuracy
## [1] 0.7797764
# Accuracy function
costAcc <- function(r, pi = 0) {
  cm <- SDMTools::confusion.matrix(r, pi, threshold = 0.3)
  acc <- sum(diag(cm)) / sum(cm)
  return(acc)
}

# Cross validated accuracy for logitModelNew
set.seed(534381)
boot::cv.glm(defaultData, logitModelNew, cost = costAcc, K = 6)$delta[1]
## [1] 0.7862778

Chapter 3 - Modeling Time to Reorder with Survival Analysis

Survival Analysis Introduction:

  • Often have “censored” data, meaning that the customer journeys are not yet complete
    • Random Type I Right censoring is the most common - a point can only be observed if it has occurred before time X, and it is otherwise unknowable (but known that they have not yet churned)
    • Can plot histograms of whether someone has churned depending on the length of time
    • plotTenure <- dataSurv %>% mutate(churn = churn %>% factor(labels = c(“No”, “Yes”))) %>%
    • ggplot() + geom_histogram(aes(x = tenure, fill = factor(churn))) + facet_grid( ~ churn) +
    • theme(legend.position = “none”)
  • Survival analysis attempts to estimate when something will happen (churn, second order, renewal, etc.)

Survival curve analysis by Kaplan-Meier:

  • Begin by creating a new object containing the survival attribute
    • cbind(dataSurv %>% select(tenure, churn), surv = Surv(dataSurv\(tenure, dataSurv\)churn)) %>% head(10)
  • The survival function is the probability of “no event” in cumulative by time t
    • The hazard function is the cumulative probability of “event” by time t
    • The “hazard rate” is the probability of the event happening in a small time, provided that it has not yet happened
  • The Kaplan-Meier analysis can be used to estimate survival
    • fitKM <- survival::survfit(Surv(dataSurv\(tenure, dataSurv\)churn) ~ 1, type = “kaplan-meier”)
    • print(fitKM) # gives a few rough summary statistics
    • plot(fitKM) # survival curve with confidence interval
    • fitKMstr <- survfit(Surv(tenure, churn) ~ Partner, data = dataSurv) # add covariates, such as ~ Partner rather than ~1 as in the baseline

Cox PH model with constant covariates:

  • Model definition: cannot parse to ISO - see Excel notes
    • Predictors are lineary and multiplicatively related to the hazard function, lambda
    • Relative hazard function needs to remain constant over time
  • Fitting a survival model in R
    • library(rms)
    • units(dataSurv$tenure) <- “Month”
    • dd <- datadist(dataSurv)
    • options(datadist = “dd”)
    • fitCPH1 <- cph(Surv(tenure, churn) ~ gender + SeniorCitizen + Partner + Dependents + StreamMov + PaperlessBilling + PayMeth + MonthlyCharges, data = dataSurv, x = TRUE, y = TRUE, surv = TRUE, time.inc = 1)
    • Coefficient interpretation is relatively similar to logistic regression - exp(fitCPH1$coefficients) - can simplify the coefficients be making them multiplicative (1.00 is no impact)
    • survplot(fitCPH1, MonthlyCharges, label.curves = list(keys = 1:5)) # plots the survival probabilities based on varying 1 variable, assuming other variables constant
    • survplot(fitCPH1, Partner) # covariate with partner, plotted
    • plot(summary(fitCPH1), log = TRUE) # visualizing the hazard ratios

Checking model assumptions and making predictions:

  • Can again use the Cox PH function
    • testCPH1 <- cox.zph(fitCPH1)
    • print(testCPH1) # if p < 0.05, can reject the assumption that the predictor meets the proportional hazard assumption
    • plot(testCPH1, var = “Partner=Yes”)
    • plot(testCPH1, var = “MonthlyCharges”)
    • This test is conservative and sensitive to the number of observations
  • If the PH (proportional hazard) assumptions are violated, can correct for this using
    • fitCPH2 <- cph(Surv(tenure, churn) ~ MonthlyCharges + SeniorCitizen + Partner + Dependents + StreamMov + Contract, stratum = “gender = Male”, data = dataSurv, x = TRUE, y = TRUE, surv = TRUE)
    • rms::validate(fitCPH1, method = “crossvalidation”, B = 10, pr = FALSE) # pr=FALSE means only print at the end; R2 is the R-squared corrected by cross-validation
  • Can then assess probabilities for the event to occur
    • oneNewData <- data.frame(gender = “Female”, SeniorCitizen = “Yes”, Partner = “No”, Dependents = “Yes”, StreamMov = “Yes”, PaperlessBilling = “Yes”, PayMeth = “BankTrans(auto)”, MonthlyCharges = 37.12)
    • str(survest(fitCPH1, newdata = oneNewData, times = 3))
    • plot(survfit(fitCPH1, newdata = oneNewData))
    • print(survfit(fitCPH1, newdata = oneNewData))

Example code includes:

survData <- readr::read_delim("./RInputFiles/survivalDataExercise.csv", delim=",")
## Parsed with column specification:
## cols(
##   daysSinceFirstPurch = col_integer(),
##   shoppingCartValue = col_double(),
##   gender = col_character(),
##   voucher = col_integer(),
##   returned = col_integer(),
##   boughtAgain = col_integer()
## )
dataNextOrder <- survData %>%
    select(daysSinceFirstPurch, boughtAgain)

# Look at the head of the data
head(dataNextOrder)
## # A tibble: 6 x 2
##   daysSinceFirstPurch boughtAgain
##                 <int>       <int>
## 1                  37           0
## 2                  63           1
## 3                  48           0
## 4                  17           1
## 5                  53           0
## 6                  11           1
# Plot a histogram
ggplot(dataNextOrder) +
  geom_histogram(aes(x = daysSinceFirstPurch, fill = factor(boughtAgain))) +
  facet_grid( ~ boughtAgain) + # Separate plots for boughtAgain = 1 vs. 0
  theme(legend.position = "none") # Don't show legend
## `stat_bin()` using `bins = 30`. Pick better value with `binwidth`.

# Create survival object
survObj <- survival::Surv(dataNextOrder$daysSinceFirstPurch, dataNextOrder$boughtAgain)

# Look at structure
str(survObj)
##  'Surv' num [1:5122, 1:2]  37+  63   48+  17   53+  11   22   16   74+  44  ...
##  - attr(*, "dimnames")=List of 2
##   ..$ : NULL
##   ..$ : chr [1:2] "time" "status"
##  - attr(*, "type")= chr "right"
# Compute and print fit
fitKMSimple <- survival::survfit(survObj ~ 1)
print(fitKMSimple)
## Call: survfit(formula = survObj ~ 1)
## 
##       n  events  median 0.95LCL 0.95UCL 
##    5122    3199      41      40      42
# Plot fit
plot(fitKMSimple, conf.int = FALSE, xlab = "Time since first purchase", 
     ylab = "Survival function", main = "Survival function"
     )

dataNextOrder <- survData %>%
    select(daysSinceFirstPurch, boughtAgain, voucher)

# Compute fit with categorical covariate
fitKMCov <- survival::survfit(survObj ~ voucher, data = dataNextOrder)

# Plot fit with covariate and add labels
plot(fitKMCov, lty = 2:3, xlab = "Time since first purchase", 
     ylab = "Survival function", main = "Survival function"
     )
legend(90, .9, c("No", "Yes"), lty = 2:3)

dataNextOrder <- survData

# Determine distributions of predictor variables
dd <- rms::datadist(dataNextOrder)
options(datadist = "dd")

# Compute Cox PH Model and print results
fitCPH <- rms::cph(survival::Surv(daysSinceFirstPurch, boughtAgain) ~ 
                       shoppingCartValue + voucher + returned + gender, data = dataNextOrder, 
                   x = TRUE, y = TRUE, surv = TRUE
                   )
print(fitCPH)
## Cox Proportional Hazards Model
##  
##  rms::cph(formula = survival::Surv(daysSinceFirstPurch, boughtAgain) ~ 
##      shoppingCartValue + voucher + returned + gender, data = dataNextOrder, 
##      x = TRUE, y = TRUE, surv = TRUE)
##  
##                       Model Tests       Discrimination    
##                                            Indexes        
##  Obs       5122    LR chi2    155.68    R2       0.030    
##  Events    3199    d.f.            4    Dxy      0.116    
##  Center -0.2808    Pr(> chi2) 0.0000    g        0.238    
##                    Score chi2 140.57    gr       1.269    
##                    Pr(> chi2) 0.0000                      
##  
##                    Coef    S.E.   Wald Z Pr(>|Z|)
##  shoppingCartValue -0.0021 0.0003 -7.56  <0.0001 
##  voucher           -0.2945 0.0480 -6.14  <0.0001 
##  returned          -0.3145 0.0495 -6.36  <0.0001 
##  gender=male        0.1080 0.0363  2.97  0.0029  
## 
# Interpret coefficients
exp(fitCPH$coefficients)
## shoppingCartValue           voucher          returned       gender=male 
##         0.9978601         0.7449362         0.7301667         1.1140891
# Plot result summary
plot(summary(fitCPH), log = TRUE)

# Check proportional hazard assumption and print result
testCPH <- survival::cox.zph(fitCPH)
print(testCPH)
##                       rho chisq      p
## shoppingCartValue -0.0168 0.907 0.3409
## voucher           -0.0155 0.770 0.3803
## returned           0.0261 2.182 0.1397
## gender=male        0.0390 4.922 0.0265
## GLOBAL                 NA 8.528 0.0740
# Plot time-dependent beta
plot(testCPH, var = "gender=male")

# Validate model
rms::validate(fitCPH, method = "crossvalidation", B = 10, dxy = TRUE, pr = FALSE)
##       index.orig training   test optimism index.corrected  n
## Dxy       0.1159   0.1160 0.1145   0.0014          0.1144 10
## R2        0.0299   0.0300 0.0288   0.0013          0.0287 10
## Slope     1.0000   1.0000 0.9733   0.0267          0.9733 10
## D         0.0032   0.0033 0.0042  -0.0009          0.0041 10
## U         0.0000   0.0000 0.0002  -0.0002          0.0002 10
## Q         0.0032   0.0033 0.0040  -0.0007          0.0040 10
## g         0.2380   0.2382 0.2320   0.0062          0.2318 10
# Create data with new customer
newCustomer <- data.frame(daysSinceFirstPurch = 21, shoppingCartValue = 99.9, gender = "female", 
                          voucher = 1, returned = 0, stringsAsFactors = FALSE
                          )

# Make predictions
pred <- survival::survfit(fitCPH, newdata = newCustomer)
print(pred)
## Call: survfit(formula = fitCPH, newdata = newCustomer)
## 
##       n  events  median 0.95LCL 0.95UCL 
##    5122    3199      47      44      49
plot(pred)

# Correct the customer's gender
newCustomer2 <- newCustomer
newCustomer2$gender <- "male"

# Redo prediction
pred2 <- survival::survfit(fitCPH, newdata = newCustomer2)
print(pred2)
## Call: survfit(formula = fitCPH, newdata = newCustomer2)
## 
##       n  events  median 0.95LCL 0.95UCL 
##    5122    3199      44      42      47

Chapter 4 - Reducing Dimensionality with Principal Component Analysis

PCA for CRM Data - address mutlicollinearity and data volume issues in the raw CRM data:

  • PCA reduces a large number of correlated variables to a smaller number of uncorrelated (orthogonal) variables
  • PCA can also help with creating an index, such as using the first component of the PCA
  • All variables must be either continuous or binary prior to running the PCA analysis
    • dataCustomers %>% cor() %>% corrplot() # plot the initial correlations

PCA Computation:

  • Need to manage for variance, otherwise high-variance variables will be over-represented in the PCA
    • lapply(dataCustomers, var)
    • dataCustomers <- dataCustomers %>% scale() %>% as.data.frame()
    • pcaCust <- prcomp(dataCustomers)
    • pcaCust$sdev %>% round(2) # standard deviations by component
    • pcaCust$sdev ^ 2 %>% round(2) # variances, also known as eigenvalues, by component give a good sense for relative importance (relative ratio is percent of variance explained)
    • round(pcaCust$rotation[, 1:6], 2) # correlations between original variables and principal components (can use these to give descriptive names to components)
  • Values of the observations are the weightings for the PC to make up the underlying data
    • sum(dataCustomers[1,] * pcaCust$rotation[,1]) # Value on 1st component for 1st customer
    • pcaCust$x[1:5, 1:6] # first 5 customers and first 6 component loadings (weightings)

PCA Model Specification:

  • Need to decide on how many components to keep - balance size of data vs. reconstruction of original data
    • Can set a minimum requirement for percentage of variance explained (such as 70%)
    • summary(pcaCust) # will show cumulatives also
    • Can use the Kaiser-Guttman criteria, which keeps only components with an eigenvalue of 1 (since 1 is the average)
    • Can also draw a scree plot to see the variances (eigenvalues) in descending order - look for an elbow
    • screeplot(pcaCust, type = “lines”)
    • Generally, use a few different techniques, and pick a number that is “in the range”
  • The biplot can help to show how the data map on to the principal components
    • biplot(pcaCust, choices = 1:2, cex = 0.7) # will show PC1 and PC2, with arrows for the various features and how they map on them

Principal components in a regression analysis:

  • PCA can help to solve the multi-collinearity problem in a regression
    • dataCustComponents <- cbind(dataCustomers[, “customerSatis”], pcaCust$x[, 1:6]) %>% as.data.frame
    • mod2 <- lm(customerSatis ~ ., dataCustComponents)
    • vif(mod2) # by construction, these will all be 1, since the principal components are orthogonal
  • Factor analysis is another dimension-reduction technique, sometimes confused with PCA
    • Factor analysis theorizes that latent constructs (e.g., intelligence) which cannot be directly measured are influencing the observed variables
    • Factor analysis is often used in questionnaires - factor analysis can investigate where multiple questions really just measure one thing
    • In contrast, with PCA, the features are actually being combined to model the data

Wrap up:

  • Logistic regression for churn
  • Survival analysis to prevent churn
  • Principal component analysis (PCA) to reduce multicollinearity

Example code includes:

load("./RInputFiles/newsData.RData")

rawData <- newsData
newsData <- newsData[, c('n_tokens_title', 'n_tokens_content', 'n_unique_tokens', 'num_hrefs', 'num_self_hrefs', 'num_imgs', 'num_videos', 'num_keywords', 'is_weekend', 'kw_avg_min', 'kw_avg_avg', 'kw_avg_max', 'average_token_length', 'global_subjectivity', 'global_sentiment_polarity', 'global_rate_positive_words', 'global_rate_negative_words', 'avg_positive_polarity', 'avg_negative_polarity', 'title_subjectivity', 'title_sentiment_polarity')]


# Overview of data structure:
str(newsData, give.attr = FALSE)
## Classes 'tbl_df', 'tbl' and 'data.frame':    39644 obs. of  21 variables:
##  $ n_tokens_title            : num  12 9 9 9 13 10 8 12 11 10 ...
##  $ n_tokens_content          : num  219 255 211 531 1072 ...
##  $ n_unique_tokens           : num  0.664 0.605 0.575 0.504 0.416 ...
##  $ num_hrefs                 : num  4 3 3 9 19 2 21 20 2 4 ...
##  $ num_self_hrefs            : num  2 1 1 0 19 2 20 20 0 1 ...
##  $ num_imgs                  : num  1 1 1 1 20 0 20 20 0 1 ...
##  $ num_videos                : num  0 0 0 0 0 0 0 0 0 1 ...
##  $ num_keywords              : num  5 4 6 7 7 9 10 9 7 5 ...
##  $ is_weekend                : num  0 0 0 0 0 0 0 0 0 0 ...
##  $ kw_avg_min                : num  0 0 0 0 0 0 0 0 0 0 ...
##  $ kw_avg_avg                : num  0 0 0 0 0 0 0 0 0 0 ...
##  $ kw_avg_max                : num  0 0 0 0 0 0 0 0 0 0 ...
##  $ average_token_length      : num  4.68 4.91 4.39 4.4 4.68 ...
##  $ global_subjectivity       : num  0.522 0.341 0.702 0.43 0.514 ...
##  $ global_sentiment_polarity : num  0.0926 0.1489 0.3233 0.1007 0.281 ...
##  $ global_rate_positive_words: num  0.0457 0.0431 0.0569 0.0414 0.0746 ...
##  $ global_rate_negative_words: num  0.0137 0.01569 0.00948 0.02072 0.01213 ...
##  $ avg_positive_polarity     : num  0.379 0.287 0.496 0.386 0.411 ...
##  $ avg_negative_polarity     : num  -0.35 -0.119 -0.467 -0.37 -0.22 ...
##  $ title_subjectivity        : num  0.5 0 0 0 0.455 ...
##  $ title_sentiment_polarity  : num  -0.188 0 0 0 0.136 ...
# Correlation structure:
newsData %>% cor() %>% corrplot::corrplot()

# Standardize data
newsData <- newsData %>% scale() %>% as.data.frame()

# Compute PCA
pcaNews <- newsData %>% prcomp()

# Eigenvalues
pcaNews$sdev**2
##  [1] 3.31015107 2.00241491 1.82662819 1.67421238 1.30249854 1.20443028
##  [7] 1.02889482 1.00052438 0.97929267 0.95905061 0.82676492 0.74951891
## [13] 0.73162009 0.66351863 0.62319656 0.57949073 0.47020594 0.41516936
## [19] 0.29926492 0.27690363 0.07624847
# Screeplot:
screeplot(pcaNews, type = "lines")

# Cumulative explained variance:
summary(pcaNews)
## Importance of components:
##                           PC1     PC2     PC3     PC4     PC5     PC6
## Standard deviation     1.8194 1.41507 1.35153 1.29391 1.14127 1.09747
## Proportion of Variance 0.1576 0.09535 0.08698 0.07972 0.06202 0.05735
## Cumulative Proportion  0.1576 0.25298 0.33996 0.41969 0.48171 0.53906
##                            PC7     PC8     PC9    PC10    PC11    PC12
## Standard deviation     1.01434 1.00026 0.98959 0.97931 0.90927 0.86575
## Proportion of Variance 0.04899 0.04764 0.04663 0.04567 0.03937 0.03569
## Cumulative Proportion  0.58806 0.63570 0.68234 0.72800 0.76737 0.80307
##                           PC13   PC14    PC15    PC16    PC17    PC18
## Standard deviation     0.85535 0.8146 0.78943 0.76124 0.68572 0.64434
## Proportion of Variance 0.03484 0.0316 0.02968 0.02759 0.02239 0.01977
## Cumulative Proportion  0.83790 0.8695 0.89918 0.92677 0.94916 0.96893
##                           PC19    PC20    PC21
## Standard deviation     0.54705 0.52622 0.27613
## Proportion of Variance 0.01425 0.01319 0.00363
## Cumulative Proportion  0.98318 0.99637 1.00000
# Kaiser-Guttmann (number of components with eigenvalue larger than 1):
sum(pcaNews$sdev > 1)
## [1] 8
# Print loadings of the first six components
pcaNews$rotation[, 1:6] %>% round(2)
##                              PC1   PC2   PC3   PC4   PC5   PC6
## n_tokens_title             -0.05 -0.10  0.01 -0.10  0.20 -0.28
## n_tokens_content            0.23 -0.17 -0.38  0.12  0.15 -0.02
## n_unique_tokens             0.00  0.00  0.00  0.01  0.01  0.06
## num_hrefs                   0.26 -0.16 -0.42 -0.03  0.07  0.11
## num_self_hrefs              0.20 -0.07 -0.39  0.06  0.12  0.08
## num_imgs                    0.14 -0.15 -0.43 -0.06  0.04  0.08
## num_videos                  0.09 -0.20  0.04 -0.19  0.16 -0.14
## num_keywords                0.07  0.11 -0.25  0.14 -0.42 -0.30
## is_weekend                  0.05 -0.01 -0.12 -0.02 -0.10 -0.16
## kw_avg_min                  0.03  0.01 -0.05 -0.25 -0.65  0.07
## kw_avg_avg                  0.02 -0.15 -0.06 -0.61 -0.31  0.17
## kw_avg_max                 -0.10 -0.21  0.10 -0.50  0.35  0.26
## average_token_length        0.39 -0.02  0.19  0.19 -0.01  0.14
## global_subjectivity         0.45 -0.01  0.23 -0.04 -0.03  0.03
## global_sentiment_polarity   0.25  0.55 -0.03 -0.19  0.11  0.13
## global_rate_positive_words  0.33  0.25  0.14 -0.08  0.04 -0.09
## global_rate_negative_words  0.15 -0.47  0.23  0.11 -0.10 -0.21
## avg_positive_polarity       0.42  0.09  0.17 -0.06  0.02  0.10
## avg_negative_polarity      -0.25  0.37 -0.20 -0.04  0.08  0.06
## title_subjectivity          0.07 -0.03  0.01 -0.27  0.07 -0.61
## title_sentiment_polarity    0.07  0.24 -0.11 -0.24  0.15 -0.42
pcaNews %>% biplot(choices=1:2, cex = 0.5)

# Predict log shares with all original variables
logShares <- rawData %>%
    select(shares) %>%
    mutate(logShares=log(1+shares)) %>%
    pull(logShares) %>%
    scale()

newsData <- newsData %>%
    cbind(logShares)

mod1 <- lm(logShares ~ ., data = newsData)

# Create dataframe with log shares and first 6 components
dataNewsComponents <- cbind(logShares = newsData[, "logShares"], pcaNews$x[, 1:6]) %>%
  as.data.frame()

# Predict log shares with first six components
mod2 <- lm(logShares ~ ., data = dataNewsComponents)

# Print adjusted R squared for both models
summary(mod1)$adj.r.squared
## [1] 0.07954578
summary(mod2)$adj.r.squared
## [1] 0.05066316

Interactive Maps with leaflet in R

Chapter 1 - Setting Up Interactive Web Maps

Introduction to leaflet - open-source JavaScript library that makes interactive, mobile-friendly maps:

  • Objective for this course is to build up to an interactive map of 4-year colleges, including incorporation type (public, private, etc.)
    • Additionally, labels that occur when hovering
  • Leaflet builds maps using tiles, which join many smaller maps together
    • library(leaflet)
    • leaflet() %>% addTiles() # zooming and scrolling lead to new tiles being shown
  • In Chapter 1, will use multiple tile types to create maps of the DataCamp HQ in Belgium and Boston
    • leaflet() %>% addProviderTiles(“CartoDB”) %>% addMarkers(lng = dc_hq\(lon, lat = dc_hq\)lat, popup = dc_hq$hq)

Map tiles - over 100 pre-canned maps that are available as bases:

  • Selecting a base map - consider the intended purpose of the map, and ensure that the maps selected meet that purpose
    • Instructor has a preference for gray-scale maps (for ease of seeing other data)
  • The base maps are stored as “providers” - most are available for immediate use, but a few require registration
    • names(providers) # get all the available providers
    • names(providers)[str_detect(names(providers), “OpenStreetMap”)] # all from OpenStreetMap
    • leaflet() %>% # addTiles() addProviderTiles(“OpenStreetMap.BlackAndWhite”) # replace the default with the BW OpenStreetMap

Setting the default map view:

  • Can load the map centered on a specific point and with a requested zoom level - coomon to use ggmap::geocode()
    • ggmap::geocode(“350 5th Ave, New York, NY 10118”) # will return the lat-lon where possible (uses google API unless source=“dsk” is chosen)
  • Can use either setView() or fitBounds()
    • leaflet() %>% addTiles() %>% setView(lng = -73.98575, lat = 40.74856, zoom = 13) # setView picks a lat/lon and zoom
    • leaflet() %>% addTiles() %>% fitBounds( lng1 = -73.910, lat1 = 40.773, lng2 = -74.060, lat2 = 40.723) # fitBounds defines a rectangle
  • Can limit user controls such as panning and zooming
    • leaflet(options = leafletOptions(dragging = FALSE, minZoom = 14, maxZoom = 18)) %>% addProviderTiles(“CartoDB”) %>% setView(lng = -73.98575, lat = 40.74856, zoom = 18)
    • dragging=FALSE removes the ability to pan
    • maxZoom and minZoom limit the options for zooming
    • leaflet() %>% addTiles() %>% setView(lng = -73.98575, lat = 40.74856, zoom = 18) %>% setMaxBounds(lng1 = -73.98575, lat1 = 40.74856, lng2 = -73.98575, lat2 = 40.74856)
    • setMaxBounds() limits the user to the boundaries that you pre-specify
  • For more information, can go to

Plotting DataCamp HQ:

  • Location markers are a common addition, managed using addMarkers()
    • leaflet() %>% addTiles() %>% addMarkers(lng = -73.98575, lat = 40.74856)
    • If single vectors are passed to lng and lat, then a single blue pin will be placed and the map will be centered/zoomed there
    • dc_hq <- tibble( hq = c(“DataCamp - NYC”, “DataCamp - Belgium”), lon = c(-73.98575, 4.717863), lat = c(40.74856, 50.881363))
    • leaflet() %>% addTiles() %>% addMarkers(lng = dc_hq\(lon, lat = dc_hq\)lat)
    • When the tibble is passed, then the map will be zoomed/centered such that all the pins can be displayed dc_hq %>% leaflet() %>% addTiles() %>% addMarkers()
    • The functions will seek a lat and lon column from the piped in data (dc_hq in this case), and pass along a note that they were used
  • Pop-ups are a common way to provide additional information about a marker
    • leaflet() %>% addTiles() %>% addMarkers(lng = dc_hq\(lon, lat = dc_hq\)lat, popup = dc_hq$hq) # markers, with popup enabled on clicking
    • leaflet() %>% addTiles() %>% addPopups(lng = dc_hq\(lon, lat = dc_hq\)lat, popup = dc_hq$hq) # popups instead of markers
  • Leaflets can be stored as objects (similar to ggplot2), with additions and prints and whatnot called later

Example code includes:

# Load the leaflet library
library(leaflet)
## 
## Attaching package: 'leaflet'
## The following object is masked from 'package:xts':
## 
##     addLegend
# Create a leaflet map with default map tile using addTiles()
leaflet() %>%
    addTiles()
# Print the providers list included in the leaflet library
providers
## $OpenStreetMap
## [1] "OpenStreetMap"
## 
## $OpenStreetMap.Mapnik
## [1] "OpenStreetMap.Mapnik"
## 
## $OpenStreetMap.BlackAndWhite
## [1] "OpenStreetMap.BlackAndWhite"
## 
## $OpenStreetMap.DE
## [1] "OpenStreetMap.DE"
## 
## $OpenStreetMap.CH
## [1] "OpenStreetMap.CH"
## 
## $OpenStreetMap.France
## [1] "OpenStreetMap.France"
## 
## $OpenStreetMap.HOT
## [1] "OpenStreetMap.HOT"
## 
## $OpenStreetMap.BZH
## [1] "OpenStreetMap.BZH"
## 
## $OpenInfraMap
## [1] "OpenInfraMap"
## 
## $OpenInfraMap.Power
## [1] "OpenInfraMap.Power"
## 
## $OpenInfraMap.Telecom
## [1] "OpenInfraMap.Telecom"
## 
## $OpenInfraMap.Petroleum
## [1] "OpenInfraMap.Petroleum"
## 
## $OpenInfraMap.Water
## [1] "OpenInfraMap.Water"
## 
## $OpenSeaMap
## [1] "OpenSeaMap"
## 
## $OpenPtMap
## [1] "OpenPtMap"
## 
## $OpenTopoMap
## [1] "OpenTopoMap"
## 
## $OpenRailwayMap
## [1] "OpenRailwayMap"
## 
## $OpenFireMap
## [1] "OpenFireMap"
## 
## $SafeCast
## [1] "SafeCast"
## 
## $Thunderforest
## [1] "Thunderforest"
## 
## $Thunderforest.OpenCycleMap
## [1] "Thunderforest.OpenCycleMap"
## 
## $Thunderforest.Transport
## [1] "Thunderforest.Transport"
## 
## $Thunderforest.TransportDark
## [1] "Thunderforest.TransportDark"
## 
## $Thunderforest.SpinalMap
## [1] "Thunderforest.SpinalMap"
## 
## $Thunderforest.Landscape
## [1] "Thunderforest.Landscape"
## 
## $Thunderforest.Outdoors
## [1] "Thunderforest.Outdoors"
## 
## $Thunderforest.Pioneer
## [1] "Thunderforest.Pioneer"
## 
## $OpenMapSurfer
## [1] "OpenMapSurfer"
## 
## $OpenMapSurfer.Roads
## [1] "OpenMapSurfer.Roads"
## 
## $OpenMapSurfer.AdminBounds
## [1] "OpenMapSurfer.AdminBounds"
## 
## $OpenMapSurfer.Grayscale
## [1] "OpenMapSurfer.Grayscale"
## 
## $Hydda
## [1] "Hydda"
## 
## $Hydda.Full
## [1] "Hydda.Full"
## 
## $Hydda.Base
## [1] "Hydda.Base"
## 
## $Hydda.RoadsAndLabels
## [1] "Hydda.RoadsAndLabels"
## 
## $MapBox
## [1] "MapBox"
## 
## $Stamen
## [1] "Stamen"
## 
## $Stamen.Toner
## [1] "Stamen.Toner"
## 
## $Stamen.TonerBackground
## [1] "Stamen.TonerBackground"
## 
## $Stamen.TonerHybrid
## [1] "Stamen.TonerHybrid"
## 
## $Stamen.TonerLines
## [1] "Stamen.TonerLines"
## 
## $Stamen.TonerLabels
## [1] "Stamen.TonerLabels"
## 
## $Stamen.TonerLite
## [1] "Stamen.TonerLite"
## 
## $Stamen.Watercolor
## [1] "Stamen.Watercolor"
## 
## $Stamen.Terrain
## [1] "Stamen.Terrain"
## 
## $Stamen.TerrainBackground
## [1] "Stamen.TerrainBackground"
## 
## $Stamen.TopOSMRelief
## [1] "Stamen.TopOSMRelief"
## 
## $Stamen.TopOSMFeatures
## [1] "Stamen.TopOSMFeatures"
## 
## $Esri
## [1] "Esri"
## 
## $Esri.WorldStreetMap
## [1] "Esri.WorldStreetMap"
## 
## $Esri.DeLorme
## [1] "Esri.DeLorme"
## 
## $Esri.WorldTopoMap
## [1] "Esri.WorldTopoMap"
## 
## $Esri.WorldImagery
## [1] "Esri.WorldImagery"
## 
## $Esri.WorldTerrain
## [1] "Esri.WorldTerrain"
## 
## $Esri.WorldShadedRelief
## [1] "Esri.WorldShadedRelief"
## 
## $Esri.WorldPhysical
## [1] "Esri.WorldPhysical"
## 
## $Esri.OceanBasemap
## [1] "Esri.OceanBasemap"
## 
## $Esri.NatGeoWorldMap
## [1] "Esri.NatGeoWorldMap"
## 
## $Esri.WorldGrayCanvas
## [1] "Esri.WorldGrayCanvas"
## 
## $OpenWeatherMap
## [1] "OpenWeatherMap"
## 
## $OpenWeatherMap.Clouds
## [1] "OpenWeatherMap.Clouds"
## 
## $OpenWeatherMap.CloudsClassic
## [1] "OpenWeatherMap.CloudsClassic"
## 
## $OpenWeatherMap.Precipitation
## [1] "OpenWeatherMap.Precipitation"
## 
## $OpenWeatherMap.PrecipitationClassic
## [1] "OpenWeatherMap.PrecipitationClassic"
## 
## $OpenWeatherMap.Rain
## [1] "OpenWeatherMap.Rain"
## 
## $OpenWeatherMap.RainClassic
## [1] "OpenWeatherMap.RainClassic"
## 
## $OpenWeatherMap.Pressure
## [1] "OpenWeatherMap.Pressure"
## 
## $OpenWeatherMap.PressureContour
## [1] "OpenWeatherMap.PressureContour"
## 
## $OpenWeatherMap.Wind
## [1] "OpenWeatherMap.Wind"
## 
## $OpenWeatherMap.Temperature
## [1] "OpenWeatherMap.Temperature"
## 
## $OpenWeatherMap.Snow
## [1] "OpenWeatherMap.Snow"
## 
## $HERE
## [1] "HERE"
## 
## $HERE.normalDay
## [1] "HERE.normalDay"
## 
## $HERE.normalDayCustom
## [1] "HERE.normalDayCustom"
## 
## $HERE.normalDayGrey
## [1] "HERE.normalDayGrey"
## 
## $HERE.normalDayMobile
## [1] "HERE.normalDayMobile"
## 
## $HERE.normalDayGreyMobile
## [1] "HERE.normalDayGreyMobile"
## 
## $HERE.normalDayTransit
## [1] "HERE.normalDayTransit"
## 
## $HERE.normalDayTransitMobile
## [1] "HERE.normalDayTransitMobile"
## 
## $HERE.normalNight
## [1] "HERE.normalNight"
## 
## $HERE.normalNightMobile
## [1] "HERE.normalNightMobile"
## 
## $HERE.normalNightGrey
## [1] "HERE.normalNightGrey"
## 
## $HERE.normalNightGreyMobile
## [1] "HERE.normalNightGreyMobile"
## 
## $HERE.basicMap
## [1] "HERE.basicMap"
## 
## $HERE.mapLabels
## [1] "HERE.mapLabels"
## 
## $HERE.trafficFlow
## [1] "HERE.trafficFlow"
## 
## $HERE.carnavDayGrey
## [1] "HERE.carnavDayGrey"
## 
## $HERE.hybridDay
## [1] "HERE.hybridDay"
## 
## $HERE.hybridDayMobile
## [1] "HERE.hybridDayMobile"
## 
## $HERE.pedestrianDay
## [1] "HERE.pedestrianDay"
## 
## $HERE.pedestrianNight
## [1] "HERE.pedestrianNight"
## 
## $HERE.satelliteDay
## [1] "HERE.satelliteDay"
## 
## $HERE.terrainDay
## [1] "HERE.terrainDay"
## 
## $HERE.terrainDayMobile
## [1] "HERE.terrainDayMobile"
## 
## $FreeMapSK
## [1] "FreeMapSK"
## 
## $MtbMap
## [1] "MtbMap"
## 
## $CartoDB
## [1] "CartoDB"
## 
## $CartoDB.Positron
## [1] "CartoDB.Positron"
## 
## $CartoDB.PositronNoLabels
## [1] "CartoDB.PositronNoLabels"
## 
## $CartoDB.PositronOnlyLabels
## [1] "CartoDB.PositronOnlyLabels"
## 
## $CartoDB.DarkMatter
## [1] "CartoDB.DarkMatter"
## 
## $CartoDB.DarkMatterNoLabels
## [1] "CartoDB.DarkMatterNoLabels"
## 
## $CartoDB.DarkMatterOnlyLabels
## [1] "CartoDB.DarkMatterOnlyLabels"
## 
## $HikeBike
## [1] "HikeBike"
## 
## $HikeBike.HikeBike
## [1] "HikeBike.HikeBike"
## 
## $HikeBike.HillShading
## [1] "HikeBike.HillShading"
## 
## $BasemapAT
## [1] "BasemapAT"
## 
## $BasemapAT.basemap
## [1] "BasemapAT.basemap"
## 
## $BasemapAT.grau
## [1] "BasemapAT.grau"
## 
## $BasemapAT.overlay
## [1] "BasemapAT.overlay"
## 
## $BasemapAT.highdpi
## [1] "BasemapAT.highdpi"
## 
## $BasemapAT.orthofoto
## [1] "BasemapAT.orthofoto"
## 
## $nlmaps
## [1] "nlmaps"
## 
## $nlmaps.standaard
## [1] "nlmaps.standaard"
## 
## $nlmaps.pastel
## [1] "nlmaps.pastel"
## 
## $nlmaps.grijs
## [1] "nlmaps.grijs"
## 
## $nlmaps.luchtfoto
## [1] "nlmaps.luchtfoto"
## 
## $NASAGIBS
## [1] "NASAGIBS"
## 
## $NASAGIBS.ModisTerraTrueColorCR
## [1] "NASAGIBS.ModisTerraTrueColorCR"
## 
## $NASAGIBS.ModisTerraBands367CR
## [1] "NASAGIBS.ModisTerraBands367CR"
## 
## $NASAGIBS.ViirsEarthAtNight2012
## [1] "NASAGIBS.ViirsEarthAtNight2012"
## 
## $NASAGIBS.ModisTerraLSTDay
## [1] "NASAGIBS.ModisTerraLSTDay"
## 
## $NASAGIBS.ModisTerraSnowCover
## [1] "NASAGIBS.ModisTerraSnowCover"
## 
## $NASAGIBS.ModisTerraAOD
## [1] "NASAGIBS.ModisTerraAOD"
## 
## $NASAGIBS.ModisTerraChlorophyll
## [1] "NASAGIBS.ModisTerraChlorophyll"
## 
## $NLS
## [1] "NLS"
## 
## $JusticeMap
## [1] "JusticeMap"
## 
## $JusticeMap.income
## [1] "JusticeMap.income"
## 
## $JusticeMap.americanIndian
## [1] "JusticeMap.americanIndian"
## 
## $JusticeMap.asian
## [1] "JusticeMap.asian"
## 
## $JusticeMap.black
## [1] "JusticeMap.black"
## 
## $JusticeMap.hispanic
## [1] "JusticeMap.hispanic"
## 
## $JusticeMap.multi
## [1] "JusticeMap.multi"
## 
## $JusticeMap.nonWhite
## [1] "JusticeMap.nonWhite"
## 
## $JusticeMap.white
## [1] "JusticeMap.white"
## 
## $JusticeMap.plurality
## [1] "JusticeMap.plurality"
## 
## $Wikimedia
## [1] "Wikimedia"
# Print only the names of the map tiles in the providers list 
names(providers)
##   [1] "OpenStreetMap"                      
##   [2] "OpenStreetMap.Mapnik"               
##   [3] "OpenStreetMap.BlackAndWhite"        
##   [4] "OpenStreetMap.DE"                   
##   [5] "OpenStreetMap.CH"                   
##   [6] "OpenStreetMap.France"               
##   [7] "OpenStreetMap.HOT"                  
##   [8] "OpenStreetMap.BZH"                  
##   [9] "OpenInfraMap"                       
##  [10] "OpenInfraMap.Power"                 
##  [11] "OpenInfraMap.Telecom"               
##  [12] "OpenInfraMap.Petroleum"             
##  [13] "OpenInfraMap.Water"                 
##  [14] "OpenSeaMap"                         
##  [15] "OpenPtMap"                          
##  [16] "OpenTopoMap"                        
##  [17] "OpenRailwayMap"                     
##  [18] "OpenFireMap"                        
##  [19] "SafeCast"                           
##  [20] "Thunderforest"                      
##  [21] "Thunderforest.OpenCycleMap"         
##  [22] "Thunderforest.Transport"            
##  [23] "Thunderforest.TransportDark"        
##  [24] "Thunderforest.SpinalMap"            
##  [25] "Thunderforest.Landscape"            
##  [26] "Thunderforest.Outdoors"             
##  [27] "Thunderforest.Pioneer"              
##  [28] "OpenMapSurfer"                      
##  [29] "OpenMapSurfer.Roads"                
##  [30] "OpenMapSurfer.AdminBounds"          
##  [31] "OpenMapSurfer.Grayscale"            
##  [32] "Hydda"                              
##  [33] "Hydda.Full"                         
##  [34] "Hydda.Base"                         
##  [35] "Hydda.RoadsAndLabels"               
##  [36] "MapBox"                             
##  [37] "Stamen"                             
##  [38] "Stamen.Toner"                       
##  [39] "Stamen.TonerBackground"             
##  [40] "Stamen.TonerHybrid"                 
##  [41] "Stamen.TonerLines"                  
##  [42] "Stamen.TonerLabels"                 
##  [43] "Stamen.TonerLite"                   
##  [44] "Stamen.Watercolor"                  
##  [45] "Stamen.Terrain"                     
##  [46] "Stamen.TerrainBackground"           
##  [47] "Stamen.TopOSMRelief"                
##  [48] "Stamen.TopOSMFeatures"              
##  [49] "Esri"                               
##  [50] "Esri.WorldStreetMap"                
##  [51] "Esri.DeLorme"                       
##  [52] "Esri.WorldTopoMap"                  
##  [53] "Esri.WorldImagery"                  
##  [54] "Esri.WorldTerrain"                  
##  [55] "Esri.WorldShadedRelief"             
##  [56] "Esri.WorldPhysical"                 
##  [57] "Esri.OceanBasemap"                  
##  [58] "Esri.NatGeoWorldMap"                
##  [59] "Esri.WorldGrayCanvas"               
##  [60] "OpenWeatherMap"                     
##  [61] "OpenWeatherMap.Clouds"              
##  [62] "OpenWeatherMap.CloudsClassic"       
##  [63] "OpenWeatherMap.Precipitation"       
##  [64] "OpenWeatherMap.PrecipitationClassic"
##  [65] "OpenWeatherMap.Rain"                
##  [66] "OpenWeatherMap.RainClassic"         
##  [67] "OpenWeatherMap.Pressure"            
##  [68] "OpenWeatherMap.PressureContour"     
##  [69] "OpenWeatherMap.Wind"                
##  [70] "OpenWeatherMap.Temperature"         
##  [71] "OpenWeatherMap.Snow"                
##  [72] "HERE"                               
##  [73] "HERE.normalDay"                     
##  [74] "HERE.normalDayCustom"               
##  [75] "HERE.normalDayGrey"                 
##  [76] "HERE.normalDayMobile"               
##  [77] "HERE.normalDayGreyMobile"           
##  [78] "HERE.normalDayTransit"              
##  [79] "HERE.normalDayTransitMobile"        
##  [80] "HERE.normalNight"                   
##  [81] "HERE.normalNightMobile"             
##  [82] "HERE.normalNightGrey"               
##  [83] "HERE.normalNightGreyMobile"         
##  [84] "HERE.basicMap"                      
##  [85] "HERE.mapLabels"                     
##  [86] "HERE.trafficFlow"                   
##  [87] "HERE.carnavDayGrey"                 
##  [88] "HERE.hybridDay"                     
##  [89] "HERE.hybridDayMobile"               
##  [90] "HERE.pedestrianDay"                 
##  [91] "HERE.pedestrianNight"               
##  [92] "HERE.satelliteDay"                  
##  [93] "HERE.terrainDay"                    
##  [94] "HERE.terrainDayMobile"              
##  [95] "FreeMapSK"                          
##  [96] "MtbMap"                             
##  [97] "CartoDB"                            
##  [98] "CartoDB.Positron"                   
##  [99] "CartoDB.PositronNoLabels"           
## [100] "CartoDB.PositronOnlyLabels"         
## [101] "CartoDB.DarkMatter"                 
## [102] "CartoDB.DarkMatterNoLabels"         
## [103] "CartoDB.DarkMatterOnlyLabels"       
## [104] "HikeBike"                           
## [105] "HikeBike.HikeBike"                  
## [106] "HikeBike.HillShading"               
## [107] "BasemapAT"                          
## [108] "BasemapAT.basemap"                  
## [109] "BasemapAT.grau"                     
## [110] "BasemapAT.overlay"                  
## [111] "BasemapAT.highdpi"                  
## [112] "BasemapAT.orthofoto"                
## [113] "nlmaps"                             
## [114] "nlmaps.standaard"                   
## [115] "nlmaps.pastel"                      
## [116] "nlmaps.grijs"                       
## [117] "nlmaps.luchtfoto"                   
## [118] "NASAGIBS"                           
## [119] "NASAGIBS.ModisTerraTrueColorCR"     
## [120] "NASAGIBS.ModisTerraBands367CR"      
## [121] "NASAGIBS.ViirsEarthAtNight2012"     
## [122] "NASAGIBS.ModisTerraLSTDay"          
## [123] "NASAGIBS.ModisTerraSnowCover"       
## [124] "NASAGIBS.ModisTerraAOD"             
## [125] "NASAGIBS.ModisTerraChlorophyll"     
## [126] "NLS"                                
## [127] "JusticeMap"                         
## [128] "JusticeMap.income"                  
## [129] "JusticeMap.americanIndian"          
## [130] "JusticeMap.asian"                   
## [131] "JusticeMap.black"                   
## [132] "JusticeMap.hispanic"                
## [133] "JusticeMap.multi"                   
## [134] "JusticeMap.nonWhite"                
## [135] "JusticeMap.white"                   
## [136] "JusticeMap.plurality"               
## [137] "Wikimedia"
# Use str_detect() to determine if the name of each provider tile contains the string "CartoDB"
str_detect(names(providers), "CartoDB")
##   [1] FALSE FALSE FALSE FALSE FALSE FALSE FALSE FALSE FALSE FALSE FALSE
##  [12] FALSE FALSE FALSE FALSE FALSE FALSE FALSE FALSE FALSE FALSE FALSE
##  [23] FALSE FALSE FALSE FALSE FALSE FALSE FALSE FALSE FALSE FALSE FALSE
##  [34] FALSE FALSE FALSE FALSE FALSE FALSE FALSE FALSE FALSE FALSE FALSE
##  [45] FALSE FALSE FALSE FALSE FALSE FALSE FALSE FALSE FALSE FALSE FALSE
##  [56] FALSE FALSE FALSE FALSE FALSE FALSE FALSE FALSE FALSE FALSE FALSE
##  [67] FALSE FALSE FALSE FALSE FALSE FALSE FALSE FALSE FALSE FALSE FALSE
##  [78] FALSE FALSE FALSE FALSE FALSE FALSE FALSE FALSE FALSE FALSE FALSE
##  [89] FALSE FALSE FALSE FALSE FALSE FALSE FALSE FALSE  TRUE  TRUE  TRUE
## [100]  TRUE  TRUE  TRUE  TRUE FALSE FALSE FALSE FALSE FALSE FALSE FALSE
## [111] FALSE FALSE FALSE FALSE FALSE FALSE FALSE FALSE FALSE FALSE FALSE
## [122] FALSE FALSE FALSE FALSE FALSE FALSE FALSE FALSE FALSE FALSE FALSE
## [133] FALSE FALSE FALSE FALSE FALSE
# Use str_detect() to print only the provider tile names that include the string "CartoDB"
names(providers)[str_detect(names(providers), "CartoDB")]
## [1] "CartoDB"                      "CartoDB.Positron"            
## [3] "CartoDB.PositronNoLabels"     "CartoDB.PositronOnlyLabels"  
## [5] "CartoDB.DarkMatter"           "CartoDB.DarkMatterNoLabels"  
## [7] "CartoDB.DarkMatterOnlyLabels"
# Change addTiles() to addProviderTiles() and set the provider argument to "CartoDB"
leaflet() %>% 
    addProviderTiles("CartoDB")
# Create a leaflet map that uses the Esri provider tile 
leaflet() %>% 
    addProviderTiles("Esri")
# Create a leaflet map that uses the CartoDB.PositronNoLabels provider tile
leaflet() %>% 
    addProviderTiles("CartoDB.PositronNoLabels")
# Map with CartoDB tile centered on DataCamp's NYC office with zoom of 6
leaflet()  %>% 
    addProviderTiles("CartoDB")  %>% 
    setView(lng = -73.98575, lat = 40.74856, zoom = 6)
dc_hq <- tibble::tibble(hq=c("NYC", "Belgium"), lon=c(-73.98575, 4.71786), lat=c(40.7486, 50.8814))
dc_hq
## # A tibble: 2 x 3
##   hq         lon   lat
##   <chr>    <dbl> <dbl>
## 1 NYC     -74.0   40.7
## 2 Belgium   4.72  50.9
# Map with CartoDB.PositronNoLabels tile centered on DataCamp's Belgium office with zoom of 4
leaflet() %>% 
    addProviderTiles("CartoDB.PositronNoLabels") %>% 
    setView(lng = dc_hq$lon[2], lat = dc_hq$lat[2], zoom = 4)
leaflet(options = leafletOptions(
                    # Set minZoom and dragging 
                    minZoom = 12, dragging = TRUE))  %>% 
  addProviderTiles("CartoDB")  %>% 
  # Set default zoom level 
  setView(lng = dc_hq$lon[2], lat = dc_hq$lat[2], zoom = 14) %>% 
  # Set max bounds of map 
  setMaxBounds(lng1 = dc_hq$lon[2] + 0.05, 
               lat1 = dc_hq$lat[2] + .05, 
               lng2 = dc_hq$lon[2] - 0.05, 
               lat2 = dc_hq$lat[2] - .05) 
# Plot DataCamp's NYC HQ
leaflet() %>% 
    addProviderTiles("CartoDB") %>% 
    addMarkers(lng = dc_hq$lon[1], lat = dc_hq$lat[1])
# Plot DataCamp's NYC HQ with zoom of 12    
leaflet() %>% 
    addProviderTiles("CartoDB") %>% 
    addMarkers(lng = -73.98575, lat = 40.74856)  %>% 
    setView(lng = -73.98575, lat = 40.74856, zoom = 12)    
# Plot both DataCamp's NYC and Belgium locations
leaflet() %>% 
    addProviderTiles("CartoDB") %>% 
    addMarkers(lng = dc_hq$lon, lat = dc_hq$lat)
# Store leaflet hq map in an object called map
map <- leaflet() %>% 
    addProviderTiles("CartoDB") %>% 
    # add hq column of dc_hq as popups
    addMarkers(lng = dc_hq$lon, lat = dc_hq$lat, 
               popup = dc_hq$hq
               )

# Center the view of map on the Belgium HQ with a zoom of 5  
map_zoom <- map %>% 
      setView(lat = 50.881363, lng = 4.717863, zoom = 5)

# Print map_zoom
map_zoom

Chapter 2 - Plotting points

Introduction to IPEDS Data:

  • Can clear the boundaries of a map, while keeping everything else (data and the like) constant
    • m %>% clearBounds() # kills the bounds layers
    • m %>% clearBounds() %>% clearMarkers() # kills the markers layers
  • The IPEDS data is the Integrated Post-Secondary Education dataset - this course uses a subset consisting of 4-year colleges
    • Goal is to create a subset of the IPEDS data consisting of the ~300 colleges in California
    • Can then plot and color-code the California colleges

Mapping California colleges:

  • Clustered markers are poorly shown by pins due to obscuring
  • A nice alternative is to use circle markers, which have much less tendency for overlaps
    • maine_colleges_map %>% clearMarkers() %>% addCircleMarkers(data = maine, radius = 3)
    • maine_colleges_map %>% addCircleMarkers( data = maine_colleges, radius = 4, color = “red”, popup = ~name) # custom color and radius while maintaining popups

Labels and pop-ups:

  • Can use piping as well as the tilde, which allows for referring to key variables in the piped in data
    • ipeds %>% leaflet() %>% addProviderTiles(“CartoDB”) %>% addCircleMarkers( lng = ~lng, lat = ~lat, popup = ~name, color = “#FF0000”)
    • Colors can be specified using hexadecimal, as shown in the example above - can find these using google and color sliders
  • Can build better popups using pipes and tildes
    • addCircleMarkers(popup = ~paste0(name, “-”, sector_label)
    • addCircleMarkers(popup = ~paste0(“”,name,“”,“
      ”,sector_label)) # enhanced with html tags
  • Labels provide similar information as pop-ups, but require only a hover rather than a click
    • ipeds %>% leaflet() %>% addProviderTiles(“CartoDB”) %>% addCircleMarkers(label = ~name, radius = 2)

Color coding colleges:

  • Can include differential colors depending on a variables that has been piped in using colorFactor()
    • OR <- ipeds %>% filter(state == “OR”)
    • pal <- colorFactor(palette = c(“red”, “blue”, “#9b4a11”), levels = c(“Public”, “Private”, “For-Profit”)) # create the color palette for future use
    • oregon_colleges <- OR %>% leaflet() %>% addProviderTiles(“CartoDB”) %>% addCircleMarkers(radius = 2, color = ~pal(sector_label), label = ~name) # apply as pal()
    • oregon_colleges %>% addLegend(position = “bottomright”, pal = pal, values = c(“Public”, “Private”, “For-Profit”)) # add to legend
  • Can instead color based on a numeric value using colorNumeric()
    • admit <- admit %>% filter(!is.na(rate), rate < 50, rate > 0) # filer for rates that exist and are between 0 and 50
    • pal <- colorNumeric(palette = “Reds”, domain = c(1:50), reverse = TRUE) # reverse=TRUE flips the gradient so that lower admit rates are darker red
    • admit_map <- admit %>% leaflet() %>% addProviderTiles(“CartoDB”) %>% addCircleMarkers(radius = 4, color = ~pal(rate), label = ~name) %>% addLegend(title = “Admit Rate”, pal = pal, values = c(1:50), position = “bottomright”)
  • Can use RColorBrewer for default color palettes
    • library(RColorBrewer)
    • display.brewer.all()

Example code includes:

# Remove markers, reset bounds, and store the updated map in the m object
map <- map %>%
    clearMarkers() %>% 
    clearBounds()

# Print the cleared map
map
ipedsRaw <- readr::read_csv("./RInputFiles/ipeds.csv")
## Parsed with column specification:
## cols(
##   name = col_character(),
##   lng = col_double(),
##   lat = col_double(),
##   state = col_character(),
##   sector_label = col_character()
## )
# Remove colleges with missing sector information
ipeds <- 
    ipedsRaw %>% 
    tidyr::drop_na()

# Count the number of four-year colleges in each state
ipeds %>% 
    group_by(state)  %>% 
    count()
## # A tibble: 56 x 2
## # Groups:   state [56]
##    state     n
##    <chr> <int>
##  1 AK        6
##  2 AL       45
##  3 AR       26
##  4 AS        1
##  5 AZ       50
##  6 CA      272
##  7 CO       53
##  8 CT       33
##  9 DC       18
## 10 DE        7
## # ... with 46 more rows
# Create a list of US States in descending order by the number of colleges in each state
ipeds  %>% 
    group_by(state)  %>% 
    count()  %>% 
    arrange(desc(n))
## # A tibble: 56 x 2
## # Groups:   state [56]
##    state     n
##    <chr> <int>
##  1 CA      272
##  2 NY      239
##  3 PA      164
##  4 FL      159
##  5 TX      154
##  6 OH      135
##  7 IL      119
##  8 MA      103
##  9 MO       87
## 10 MN       82
## # ... with 46 more rows
# Create a dataframe called `ca` with data on only colleges in California
ca <- ipeds %>%
    filter(state == "CA")

map <- leaflet() %>% 
    addProviderTiles("CartoDB")

# Use `addMarkers` to plot all of the colleges in `ca` on the `m` leaflet map
map %>%
    addMarkers(lng = ca$lng, lat = ca$lat)
la_coords <- data.frame(lat = 34.05223, lon = -118.2437) 

# Center the map on LA 
map %>% 
    addMarkers(data = ca) %>% 
    setView(lat = la_coords$lat, lng = la_coords$lon, zoom = 12)
## Assuming "lng" and "lat" are longitude and latitude, respectively
# Set the zoom level to 8 and store in the m object
map_zoom <-
    map %>%
    addMarkers(data = ca) %>%
    setView(lat = la_coords$lat, lng = la_coords$lon, zoom = 8)
## Assuming "lng" and "lat" are longitude and latitude, respectively
map_zoom
# Clear the markers from the map 
map2 <- map %>% clearMarkers()

# Use addCircleMarkers() to plot each college as a circle
map2 %>%
    addCircleMarkers(lng = ca$lng, lat = ca$lat)
# Change the radius of each circle to be 2 pixels and the color to red
map2 %>% 
    addCircleMarkers(lng = ca$lng, lat = ca$lat, radius = 2, color = "red")
# Add circle markers with popups for college names
map %>%
    addCircleMarkers(data = ca, radius = 2, popup = ~name)
## Assuming "lng" and "lat" are longitude and latitude, respectively
# Change circle color to #2cb42c and store map in map_color object
map_color <- map %>% 
    addCircleMarkers(data = ca, radius = 2, color = "#2cb42c", popup = ~name)
## Assuming "lng" and "lat" are longitude and latitude, respectively
# Print map_color
map_color
# Clear the bounds and markers on the map object and store in map2
map2 <- map %>% 
    clearBounds() %>% 
    clearMarkers()

# Add circle markers with popups that display both the institution name and sector
map2 %>% 
    addCircleMarkers(data = ca, radius = 2, 
                     popup = ~paste0(name, "<br/>", sector_label)
                     )
## Assuming "lng" and "lat" are longitude and latitude, respectively
# Make the institution name in each popup bold
map2 %>% 
    addCircleMarkers(data = ca, radius = 2, 
                     popup = ~paste0("<b>", name, "</b>", "<br/>", sector_label)
                     )
## Assuming "lng" and "lat" are longitude and latitude, respectively
# Add circle markers with labels identifying the name of each college
map %>% 
    addCircleMarkers(data = ca, radius = 2, label = ~name)
## Assuming "lng" and "lat" are longitude and latitude, respectively
# Use paste0 to add sector information to the label inside parentheses 
map %>% 
    addCircleMarkers(data = ca, radius = 2, label = ~paste0(name, " (", sector_label, ")"))
## Assuming "lng" and "lat" are longitude and latitude, respectively
# Make a color palette called pal for the values of `sector_label` using `colorFactor()`  
# Colors should be: "red", "blue", and "#9b4a11" for "Public", "Private", and "For-Profit" colleges, respectively
pal <- colorFactor(palette = c("red", "blue", "#9b4a11"), 
                   levels = c("Public", "Private", "For-Profit")
                   )

# Add circle markers that color colleges using pal() and the values of sector_label
map2 <- map %>% 
        addCircleMarkers(data = ca, radius = 2, 
                         color = ~pal(sector_label), 
                         label = ~paste0(name, " (", sector_label, ")")
                         )
## Assuming "lng" and "lat" are longitude and latitude, respectively
# Print map2
map2
# Add a legend that displays the colors used in pal
map2 %>% 
    addLegend(pal = pal, values = c("Public", "Private", "For-Profit"))
# Customize the legend
map2 %>% 
    addLegend(pal = pal, 
              values = c("Public", "Private", "For-Profit"),
              # opacity of .5, title of Sector, and position of topright
              opacity = 0.5, title = "Sector", position = "topright"
              )

Chapter 3 - Groups, Layers, Extras

Leaflet Extras Package:

  • The leaflet.extras package provides some nice extensibility to the baseline leaflet package
    • leaflet() %>% addTiles() %>% addSearchOSM() # searching open-source-maps (magnifying glass icon with search box)
    • leaflet() %>% addTiles() %>% addSearchOSM() %>% addReverseSearchOSM() # can also use geocode to find a click, as requested by addReverseSearchOSM()
    • leaflet() %>% addTiles() %>% addSearchOSM() %>% addReverseSearchOSM() %>% addResetMapButton() # can click “reset” to return to the default view

Overlay Groups - ability to control the segments that are displayed on the map:

  • One option is to segment the data in advance, then to add as layers using addCircleMarkers
    • ca_public <- ipeds %>% filter(sector == “Public”, state == “CA”)
    • m %>% addCircleMarkers( data = ca_public, group = “Public”)
  • After creating multiple calls for addCircleMarkers(), each with group=, can then activate the grouping
    • addLayersControl( overlayGroups = c(“Public”, “Private”, “For-Profit”))
  • Since the layers are stacked, the order in which they are added matters (they layer/stack on top of each other)

Base Groups - can provide multiple options for toggling (only one may be selected at a time):

  • Need to call addProviderTiles() once for each layer that is an option, then activate using addLayersControl()
    • a <- leaflet() %>% addTiles(group = “OSM”) %>% addProviderTiles(“CartoDB”, group = “Carto”) %>% addProviderTiles(“Esri”, group = “Esri”)
    • a %>% addLayersControl(baseGroups = c(“OSM”, “Carto”, “Esri”), position = “topleft”)
  • Can be handy to try a few different base groups during exploratory analysis, to find the base that best matches the rest of the analysis
  • Basic four-step process for building up the base groups includes
    • leaflet() %>% # initialize leaflet map
    • addTiles(group = “OSM”) %>% addProviderTiles(“CartoDB”, group = “Carto”) %>% addProviderTiles(“Esri”, group = “Esri”) %>% # add basemaps with groups
    • addCircleMarkers(data = public, radius = 2, label = ~htmlEscape(name), color = ~pal(sector_label), group = “Public”) %>% addCircleMarkers(data = private, radius = 2, label = ~htmlEscape(name), color = ~pal(sector_label), group = “Private”) %>% addCircleMarkers(data = profit, radius = 2, label = ~htmlEscape(name), color = ~pal(sector_label), group = “For-Profit”) %>% # add marker layer for each sector with corresponding group name
    • addLayersControl(baseGroups = c(“OSM”, “Carto”, “Esri”), overlayGroups = c(“Public”, “Private”, “For-Profit”)) # add layer controls for base and overlay groups

Pieces of Flair:

  • Can customize ths search function using leaflet.extra capability
    • ca_public <- ipeds %>% filter(sector_label == “Public”, state == “CA”)
    • ca_public %>% leaflet() %>% addProviderTiles(“Esri”) %>% addCircleMarkers(radius = 2, label = ~htmlEscape(name), color = ~pal(sector_label), group = “Public”) %>% addSearchFeatures(targetGroups = ‘Public’, options = searchFeaturesOptions(zoom = 10)) # will filter the search on Public data, with a specified zoom
  • Can cluster the colleges to improve readability of the maps
    • ipeds %>% leaflet() %>% addTiles() %>% addCircleMarkers(radius = 2, color = ~pal(sector_label), clusterOptions = markerClusterOptions()) # many colleges in one circle

Example code includes:

library(leaflet.extras)
library(htmltools)

leaflet() %>%
  addTiles() %>% 
  addSearchOSM() %>% 
  addReverseSearchOSM() 
m2 <- ipeds %>% 
    leaflet() %>% 
    # use the CartoDB provider tile
    addProviderTiles("CartoDB") %>% 
    # center on the middle of the US with zoom of 3
    setView(lat = 39.8282, lng = -98.5795, zoom=3)

# Map all American colleges 
m2 %>% 
    addCircleMarkers() 
## Assuming "lng" and "lat" are longitude and latitude, respectively
# Create data frame called public with only public colleges
public <- filter(ipeds, sector_label == "Public")  

# Create a leaflet map of public colleges called m3 
m3 <- leaflet() %>% 
    addProviderTiles("CartoDB") %>% 
    addCircleMarkers(data = public, radius = 2, label = ~htmlEscape(name), 
                     color = ~pal(sector_label), group = "Public"
                     )
## Assuming "lng" and "lat" are longitude and latitude, respectively
m3
# Create data frame called private with only private colleges
private <- filter(ipeds, sector_label == "Private")  

# Add private colleges to `m3` as a new layer
m3 <- m3 %>% 
    addCircleMarkers(data = private, radius = 2, label = ~htmlEscape(name), 
                     color = ~pal(sector_label), group = "Private"
                     ) %>% 
    addLayersControl(overlayGroups = c("Public", "Private"))
## Assuming "lng" and "lat" are longitude and latitude, respectively
m3
# Create data frame called profit with only for-profit colleges
profit <- filter(ipeds, sector_label == "For-Profit")  

# Add for-profit colleges to `m3` as a new layer
m3 <- m3 %>% 
    addCircleMarkers(data = profit, radius = 2, label = ~htmlEscape(name), 
                     color = ~pal(sector_label),   group = "For-Profit"
                     )  %>% 
    addLayersControl(overlayGroups = c("Public", "Private", "For-Profit"))  
## Assuming "lng" and "lat" are longitude and latitude, respectively
# Center the map on the middle of the US with a zoom of 4
m4 <- m3 %>%
    setView(lat = 39.8282, lng = -98.5795, zoom = 4) 
        
m4
leaflet() %>% 
  # Add the OSM, CartoDB and Esri tiles
  addTiles(group = "OSM") %>% 
  addProviderTiles("CartoDB", group = "Carto") %>% 
  addProviderTiles("Esri", group = "Esri") %>% 
  # Use addLayersControl to allow users to toggle between basemaps
  addLayersControl(baseGroups = c("OSM", "Carto", "Esri"))
m4 <- leaflet() %>% 
    addTiles(group = "OSM") %>% 
    addProviderTiles("CartoDB", group = "Carto") %>% 
    addProviderTiles("Esri", group = "Esri") %>% 
    addCircleMarkers(data = public, radius = 2, label = ~htmlEscape(name), 
                     color = ~pal(sector_label),  group = "Public"
                     ) %>% 
    addCircleMarkers(data = private, radius = 2, label = ~htmlEscape(name), 
                     color = ~pal(sector_label), group = "Private"
                     )  %>% 
    addCircleMarkers(data = profit, radius = 2, label = ~htmlEscape(name), 
                     color = ~pal(sector_label), group = "For-Profit"
                     )  %>% 
    addLayersControl(baseGroups = c("OSM", "Carto", "Esri"), 
                     overlayGroups = c("Public", "Private", "For-Profit")
                     ) %>% 
    setView(lat = 39.8282, lng = -98.5795, zoom = 4) 
## Assuming "lng" and "lat" are longitude and latitude, respectively
## Assuming "lng" and "lat" are longitude and latitude, respectively
## Assuming "lng" and "lat" are longitude and latitude, respectively
m4
ipeds %>% 
    leaflet() %>% 
    addTiles() %>% 
    # Sanitize any html in our labels
    addCircleMarkers(radius = 2, label = ~htmlEscape(name), 
                     # Color code colleges by sector using the `pal` color palette 
                     color = ~pal(sector_label), 
                     # Cluster all colleges using `clusterOptions` 
                     clusterOptions = markerClusterOptions()
                     ) 
## Assuming "lng" and "lat" are longitude and latitude, respectively

Chapter 4 - Plotting Polygons

Spatial Data - ability to plot polygons rather than points:

  • Polygons have many points, and are stored in SPDF (Spatial Polygons Data Frame) with 5 slots
    • data - one observation per polygon
    • polygons - coordinates to plot each polygon
    • plotOrder - order for plotting
    • bbox - rectangle containing all the polygons
    • proj4string - coordinate reference system (CRS)
    • All accessed using the @ symbol
  • Can join from the data component of the SPDF, accessed using @
    • hp@data <- shp@data %>% left_join(nc_income, by = c(“GEOID10” = “zipcode”))
    • shp@polygons[[1]] %>% leaflet() %>% addPolygons() # can plot a single polygon

Mapping Polygons - can pipe SPDF in to a series of leaflet calls:

  • The basic polygon plotting method using leaflet() may produce shape boundaries that are too thick
    • shp %>% leaflet() %>% addTiles() %>% addPolygons()
    • weight - thickness of lines
    • color - color of lines
    • label - information shown on hover
    • highlight - options to highlight polygon on hover
  • The refined plotting approach adds customization for better readability
    • shp %>% leaflet() %>% addTiles() %>% addPolygons(weight = 1, color = “grey”, label = ~paste0(“Total Income:” dollar(income)), highlight = highlightOptions(weight = 3, color = “red”, bringToFront = TRUE))
  • Can color numeric data when plotting polygons
    • colorNumeric - maps continuous data to interpolated palettes
    • colorBin - colors based on cut function
    • colorQuantile - colors based on quantile
    • nc_pal <- colorNumeric(palette = “Blues”, domain = high_inc@data$mean_income)
    • nc_pal <- colorBin(palette = “YlGn”, bins = 5, domain = high_inc@data$mean_income)
    • nc_pal <- colorQuantile(palette = “YlGn”, n = 4, domain = high_inc@data$mean_income)
  • Example of coloring using colorNumeric()
    • nc_pal <- colorNumeric(“Blues”, domain = high_inc@data$mean_income)
    • previewColors(pal = nc_pal, values = c(seq(100000, 600000, by = 100000))) # explore sample values
    • shp %>% leaflet() %>% # addTiles() %>% addPolygons(weight = 1, fillOpacity = 1, color = ~nc_pal(mean_income), label = ~paste0(“Mean Income:”, dollar(mean_income)), highlight = highlightOptions(weight = 3, color = “red”, bringToFront = TRUE))
  • Sometimes need to log-transform skewed data for better displays

Putting Everything Together:

  • Leaflet and htmlwidgets for base maps and coloring
  • Base and overlay groups to enhance interactivity
  • Features available in the leaflet.extras function
  • Can piece together a full map that includes both polygons and circle markers
    • leaflet() %>% addTiles(group = “OSM”) %>% addProviderTiles(“CartoDB”, group = “Carto”) %>%
    • addProviderTiles(“Esri”, group = “Esri”) %>%
    • addPolygons(data = shp, weight = 1, fillOpacity = .75, color = ~nc_pal(log(mean_income)), label = ~paste0(“Mean Income:”, dollar(mean_income)), group = “Mean Income”) %>%
    • addCircleMarkers(data = nc_public, radius = 2, label = ~htmlEscape(name), color = ~pal(sector_label), group = “Public”) %>%
    • addCircleMarkers(data = nc_private, radius = 2, label = ~htmlEscape(name), color = ~pal(sector_label), group = “Private”) %>%
    • addCircleMarkers(data = nc_profit, radius = 2, label = ~htmlEscape(name), color = ~pal(sector_label), group = “For-Profit”) %>%
    • addLayersControl(baseGroups = c(“OSM”, “Carto”, “Esri”), overlayGroups = c(“Public”, “Private”, “For-Profit”, “Mean Income”))
  • Can also save a map for future use
    • m <- leaflet() %>% addTiles() %>% addMarkers( data = ipeds, clusterOptions = markerClusterOptions())%>% addPolygons(data = shp)
    • library(htmlwidgets)
    • saveWidget(m, file=“myMap.html”) # saves the file as html

Wrap up - additional resources:

Example code includes:

load("./RInputFiles/nc_zips.Rda")
load("./RInputFiles/wealthiest_zips.Rda")
nc_income <- readr::read_csv("./RInputFiles/mean_income_by_zip_nc.csv")
## Parsed with column specification:
## cols(
##   zipcode = col_integer(),
##   returns = col_integer(),
##   income = col_double(),
##   mean_income = col_double()
## )
str(nc_income, give.attr = FALSE)
## Classes 'tbl_df', 'tbl' and 'data.frame':    723 obs. of  4 variables:
##  $ zipcode    : int  28207 28211 27608 28480 27517 27614 28173 28036 27408 28226 ...
##  $ returns    : int  4470 14060 5690 1510 12710 15670 21880 7640 9100 19240 ...
##  $ income     : num  2.46e+09 3.32e+09 1.13e+09 2.41e+08 1.97e+09 ...
##  $ mean_income: num  550849 235961 197725 159617 154682 ...
# Print a summary of the `shp` data
summary(shp)
## Loading required package: sp
## Object of class SpatialPolygonsDataFrame
## Coordinates:
##         min       max
## x -84.32187 -75.46089
## y  33.84232  36.58812
## Is projected: FALSE 
## proj4string :
## [+init=epsg:4326 +proj=longlat +datum=WGS84 +no_defs +ellps=WGS84
## +towgs84=0,0,0]
## Data attributes:
##     GEOID10         ALAND10   
##  27006  :  1   100240769:  1  
##  27007  :  1   100252722:  1  
##  27009  :  1   1003885  :  1  
##  27011  :  1   100620829:  1  
##  27012  :  1   100707703:  1  
##  27013  :  1   101001856:  1  
##  (Other):802   (Other)  :802
# Print the class of `shp`
class(shp)
## [1] "SpatialPolygonsDataFrame"
## attr(,"package")
## [1] "sp"
# Print the slot names of `shp`
slotNames(shp)
## [1] "data"        "polygons"    "plotOrder"   "bbox"        "proj4string"
# Glimpse the data slot of shp
glimpse(shp@data)
## Observations: 808
## Variables: 2
## $ GEOID10 <fct> 27925, 28754, 28092, 27217, 28711, 28666, 28602, 27841...
## $ ALAND10 <fct> 624688620, 223734670, 317180853, 318965510, 258603117,...
# Print the class of the data slot of shp
class(shp@data)
## [1] "data.frame"
# Print GEOID10
shp@data$GEOID10
##   [1] 27925 28754 28092 27217 28711 28666 28602 27841 27831 28785 27504
##  [12] 27330 28768 28658 28716 28139 27565 28394 27982 28025 28159 28382
##  [23] 28312 28342 27839 27852 28723 28077 28039 28452 27306 28375 28713
##  [34] 28743 28717 28150 28447 27205 27379 28425 27827 27540 28114 28451
##  [45] 27892 27249 28628 27873 28781 27916 28705 28714 28101 28102 28445
##  [56] 28448 28458 28719 28478 28479 28501 28748 28752 28207 28753 28757
##  [67] 28209 28212 28560 28504 27983 27985 28018 28019 28562 28906 28530
##  [78] 28771 28779 28782 28376 28581 28152 28169 28170 28657 28021 28204
##  [89] 28533 28540 28543 28551 28262 28280 28575 28790 28792 28667 28672
## [100] 28108 28462 28681 28465 28734 28739 28694 28697 28702 28745 28127
## [111] 28420 28422 28424 28428 28435 28088 28089 28090 27562 28334 28787
## [122] 28433 27360 27534 28043 27370 28444 27531 28675 28712 28449 27053
## [133] 27944 28367 28326 28740 28659 28282 27244 27597 27017 28761 28457
## [144] 28441 27956 27889 28652 28146 28513 28777 28786 27596 27530 28369
## [155] 28327 27340 27028 27823 27879 28244 27810 27886 28306 27025 27239
## [166] 27967 27824 27826 27834 27030 28358 28365 27520 27524 27525 27526
## [177] 27292 27874 27882 27883 27885 27253 27576 27577 27582 27295 27298
## [188] 27332 27910 27052 27055 27344 27516 27850 27856 27265 27603 27605
## [199] 27537 27539 27541 28601 28604 27809 27278 27284 27371 27201 27312
## [210] 28320 28325 27207 28330 28607 28611 28612 27549 27555 27317 27320
## [221] 27703 27709 28350 28643 28337 28621 27569 28645 28651 27948 28630
## [232] 27923 27929 27936 27943 28721 28512 27546 27891 28379 27822 27909
## [243] 28655 28662 27587 27589 28625 28742 28553 27941 28134 27043 27893
## [254] 28328 28135 28007 28338 27110 28472 28756 28110 28519 27861 27407
## [265] 28374 28211 28668 27214 27965 27949 27806 28340 27917 27288 27563
## [276] 28669 27229 27283 27109 27843 27047 28303 28585 28676 28689 28305
## [287] 28635 28640 27016 27863 27968 28528 27915 27981 28411 28577 27326
## [298] 27954 28556 27105 27545 27813 27974 27301 28168 28670 28801 27050
## [309] 28610 28665 28125 28538 27849 28036 28586 27801 27807 28904 27875
## [320] 28557 27958 28468 27536 28213 28341 28747 28707 27262 28006 28360
## [331] 28031 27845 28166 28616 27572 27014 27503 27011 28572 28386 27291
## [342] 28432 27804 27343 28073 28467 28173 28539 28352 27828 28515 28555
## [353] 27855 27583 28310 28396 28348 28138 28642 27542 27408 28215 27821
## [364] 28105 28270 28206 28301 27876 28627 27019 28574 28647 28806 27349
## [375] 28091 28660 28726 28508 27840 28803 28511 27964 27978 28086 27927
## [386] 28774 28383 27559 28523 28332 28749 27962 27455 28056 27501 28027
## [397] 27527 27282 27837 28682 27310 28356 27233 27231 27006 28144 27857
## [408] 27042 28314 27612 28525 27281 28147 28366 28629 27523 27937 28119
## [419] 28012 27048 27880 27350 27027 27606 27938 28638 28720 28580 27103
## [430] 27986 28001 28034 28393 28032 28040 28677 28395 28391 28678 28399
## [441] 28455 28098 28401 28103 28684 28685 28409 28071 28683 28083 28708
## [452] 28097 28450 28431 28453 28454 28709 28439 28377 28715 28443 28436
## [463] 28438 28751 28129 28133 28763 28109 28120 28466 28746 28137 28480
## [474] 28759 28731 28762 28405 28054 28698 28081 28403 28052 28701 28690
## [485] 28412 28704 28078 28421 28693 28544 28516 28773 28775 28905 28174
## [496] 28203 28570 28208 28210 28202 28804 28805 28791 28901 28547 28107
## [507] 28722 28729 28461 28730 28463 28552 28554 28115 28732 28112 28214
## [518] 28733 28308 28304 28571 28584 28582 28583 28273 28587 28278 28578
## [529] 28579 28323 28164 28605 28518 28520 28526 28783 28529 28167 28521
## [540] 28531 28311 28163 28537 28772 28626 27942 27928 28634 28649 28339
## [551] 28357 27935 28623 28618 28654 28624 28619 27922 28307 28226 27946
## [562] 27947 28347 28349 28227 28637 27926 27920 28646 28573 27921 28351
## [573] 28269 28590 27341 28364 27604 27976 28615 27357 28344 28613 28609
## [584] 28343 27409 27376 27377 27701 27610 27979 27405 27704 27705 27959
## [595] 27960 27403 27966 27953 27970 27972 27973 27707 27957 27401 27517
## [606] 27502 27507 27508 27509 27510 27518 27505 27020 27613 27024 27514
## [617] 27519 27713 27614 27803 27616 27617 27513 27511 27023 27046 27844
## [628] 27869 27853 27051 27041 27521 27871 27872 27842 27106 27830 27846
## [639] 27013 27862 27104 27832 27847 27858 27865 27851 27825 27829 27012
## [650] 27816 27817 27557 27808 27209 27208 27820 27888 27814 27551 27556
## [661] 27045 27235 27560 27215 27054 27248 27242 27260 27243 27258 27581
## [672] 27812 27601 27592 27591 27544 27316 27313 27325 27314 27311 27896
## [683] 27007 28650 28606 27009 28735 28673 28725 28033 27870 27864 28429
## [694] 28384 28663 27022 28333 27574 28524 28527 28277 27263 28023 27573
## [705] 27615 28020 28464 28128 28009 28205 28104 27299 27884 28076 28080
## [716] 28160 28532 27302 28124 27932 27924 28037 27819 27608 28789 28079
## [727] 28398 27553 27878 27018 27040 28392 27315 28594 27950 28442 27410
## [738] 27805 28371 27305 28778 28692 28072 28456 28589 28363 27355 27358
## [749] 28385 28736 27890 27522 28617 28671 28387 28390 27212 27609 27568
## [760] 28679 27881 27101 28622 28644 28631 28636 28373 28345 27712 28117
## [771] 27866 27021 27406 28741 28372 27897 28430 27980 28017 27203 28909
## [782] 27127 27607 27939 28217 28216 27252 28423 28718 27919 28510 28460
## [793] 28434 28470 28766 28546 27818 27529 28469 28016 28075 28318 27107
## [804] 27356 28315 27571 27860 28902
## 33144 Levels: 00601 00602 00603 00606 00610 00612 00616 00617 00622 ... 99929
shp@data$GEOID10 <- as.integer(as.character(shp@data$GEOID10))
str(shp@data$GEOID10)
##  int [1:808] 27925 28754 28092 27217 28711 28666 28602 27841 27831 28785 ...
# Glimpse the nc_income data
glimpse(nc_income)
## Observations: 723
## Variables: 4
## $ zipcode     <int> 28207, 28211, 27608, 28480, 27517, 27614, 28173, 2...
## $ returns     <int> 4470, 14060, 5690, 1510, 12710, 15670, 21880, 7640...
## $ income      <dbl> 2462295000, 3317607000, 1125055000, 241022000, 196...
## $ mean_income <dbl> 550849.0, 235960.7, 197725.0, 159617.2, 154682.2, ...
# Summarise the nc_income data
summary(nc_income)
##     zipcode         returns          income           mean_income    
##  Min.   :27006   Min.   :  110   Min.   :4.557e+06   Min.   : 26625  
##  1st Qu.:27605   1st Qu.: 1105   1st Qu.:4.615e+07   1st Qu.: 40368  
##  Median :28115   Median : 3050   Median :1.526e+08   Median : 46288  
##  Mean   :28062   Mean   : 5979   Mean   :3.648e+08   Mean   : 53338  
##  3rd Qu.:28521   3rd Qu.: 9050   3rd Qu.:4.670e+08   3rd Qu.: 55917  
##  Max.   :28909   Max.   :37020   Max.   :3.970e+09   Max.   :550849
# Left join nc_income onto shp@data and store in shp_nc_income
shp_nc_income <- shp@data %>% 
                left_join(nc_income, by = c("GEOID10" = "zipcode"))

# Print the number of missing values of each variable in shp_nc_income
shp_nc_income %>%
  summarise_all(funs(sum(is.na(.))))
##   GEOID10 ALAND10 returns income mean_income
## 1       0       0      85     85          85
shp <- merge(shp, shp_nc_income, by=c("GEOID10", "ALAND10"))


# map the polygons in shp
shp %>% 
    leaflet() %>% 
    addTiles() %>% 
    addPolygons()
# which zips were not in the income data?
shp_na <- shp[is.na(shp$mean_income),]

# map the polygons in shp_na
shp_na %>% 
    leaflet() %>% 
    addTiles() %>% 
    addPolygons()
# summarise the mean income variable
summary(shp$mean_income)
##    Min. 1st Qu.  Median    Mean 3rd Qu.    Max.    NA's 
##   26625   40368   46288   53338   55917  550849      85
# subset shp to include only zip codes in the top quartile of mean income
high_inc <- shp[!is.na(shp$mean_income) & shp$mean_income > 55917,]

# map the boundaries of the zip codes in the top quartile of mean income
high_inc %>%
  leaflet() %>%
  addTiles() %>%
  addPolygons()
dollar <- function (x, negative_parens=TRUE, prefix="$", suffix="") {
    # KLUGE to make this work . . . 
    needs_cents <- function(...) { FALSE }
    if (length(x) == 0) 
        return(character())
    x <- plyr::round_any(x, 0.01)
    if (needs_cents(x, largest_with_cents)) {
        nsmall <- 2L
    }
    else {
        x <- plyr::round_any(x, 1)
        nsmall <- 0L
    }
    negative <- !is.na(x) & x < 0
    if (negative_parens) {
        x <- abs(x)
    }
    amount <- format(abs(x), nsmall = nsmall, trim = TRUE, big.mark = ",", scientific = FALSE, digits = 1L)
    if (negative_parens) {
        paste0(ifelse(negative, "(", ""), prefix, amount, suffix, ifelse(negative, ")", ""))
    }
    else {
        paste0(prefix, ifelse(negative, "-", ""), amount, suffix)
    }
}


# create color palette with colorNumeric()
nc_pal <- colorNumeric("YlGn", domain = high_inc@data$mean_income)

high_inc %>%
  leaflet() %>%
  addTiles() %>%
  # set boundary thickness to 1 and color polygons blue
  addPolygons(weight = 1, color = ~nc_pal(mean_income),
              # add labels that display mean income
              label = ~paste0("Mean Income: ", dollar(mean_income)),
              # highlight polygons on hover
              highlight = highlightOptions(weight = 5, color = "white",
              bringToFront = TRUE))
# Create a logged version of the nc_pal color palette
nc_pal <- colorNumeric("YlGn", domain = log(high_inc@data$mean_income))

# apply the nc_pal
high_inc %>%
  leaflet() %>%
  addProviderTiles("CartoDB") %>%
  addPolygons(weight = 1, color = ~nc_pal(log(mean_income)), fillOpacity = 1,
              label = ~paste0("Mean Income: ", dollar(mean_income)),
              highlightOptions = highlightOptions(weight = 5, color = "white", bringToFront = TRUE))
# Print the slot names of `wealthy_zips`
slotNames(wealthy_zips)
## [1] "data"        "polygons"    "plotOrder"   "bbox"        "proj4string"
# Print a summary of the `mean_income` variable
summary(wealthy_zips$mean_income)
##    Min. 1st Qu.  Median    Mean 3rd Qu.    Max. 
##  200444  229914  279330  339859  371904 2553591
# plot zip codes with mean incomes >= $200k
wealthy_zips %>% 
  leaflet() %>% 
  addProviderTiles("CartoDB") %>% 
  addPolygons(weight = 1, fillOpacity = .7, color = "Green",  group = "Wealthy Zipcodes", 
              label = ~paste0("Mean Income: ", dollar(mean_income)),
              highlightOptions = highlightOptions(weight = 5, color = "white", bringToFront = TRUE))
# Add polygons using wealthy_zips
final_map <- m4 %>% 
   addPolygons(data = wealthy_zips, weight = 1, fillOpacity = .5, color = "Grey",  group = "Wealthy Zip Codes", 
              label = ~paste0("Mean Income: ", dollar(mean_income)),
              highlight = highlightOptions(weight = 5, color = "white", bringToFront = TRUE)) %>% 
    # Update layer controls including "Wealthy Zip Codes"
    addLayersControl(baseGroups = c("OSM", "Carto", "Esri"), 
                         overlayGroups = c("Public", "Private", "For-Profit", "Wealthy Zip Codes"))

# Print and explore your very last map of the course!
final_map

Support Vector Machines in R

Chapter 1 - Introduction

Sugar content of soft drinks:

  • Course covers Support Vector Machines (SVM), including visualization, mechanics, situations where they work best, etc.
    • Will stick with binary classification for this course
  • For a 1-dimensional dataset, the clusters can be separated by choosing a “separating boundary” (decision boundary)
  • Margins are the distances between the decision boundary and the closest point
    • The best decision boundary is considered to be the decision boundary that maximizes the margin (more robust to noise)
    • The SVM tries to find the decision boundary that maximizes the margin in n-dimensions

Generating a linearly separable dataset

  • Can use runif to generate random data that is unifotm from 0 to 1
    • n <- 200
    • set.seed(42)
    • df <- data.frame(x1 = runif(n), x2 = runif(n))
  • Can define the points with x1 < x2 as class A and the points with x1 > x2 as class B
    • Can also create a margin by filtering out points where abs(x1-x2) is below a user-specified threshold

Example code includes:

df <- data.frame(sample=1:25, 
                 sugar_content=c(10.9, 10.9, 10.6, 10, 8, 8.2, 8.6, 10.9, 10.7, 8, 7.7, 7.8, 8.4, 11.5, 11.2, 8.9, 8.7, 7.4, 10.9, 10, 11.4, 10.8, 8.5, 8.2, 10.6)
                 )
str(df)
## 'data.frame':    25 obs. of  2 variables:
##  $ sample       : int  1 2 3 4 5 6 7 8 9 10 ...
##  $ sugar_content: num  10.9 10.9 10.6 10 8 8.2 8.6 10.9 10.7 8 ...
#print variable names
names(df)
## [1] "sample"        "sugar_content"
#build plot
plot_ <- ggplot(data = df, aes(x = sugar_content, y = c(0))) + 
    geom_point() + 
    geom_text(label = df$sugar_content, size = 2.5, vjust = 2, hjust = 0.5)

#display plot
plot_

#The maximal margin separator is at the midpoint of the two extreme points in each cluster.
mm_separator <- (8.9 + 10)/2


#create data frame
separator <- data.frame(sep = c(mm_separator))

#add ggplot layer 
plot_ <- plot_ + 
  geom_point(data = separator, x = separator$sep, y = c(0), color = "blue", size = 4)

#display plot
plot_

#set seed
set.seed(42)

#set number of data points. 
n <- 600

#Generate data frame with two uniformly distributed predictors lying between 0 and 1.
df <- data.frame(x1 = runif(n), x2 = runif(n))

#classify data points depending on location
df$y <- factor(ifelse(df$x2 - 1.4*df$x1 < 0, -1, 1), levels = c(-1, 1))


#set margin
delta <- 0.07

# retain only those points that lie outside the margin
df1 <- df[abs(1.4*df$x1 - df$x2) > delta, ]

#build plot
plot_margins <- ggplot(data = df1, aes(x = x1, y = x2, color = y)) + geom_point() + 
    scale_color_manual(values = c("red", "blue")) + 
    geom_abline(slope = 1.4, intercept = 0)+
    geom_abline(slope = 1.4, intercept = delta, linetype = "dashed") +
    geom_abline(slope = 1.4, intercept = -delta, linetype = "dashed")
 
#display plot 
plot_margins


Chapter 2 - Support Vector Classifiers - Linear Kernels

Linear Support Vector Machines:

  • Can split the data from the previous chapter (perfectly separable) in to train/test on an 80-20 basis
    • set.seed() = 1
    • df[, “train”] <- ifelse(runif(nrow(df))<0.8,1,0)
    • trainset <- df[df$train==1,]
    • testset <- df[df$train==0,]
    • trainColNum <- grep(“train”, names(trainset))
    • trainset <- trainset[,-trainColNum]
    • testset <- testset[,-trainColNum]
  • Decision boundaries have many shapes-types (called kernels) such as lines, polynomials, etc.
  • For this chapter, will use e1071::svm(), a function with many options
    • formula, data, type (“C-classification” for classification), kernel (“linear” for this chapter), cost/gamma (tuning parameters, which will be left at the defaults for now), scale (boolean telling whether to scale the data in advance - FALSE makes for easier plotting, but typically would be set to TRUE in the real-world)
  • Example of running e1071::svm()
    • library(e1071)
    • svm_model<- svm(y ~ ., data = trainset, type = “C-classification”, kernel = “linear”, scale = FALSE)
    • svm_model
    • svm_model$index # indices of the support vectors
    • svm_model$SV # support vector coordinates
    • svm_model$rho # negative y-intercept of the decision boundary
    • svm_model$coefs # weighting coefficients of support vectors (magnitude is importance, side is which part of boundary)
    • pred_train <- predict(svm_model,trainset)
    • pred_test <- predict(svm_model,testset)

Visualizing Linear SVM:

  • Can begin by plotting the training data, distinguished by color
    • p <- ggplot(data = trainset, aes(x = x1, y = x2, color = y)) + geom_point() + scale_color_manual(values = c(“red”,“blue”))
    • df_sv <- trainset[svm_model$index,]
    • p <- p + geom_point(data = df_sv, aes(x = x1, y = x2), color = “purple”, size = 4, alpha = 0.5)
    • p
  • The support vectors tend to be close to the decision boundary - in fact, they are defined as points that “support” the boundary
  • Goal is to extract the slope and coefficients from the model (not stored in the model object)
    • w <- t(svm_model\(coefs) %*% svm_model\)SV
    • slope_1 <- -w[1]/w[2]
    • intercept_1 <- svm_model$rho/w[2]
    • p <- p + geom_abline(slope = slope_1, intercept = intercept_1)
    • p <- p + geom_abline(slope = slope_1, intercept = intercept_1-1/w[2], linetype = “dashed”) + geom_abline(slope = slope_1, intercept = intercept_1+1/w[2], linetype = “dashed”)
    • p
  • There are several properties observed in the plot
    • The boundary is supported by the support vectors
    • The boundary is “soft”, which allows for uncertainty in location/shape of the boundary
    • Can also use e1071::plot(x=myModel, data=myData) to plot the function

Tuning Linear SVM:

  • Can tweak the cost parameter to change the size of the soft boundary for the SVM
    • Higher costs lead to harder (smaller, narrower) decision boundaries, with fewer support vectors
    • The implication is that raising the cost can be a good idea if the data are known to be linearly separable

Multi-class problems:

  • SVM can manage classification problems with 3+ target types also - using the example iris data
    • p <- ggplot(data = iris, aes(x = Petal.Width, y = Petal.Length, color = Species)) + geom_point()
    • p
  • The SVM at core is a binary classifier, but can be used in a multi-class setting
    • Have a model for each of the choose(m, 2) possible combinations, and use majority voting on the outputs (ties broken by random)
    • This method is called the “one against one” classification, and it is automatically included in e1071
    • svm_model<- svm(Species ~ ., data = trainset, type = “C-classification”, kernel = “linear”) # all run automatically

Example code includes:

dfOld <- df
delta <- 0.07
df <- df[abs(1.4*df$x1 - df$x2) > delta, ]


#split train and test data in an 80/20 proportion
df[, "train"] <- ifelse(runif(nrow(df))<0.8, 1, 0)

#assign training rows to data frame trainset
trainset <- df[df$train == 1, ]
#assign test rows to data frame testset
testset <- df[df$train == 0, ]

#find index of "train" column
trainColNum <- grep("train", names(df))

#remove "train" column from train and test dataset
trainset <- trainset[, -trainColNum]
testset <- testset[, -trainColNum]


library(e1071)

#build svm model, setting required parameters
svm_model<- svm(y ~ ., 
                data = trainset, 
                type = "C-classification", 
                kernel = "linear", 
                scale = FALSE)


#list components of model
names(svm_model)
##  [1] "call"            "type"            "kernel"         
##  [4] "cost"            "degree"          "gamma"          
##  [7] "coef0"           "nu"              "epsilon"        
## [10] "sparse"          "scaled"          "x.scale"        
## [13] "y.scale"         "nclasses"        "levels"         
## [16] "tot.nSV"         "nSV"             "labels"         
## [19] "SV"              "index"           "rho"            
## [22] "compprob"        "probA"           "probB"          
## [25] "sigma"           "coefs"           "na.action"      
## [28] "fitted"          "decision.values" "terms"
#list values of the SV, index and rho
svm_model$SV
##               x1          x2
## 11  0.4577417762 0.476919189
## 19  0.4749970816 0.486642912
## 45  0.4317512489 0.520339758
## 58  0.1712643304 0.100229354
## 61  0.6756072745 0.772399305
## 69  0.6932048204 0.838569788
## 99  0.7439746463 0.912029979
## 101 0.6262453445 0.765520479
## 103 0.2165673110 0.202548483
## 118 0.3556659538 0.298152283
## 143 0.4640695513 0.535269056
## 144 0.7793681615 0.941694443
## 147 0.1701624813 0.050030747
## 173 0.4140496817 0.380267640
## 176 0.1364903601 0.011009041
## 180 0.7690324257 0.951921815
## 194 0.1290892835 0.021196302
## 199 0.7431877197 0.824081728
## 204 0.4427962683 0.532290264
## 209 0.2524584394 0.281511990
## 226 0.8205145481 0.962842692
## 253 0.2697161783 0.288755647
## 268 0.2050496121 0.182046106
## 272 0.7853494422 0.870432480
## 278 0.4037828147 0.476424339
## 286 0.1709963905 0.164468810
## 294 0.3864540118 0.370921416
## 295 0.3324459905 0.382318948
## 325 0.5648222226 0.618285144
## 338 0.3169501573 0.333509587
## 341 0.4091320913 0.496387038
## 344 0.3597852497 0.345139100
## 393 0.6568108753 0.815567016
## 400 0.0755990995 0.007417523
## 406 0.1079870730 0.022227321
## 413 0.2401496081 0.151690785
## 427 0.4664852461 0.464965629
## 443 0.3626018071 0.369346223
## 450 0.0619409799 0.011438249
## 466 0.6399842701 0.695480783
## 479 0.1730011790 0.136427131
## 503 0.5195604505 0.627322678
## 525 0.6494539515 0.833293378
## 526 0.6903516576 0.790328991
## 535 0.4243346907 0.470753220
## 590 0.7148487861 0.902375512
## 595 0.8058112133 0.937903824
## 600 0.4587231132 0.446819442
## 15  0.4622928225 0.839631285
## 29  0.4469696281 0.721333573
## 37  0.0073341469 0.108096598
## 38  0.2076589728 0.519075874
## 59  0.2610879638 0.472588875
## 90  0.3052183695 0.548420829
## 92  0.0002388966 0.122946701
## 102 0.2171576982 0.505044580
## 104 0.3889450287 0.717138722
## 129 0.2335235255 0.439058027
## 132 0.6034740848 0.958318281
## 133 0.6315072989 0.970767964
## 158 0.0290858189 0.148069276
## 175 0.4274944656 0.725024226
## 178 0.5923042425 0.900228734
## 189 0.1333296183 0.390023998
## 196 0.0531294835 0.276241161
## 202 0.5171110556 0.899924811
## 210 0.2596899802 0.503687580
## 215 0.4513108502 0.743930877
## 229 0.0483467767 0.218475638
## 232 0.1590223818 0.402696270
## 237 0.0865806018 0.263718613
## 239 0.5545858634 0.935806216
## 249 0.4992728804 0.812805236
## 258 0.5397982858 0.932383237
## 276 0.3367135401 0.672058288
## 293 0.3152607968 0.625878707
## 309 0.3199476011 0.541676977
## 311 0.1078112544 0.374908455
## 378 0.1084886545 0.376079086
## 409 0.0842775232 0.235715229
## 419 0.4264662997 0.798480970
## 420 0.0600483362 0.298929408
## 430 0.5141573721 0.908452330
## 451 0.4309255683 0.821331850
## 477 0.5964720468 0.913432184
## 481 0.2329343846 0.409654615
## 482 0.5770482090 0.969947845
## 488 0.2485451805 0.533491509
## 520 0.5784583788 0.907620618
## 524 0.1270027745 0.348539336
## 530 0.2665205784 0.458110426
## 540 0.2131855546 0.530223881
## 558 0.2770604359 0.510976796
## 562 0.2056735931 0.433566746
## 580 0.5705413527 0.994652604
## 581 0.2458533479 0.494881822
svm_model$index
##  [1]   8  11  30  39  42  48  71  73  75  85 103 104 105 124 127 131 141
## [18] 145 149 153 167 188 196 199 204 208 215 216 240 251 254 257 290 297
## [35] 300 306 317 329 335 347 353 372 390 391 398 440 443 445   9  18  23
## [52]  24  40  63  65  74  76  92  95  96 114 126 129 137 143 148 154 157
## [69] 170 173 178 180 186 192 202 214 228 229 281 303 310 311 318 336 351
## [86] 355 356 362 385 389 395 402 415 419 431 432
svm_model$rho
## [1] -0.1641859
#compute training accuracy
pred_train <- predict(svm_model, trainset)
mean(pred_train == trainset$y)
## [1] 1
#compute test accuracy
pred_test <- predict(svm_model, testset)
mean(pred_test == testset$y)
## [1] 1
#build scatter plot of training dataset
scatter_plot <- ggplot(data = trainset, aes(x = x1, y = x2, color = y)) + 
    geom_point() + 
    scale_color_manual(values = c("red", "blue"))
 
#add plot layer marking out the support vectors 
layered_plot <- 
    scatter_plot + geom_point(data = trainset[svm_model$index, ], aes(x = x1, y = x2), color = "purple", size = 4, alpha = 0.5)

#display plot
layered_plot

#calculate slope and intercept of decision boundary from weight vector and svm model
w <- c(x1=6.55241, x2=-4.73278)  # calculated manually outside of this module
slope_1 <- -w[1]/w[2]
intercept_1 <- svm_model$rho/w[2]

#build scatter plot of training dataset
scatter_plot <- ggplot(data = trainset, aes(x = x1, y = x2, color = y)) + 
    geom_point() + scale_color_manual(values = c("red", "blue"))
#add decision boundary
plot_decision <- scatter_plot + geom_abline(slope = slope_1, intercept = intercept_1) 
#add margin boundaries
plot_margins <- plot_decision + 
 geom_abline(slope = slope_1, intercept = intercept_1 - 1/w[2], linetype = "dashed")+
 geom_abline(slope = slope_1, intercept = intercept_1 + 1/w[2], linetype = "dashed")
#display plot
plot_margins

#build svm model
svm_model<- 
    svm(y ~ ., data = trainset, type = "C-classification", 
        kernel = "linear", scale = FALSE)

#plot decision boundaries and support vectors
plot(x = svm_model, data = trainset)

#build svm model, cost = 1
svm_model_1 <- svm(y ~ .,
                   data = trainset,
                   type = "C-classification",
                   cost = 1,
                   kernel = "linear",
                   scale = FALSE)

#print model details
svm_model_1
## 
## Call:
## svm(formula = y ~ ., data = trainset, type = "C-classification", 
##     cost = 1, kernel = "linear", scale = FALSE)
## 
## 
## Parameters:
##    SVM-Type:  C-classification 
##  SVM-Kernel:  linear 
##        cost:  1 
##       gamma:  0.5 
## 
## Number of Support Vectors:  96
#build svm model, cost = 100
svm_model_100 <- svm(y ~ .,
                   data = trainset,
                   type = "C-classification",
                   cost = 100,
                   kernel = "linear",
                   scale = FALSE)

#print model details
svm_model_100
## 
## Call:
## svm(formula = y ~ ., data = trainset, type = "C-classification", 
##     cost = 100, kernel = "linear", scale = FALSE)
## 
## 
## Parameters:
##    SVM-Type:  C-classification 
##  SVM-Kernel:  linear 
##        cost:  100 
##       gamma:  0.5 
## 
## Number of Support Vectors:  6
# Create the base train_plot
train_plot <- ggplot(data = trainset, aes(x = x1, y = x2, color = y)) + 
    geom_point() + scale_color_manual(values = c("red", "blue"))
w_1 <- c(x1=6.55241, x2=-4.73278)  # calculated manually outside of this module
w_100 <- c(x1=18.3097, x2=-13.09972)  # calculated manually outside of this module
intercept_1 <- -0.005515526  # calculated outside of this module
intercept_100 <- 0.001852543  # calculated outside of this module
slope_1 <- -w_1[1]/w_1[2]
slope_100 <- -w_100[1]/w_100[2]


#add decision boundary and margins for cost = 1 to training data scatter plot
train_plot_with_margins <- train_plot + 
    geom_abline(slope = slope_1, intercept = intercept_1) +
    geom_abline(slope = slope_1, intercept = intercept_1 - 1/w_1[2], linetype = "dashed")+
    geom_abline(slope = slope_1, intercept = intercept_1 + 1/w_1[2], linetype = "dashed")

#display plot
train_plot_with_margins

#add decision boundary and margins for cost = 100 to training data scatter plot
train_plot_with_margins <- train_plot_with_margins + 
    geom_abline(slope = slope_100, intercept = intercept_100, color = "goldenrod") +
    geom_abline(slope = slope_100, intercept = intercept_100 - 1/w_100[2], linetype = "dashed", color = "goldenrod")+
    geom_abline(slope = slope_100, intercept = intercept_100 + 1/w_100[2], linetype = "dashed", color = "goldenrod")

#display plot 
train_plot_with_margins

svm_model<- svm(y ~ ., data = trainset, type = "C-classification", kernel = "linear", scale = FALSE)

#compute training accuracy
pred_train <- predict(svm_model, trainset)
mean(pred_train == trainset$y)
## [1] 1
#compute test accuracy
pred_test <- predict(svm_model, testset)
mean(pred_test == testset$y)
## [1] 1
#plot
plot(svm_model, trainset)

data(iris)
nTrials <- 100
accuracy <- numeric(nTrials)

#calculate accuracy for n distinct 80/20 train/test partitions
for (i in 1:nTrials){ 
    iris[, "train"] <- ifelse(runif(nrow(iris))<0.8, 1, 0)
    trainColNum <- grep("train", names(iris))
    trainset <- iris[iris$train == 1, -trainColNum]
    testset <- iris[iris$train == 0, -trainColNum]
    svm_model <- svm(Species~ ., data = trainset, 
                     type = "C-classification", kernel = "linear")
    pred_test <- predict(svm_model, testset)
    accuracy[i] <- mean(pred_test == testset$Species)
}

#mean accuracy and standard deviation
mean(accuracy) 
## [1] 0.9643194
sd(accuracy)
## [1] 0.03704363

Chapter 3 - Polynomial Kernels

Generating radially separable datasets:

  • The goal is to generate 2D points (again uniformly distributed on x1 and x2 using runif)
  • Can then define a value for whether the points are within x of the center
    • radius <- 0.7
    • radius_squared <- radius^2
    • df\(y <- factor(ifelse(df\)x1^2 + df$x2^2 < radius_squared, -1, 1), levels = c(-1,1))
    • p <- ggplot(data = df, aes(x = x1, y = x2, color = y)) + geom_point() + scale_color_manual(values = c(“-1” = “red”,“1” = “blue”))
    • p
  • Can add a circular boundary
    • circle <- function(x1_center, x2_center, r, npoint = 100){
    • #angular spacing of 2*pi/npoint between points
    • theta <- seq(0,2*pi,length.out = npoint)
    • x1_circ <- x1_center + r * cos(theta)
    • x2_circ <- x2_center + r * sin(theta)
    • return(data.frame(x1c = x1_circ, x2c = x2_circ))
    • }
    • boundary <- circle(x1_center = 0, x2_center = 0, r = radius)
    • p <- p + geom_path(data = boundary, aes(x = x1c, y = x2c), inherit.aes = FALSE)

Linear SVM on radially separable datasets:

  • The linear SVM will perform poorly on the radially separable dataset
    • svm_model<- svm(y ~ ., data=trainset, type=“C-classification”, kernel=“linear”)
    • svm_model
    • pred_test <- predict(svm_model,testset)
    • plot(svm_model,trainset) # all points are classified as 1

Kernel trick - devise a mathematical transformation that makes the data linearly separable:

  • For a circles could map X1 = x12 and X2 = x22, where X1 + X2 = 0.49 (which is linearly separable)
  • The polynomial kernel has a degree (e.g., 1 for linear, 2 for quadratic, etc.) and tuning parameters gamma and coef0
    • The kernel also uses u dot v where u and v are vectors belonging to the dataset
    • (gamma * (u dot v) + coef0) ** degree
  • Applying the quadratic kernel to the circular data from above
    • svm_model<- svm(y ~ ., data = trainset, type = “C-classification”, kernel = “polynomial”, degree = 2)
    • plot(svm_model, trainset)

Tuning SVM:

  • Set a search range for each parameter, typically as a sequence of variable (e.g., in multiples of 10)
  • For each combination of parameters, build an SVM and assess the out-of-sample accuracy - can become computationally intensive, though
    • tune_out <- tune.svm(x = trainset[,-3], y = trainset[,3], type = “C-classification”, kernel = “polynomial”, degree = 2, cost = 10^(-1:2), gamma = c(0.1,1,10), coef0 = c(0.1,1,10))
    • tune_out\(best.parameters\)cost
    • tune_out\(best.parameters\)gamma
    • tune_out\(best.parameters\)coef0
    • svm_model <- svm(y~ ., data = trainset, type = “C-classification”, kernel = “polynomial”, degree = 2, cost = tune_out\(best.parameters\)cost, gamma = tune_out\(best.parameters\)gamma, coef0 = tune_out\(best.parameters\)coef0)

Example code includes:

#set number of variables and seed
n <- 400
set.seed(1)

#Generate data frame with two uniformly distributed predictors, x1 and x2
df <- data.frame(x1 = runif(n, min = -1, max = 1), x2 = runif(n, min = -1, max = 1))

#We want a circular boundary. Set boundary radius 
radius <- 0.8
radius_squared <- radius^2

#create dependent categorical variable, y, with value -1 or 1 depending on whether point lies
#within or outside the circle.
df$y <- factor(ifelse(df$x1**2 + df$x2**2 < radius_squared, -1, 1), levels = c(-1, 1))


#build scatter plot, distinguish class by color
scatter_plot <- ggplot(data = df, aes(x = x1, y = x2, color = y)) + 
    geom_point() +
    scale_color_manual(values = c("red", "blue"))

#display plot
scatter_plot

inTrain <- sample(1:nrow(df), round(0.75*nrow(df)), replace=FALSE)
trainset <- df[sort(inTrain), ]
testset <- df[-inTrain, ]


#default cost mode;
svm_model_1 <- svm(y ~ ., data = trainset, type = "C-classification", cost = 1, kernel = "linear")

#training accuracy
pred_train <- predict(svm_model_1, trainset)
mean(pred_train == trainset$y)
## [1] 0.64
#test accuracy
pred_test <- predict(svm_model_1, testset)
mean(pred_test == testset$y)
## [1] 0.48
#cost = 100 model
svm_model_100 <- svm(y ~ ., data = trainset, type = "C-classification", cost = 100, kernel = "linear")

#accuracy
pred_train <- predict(svm_model_100, trainset)
mean(pred_train == trainset$y)
## [1] 0.64
pred_test <- predict(svm_model_100, testset)
mean(pred_test == testset$y)
## [1] 0.48
#print average accuracy and standard deviation
accuracy <- rep(NA, 100)
set.seed(2)

#comment
for (i in 1:100){
    df[, "train"] <- ifelse(runif(nrow(df))<0.8, 1, 0)
    trainset <- df[df$train == 1, ]
    testset <- df[df$train == 0, ]
    trainColNum <- grep("train", names(trainset))
    trainset <- trainset[, -trainColNum]
    testset <- testset[, -trainColNum]
    svm_model<- svm(y ~ ., data = trainset, type = "C-classification", kernel = "linear")
    pred_test <- predict(svm_model, testset)
    accuracy[i] <- mean(pred_test == testset$y)
}

#print average accuracy and standard deviation
mean(accuracy)
## [1] 0.5554571
sd(accuracy)
## [1] 0.04243524
#transform data
df1 <- data.frame(x1sq = df$x1^2, x2sq = df$x2^2, y = df$y)

#plot data points in the transformed space
plot_transformed <- ggplot(data = df1, aes(x = x1sq, y = x2sq, color = y)) + 
    geom_point()+ guides(color = FALSE) + 
    scale_color_manual(values = c("red", "blue"))

#add decision boundary and visualize
plot_decision <- plot_transformed + geom_abline(slope = -1, intercept = 0.64)
plot_decision

# Still want to use the old (non-squared) data
inTrain <- sample(1:nrow(df), round(0.75*nrow(df)), replace=FALSE)
df$train <- NULL
trainset <- df[sort(inTrain), ]
testset <- df[-inTrain, ]

svm_model <- svm(y ~ ., data = trainset, type = "C-classification", kernel = "polynomial", degree = 2)

#measure training and test accuracy
pred_train <- predict(svm_model, trainset)
mean(pred_train == trainset$y)
## [1] 0.9866667
pred_test <- predict(svm_model, testset)
mean(pred_test == testset$y)
## [1] 0.98
#plot
plot(svm_model, trainset)

#tune model
tune_out <- 
    tune.svm(x = trainset[, -3], y = trainset[, 3], 
             type = "C-classification", 
             kernel = "polynomial", degree = 2, cost = 10^(-1:2), 
             gamma = c(0.1, 1, 10), coef0 = c(0.1, 1, 10))

#list optimal values
tune_out$best.parameters$cost
## [1] 0.1
tune_out$best.parameters$gamma
## [1] 10
tune_out$best.parameters$coef0
## [1] 0.1
#Build tuned model
svm_model <- svm(y ~ ., data = trainset, type = "C-classification", 
                 kernel = "polynomial", degree = 2, 
                 cost = tune_out$best.parameters$cost, 
                 gamma = tune_out$best.parameters$gamma, 
                 coef0 = tune_out$best.parameters$coef0)

#Calculate training and test accuracies
pred_train <- predict(svm_model, trainset)
mean(pred_train == trainset$y)
## [1] 0.9966667
pred_test <- predict(svm_model, testset)
mean(pred_test == testset$y)
## [1] 1
#plot model
plot(svm_model, trainset)


Chapter 4 - Radial Basis Kernel Functions

Generating complex datasets:

  • The RBF kernel is highly flexible, can fit complex boundaries, and is common in the real-world
  • Can generate complex data by using different distributions for x and y
    • n <- 600
    • set.seed(42)
    • df <- data.frame(x1 = rnorm(n, mean = -0.5, sd = 1), x2 = runif(n, min = -1, max = 1))
  • The decision boundary can then be two circles that just barely touch at the origin
    • radius <- 0.7
    • radius_squared <- radius^2
    • center_1 <- c(-0.7,0)
    • center_2 <- c(0.7,0)
    • df\(y <- factor(ifelse( (df\)x1-center_1[1])^2 + (df\(x2-center_1[2])^2 < radius_squared| (df\)x1-center_2[1])^2 + (df$x2-center_2[2])^2 < radius_squared, -1,1), levels = c(-1,1))
    • p <- ggplot(data = df, aes(x = x1, y = x2, color = y)) + geom_point() + guides(color = FALSE) + scale_color_manual(values = c(“red”,“blue”))
    • p
  • Can then build linear, polynomial, and RBF kernels to model the data

Motivating the RBF kernel:

  • Neither the linear kernel nor the polynomial kernel will work well for the dataset as described
  • Can use the heuristic that points near each other probably belong to the same class (similar to kNN)
    • The kernel should have a maximum at (a, b), and should decay as you move away from (a, b)
    • The rate of decay, all else equal should be the same in all directions, with a tunable gamma
    • As good fortune has it, the exponential exp(-gamma * r) has all of these properties
    • rbf <- function(r, gamma) exp(-gamma*r)
    • ggplot(data.frame(r = c(-0, 10)), aes(r)) +
    • stat_function(fun = rbf, args = list(gamma = 0.2), aes(color = “0.2”)) +
    • stat_function(fun = rbf, args = list(gamma = 0.4), aes(color = “0.4”)) +
    • stat_function(fun = rbf, args = list(gamma = 0.6), aes(color = “0.6”)) +
    • stat_function(fun = rbf, args = list(gamma = 0.8), aes(color = “0.8”)) +
    • stat_function(fun = rbf, args = list(gamma = 1), aes(color = “1”)) +
    • stat_function(fun = rbf, args = list(gamma = 2), aes(color = “2”)) +
    • scale_color_manual(“gamma”, values = c(“red”,“orange”,“yellow”, “green”,“blue”,“violet”)) +
    • ggtitle(“Radial basis function (gamma=0.2 to 2)”)

The RBF kernel simulates some of the principles of kNN using exponential decay:

  • The RBF kernel can be built using pre-set R commands
    • svm_model<- svm(y ~ ., data = trainset, type = “C-classification”, kernel = “radial”)
  • The predicted decision boundary will no longer be linear, and can be refined through tuning
    • tune_out <- tune.svm(x = trainset[,-3], y = trainset[,3], gamma = 5*10^(-2:2), cost = c(0.01,0.1,1,10,100), type = “C-classification”, kernel = “radial”)
    • tune_out\(best.parameters\)cost
    • tune_out\(best.parameters\)gamma
    • svm_model <- svm(y~ ., data=trainset, type=“C-classification”, kernel=“radial”, cost=tune_out\(best.parameters\)cost, gamma=tune_out\(best.parameters\)gamma)

Example code includes:

#number of data points
n <- 1000

#set seed
set.seed(1)

#create dataframe
df <- data.frame(x1 = rnorm(n, mean = -0.5, sd = 1), x2 = runif(n, min = -1, max = 1))


#set radius and centers
radius <- 0.8
center_1 <- c(-0.8, 0)
center_2 <- c(0.8, 0)
radius_squared <- radius^2

#create binary classification variable
df$y <- factor(ifelse((df$x1-center_1[1])^2 + (df$x2-center_1[2])^2 < radius_squared |
                      (df$x1-center_2[1])^2 + (df$x2-center_2[2])^2 < radius_squared, -1, 1),
                      levels = c(-1, 1))


#create scatter plot
scatter_plot<- ggplot(data = df, aes(x = x1, y = x2, color = y)) + 
    geom_point() + 
    scale_color_manual(values = c("red", "blue"))
 
scatter_plot 

# Create 75/25 split for train/test
inTrain <- sample(1:nrow(df), round(0.75*nrow(df)), replace=FALSE)
trainset <- df[sort(inTrain), ]
testset <- df[-inTrain, ]


#build model
svm_model <- svm(y ~ ., data = trainset, type = "C-classification", kernel = "linear")

#accuracy
pred_train <- predict(svm_model, trainset)
mean(pred_train == trainset$y)
## [1] 0.5853333
pred_test <- predict(svm_model, testset)
mean(pred_test == testset$y)
## [1] 0.564
#plot model against testset
plot(svm_model, testset)

#build model
svm_model <- svm(y ~ ., data = trainset, type = "C-classification", kernel = "polynomial", degree = 2)

#accuracy
pred_train <- predict(svm_model, trainset)
mean(pred_train == trainset$y)
## [1] 0.8253333
pred_test <- predict(svm_model, testset)
mean(pred_test == testset$y)
## [1] 0.788
#plot model
plot(svm_model, trainset)

#create vector to store accuracies and set random number seed
accuracy <- rep(NA, 100)
set.seed(2)


# Create a dummy frame dfDum for use in the for loop
dfDum <- df

#calculate accuracies for 100 training/test partitions
for (i in 1:100){
    dfDum[, "train"] <- ifelse(runif(nrow(dfDum))<0.8, 1, 0)
    trainset <- dfDum[dfDum$train == 1, ]
    testset <- dfDum[dfDum$train == 0, ]
    trainColNum <- grep("train", names(trainset))
    trainset <- trainset[, -trainColNum]
    testset <- testset[, -trainColNum]
    svm_model<- svm(y ~ ., data = trainset, type = "C-classification", kernel = "polynomial", degree = 2)
    pred_test <- predict(svm_model, testset)
    accuracy[i] <- mean(pred_test == testset$y)
}

#print average accuracy and standard deviation
mean(accuracy)
## [1] 0.804765
sd(accuracy)
## [1] 0.02398396
#create vector to store accuracies and set random number seed
accuracy <- rep(NA, 100)
set.seed(2)

#calculate accuracies for 100 training/test partitions
for (i in 1:100){
    dfDum[, "train"] <- ifelse(runif(nrow(dfDum))<0.8, 1, 0)
    trainset <- dfDum[dfDum$train == 1, ]
    testset <- dfDum[dfDum$train == 0, ]
    trainColNum <- grep("train", names(trainset))
    trainset <- trainset[, -trainColNum]
    testset <- testset[, -trainColNum]
    svm_model<- svm(y ~ ., data = trainset, type = "C-classification", kernel = "radial")
    pred_test <- predict(svm_model, testset)
    accuracy[i] <- mean(pred_test == testset$y)
}

#print average accuracy and standard deviation
mean(accuracy)
## [1] 0.9034203
sd(accuracy)
## [1] 0.01786378
# Re-create original 75/25 split for train/test
inTrain <- sample(1:nrow(df), round(0.75*nrow(df)), replace=FALSE)
trainset <- df[sort(inTrain), ]
testset <- df[-inTrain, ]

#tune model
tune_out <- tune.svm(x = trainset[, -3], y = trainset[, 3], 
                     gamma = 5*10^(-2:2), 
                     cost = c(0.01, 0.1, 1, 10, 100), 
                     type = "C-classification", kernel = "radial")
tune_out
## 
## Parameter tuning of 'svm':
## 
## - sampling method: 10-fold cross validation 
## 
## - best parameters:
##  gamma cost
##      5    1
## 
## - best performance: 0.04
#build tuned model
svm_model <- svm(y~ ., data = trainset, type = "C-classification", kernel = "radial", 
                 cost = tune_out$best.parameters$cost, 
                 gamma = tune_out$best.parameters$gamma)

#calculate test accuracy
pred_test <- predict(svm_model, testset)
mean(pred_test == testset$y)
## [1] 0.956
#Plot decision boundary against test data
plot(svm_model, testset)


Experimental Design in R

Chapter 1 - Introduction to Experimental Design

Introduction to experimental design:

  • Experiments start with a question in mind, then finding and analyzing data
  • This course will use open data, meaning that we do not know the original experimental design
  • Key conditions of an experiment include randomization, replication, and blocking

Hypothesis testing:

  • The null hypothesis changes depending on the question of interest - “no effect” (two-sided) or “no positive effect” (one-sided) or etc.
  • Power is the probability that the test correctly reject the null hypothesis when the alternative hypothesis is true (target >= 80%)
  • The effect size is the standardized measure of the difference that you are trying to detect
  • Sample size is generally chosen so that the effect size can be measured at the required power
  • Example of using the power package for calculating the metrics
    • library(pwr)
    • pwr.anova.test(k = 3, n = 20, f = 0.2, sig.level = 0.05, power = NULL) # one must be entered as NULL (this will be calculated) ; k groups with n per group and f effect size

Example code includes:

# load the ToothGrowth dataset
data("ToothGrowth")

#perform a two-sided t-test
t.test(x = ToothGrowth$len, alternative = "two.sided", mu = 18)
## 
##  One Sample t-test
## 
## data:  ToothGrowth$len
## t = 0.82361, df = 59, p-value = 0.4135
## alternative hypothesis: true mean is not equal to 18
## 95 percent confidence interval:
##  16.83731 20.78936
## sample estimates:
## mean of x 
##  18.81333
#perform a t-test
ToothGrowth_ttest <- t.test(len ~ supp, data = ToothGrowth)

#tidy the t-test model object
broom::tidy(ToothGrowth_ttest)
## # A tibble: 1 x 10
##   estimate estimate1 estimate2 statistic p.value parameter conf.low
##      <dbl>     <dbl>     <dbl>     <dbl>   <dbl>     <dbl>    <dbl>
## 1     3.70      20.7      17.0      1.92  0.0606      55.3   -0.171
## # ... with 3 more variables: conf.high <dbl>, method <chr>,
## #   alternative <chr>
#group by supp, dose, then examine how many observations in ToothGrowth there are by those groups
ToothGrowth %>% 
    group_by(supp, dose) %>% 
    summarize(n=n())
## # A tibble: 6 x 3
## # Groups:   supp [?]
##   supp   dose     n
##   <fct> <dbl> <int>
## 1 OJ      0.5    10
## 2 OJ      1      10
## 3 OJ      2      10
## 4 VC      0.5    10
## 5 VC      1      10
## 6 VC      2      10
#create a boxplot with geom_boxplot()
ggplot(ToothGrowth, aes(x=as.factor(dose), y=len)) + 
    geom_boxplot()

#create the ToothGrowth_aov model object
ToothGrowth_aov <- aov(len ~ dose + supp, data = ToothGrowth)

#examine the model object with summary()
summary(ToothGrowth_aov)
##             Df Sum Sq Mean Sq F value   Pr(>F)    
## dose         1 2224.3  2224.3  123.99 6.31e-16 ***
## supp         1  205.3   205.3   11.45   0.0013 ** 
## Residuals   57 1022.6    17.9                     
## ---
## Signif. codes:  0 '***' 0.001 '**' 0.01 '*' 0.05 '.' 0.1 ' ' 1
#less than
t.test(x = ToothGrowth$len, alternative = "less", mu = 18)
## 
##  One Sample t-test
## 
## data:  ToothGrowth$len
## t = 0.82361, df = 59, p-value = 0.7933
## alternative hypothesis: true mean is less than 18
## 95 percent confidence interval:
##      -Inf 20.46358
## sample estimates:
## mean of x 
##  18.81333
#greater than
t.test(x = ToothGrowth$len, alternative = "greater", mu = 18)
## 
##  One Sample t-test
## 
## data:  ToothGrowth$len
## t = 0.82361, df = 59, p-value = 0.2067
## alternative hypothesis: true mean is greater than 18
## 95 percent confidence interval:
##  17.16309      Inf
## sample estimates:
## mean of x 
##  18.81333
#calculate power
pwr::pwr.t.test(n = 100, d = 0.35, sig.level = 0.10, type = "two.sample", 
                alternative = "two.sided", power = NULL
                )
## 
##      Two-sample t test power calculation 
## 
##               n = 100
##               d = 0.35
##       sig.level = 0.1
##           power = 0.7943532
##     alternative = two.sided
## 
## NOTE: n is number in *each* group
#calculate sample size
pwr::pwr.t.test(n = NULL, d = 0.25, sig.level = 0.05, 
                type = "one.sample", alternative = "greater", power = 0.8
                )
## 
##      One-sample t test power calculation 
## 
##               n = 100.2877
##               d = 0.25
##       sig.level = 0.05
##           power = 0.8
##     alternative = greater

Chapter 2 - Basic Experiments

Single and Multiple Factor Experiments:

  • The ANOVA (Analysis of Variance) test allows for comparing means across 3-groups; is at least one mean different
    • model_1 <- lm(y ~ x, data = dataset) # first option is lm followed by aov
    • anova(model_1) # first option is lm followed by anova
    • aov(y ~ x, data = dataset) # second option is a straight call to aov
  • The multiple factor experiment includes additional potential explanatory variables
    • model2 <- lm(y ~ x + r + s + t)
    • anova(model2)
  • The Lending Club data is 890k x 75, and contains data from a lending company

Model Validation:

  • EDA is an important step prior to modeling the data
  • Boxplots can be a helpful way to explore the data
    • ggplot(data = lendingclub, aes(x = verification_status, y = funded_amnt)) + geom_boxplot()
  • ANOVA and other linear models generally assume that the residuals are normally distributed

A/B Testing:

  • A/B tests are a type of controlled experiment with only two variants of something
  • Power and sample size are crucial to A/B testing, allowing for an understanding of the required size for a desired power and expected effect size

Example code includes:

lendingclub <- readr::read_csv("./RInputFiles/lendclub.csv")
## Parsed with column specification:
## cols(
##   member_id = col_integer(),
##   loan_amnt = col_integer(),
##   funded_amnt = col_integer(),
##   term = col_character(),
##   int_rate = col_double(),
##   emp_length = col_character(),
##   home_ownership = col_character(),
##   annual_inc = col_double(),
##   verification_status = col_character(),
##   loan_status = col_character(),
##   purpose = col_character(),
##   grade = col_character()
## )
#examine the variables with glimpse()
glimpse(lendingclub)
## Observations: 1,500
## Variables: 12
## $ member_id           <int> 55096114, 1555332, 1009151, 69524202, 7212...
## $ loan_amnt           <int> 11000, 10000, 13000, 5000, 18000, 14000, 8...
## $ funded_amnt         <int> 11000, 10000, 13000, 5000, 18000, 14000, 8...
## $ term                <chr> "36 months", "36 months", "60 months", "36...
## $ int_rate            <dbl> 12.69, 6.62, 10.99, 12.05, 5.32, 16.99, 13...
## $ emp_length          <chr> "10+ years", "10+ years", "3 years", "10+ ...
## $ home_ownership      <chr> "RENT", "MORTGAGE", "MORTGAGE", "MORTGAGE"...
## $ annual_inc          <dbl> 51000, 40000, 78204, 51000, 96000, 47000, ...
## $ verification_status <chr> "Not Verified", "Verified", "Not Verified"...
## $ loan_status         <chr> "Current", "Fully Paid", "Fully Paid", "Cu...
## $ purpose             <chr> "debt_consolidation", "debt_consolidation"...
## $ grade               <chr> "C", "A", "B", "C", "A", "D", "C", "A", "D...
#find median loan_amt, mean int_rate, and mean annual_inc with summarise()
lendingclub %>% summarise(median(loan_amnt), mean(int_rate), mean(annual_inc))
## # A tibble: 1 x 3
##   `median(loan_amnt)` `mean(int_rate)` `mean(annual_inc)`
##                 <dbl>            <dbl>              <dbl>
## 1               13000             13.3             75736.
# use ggplot2 to build a bar chart of purpose
ggplot(data=lendingclub, aes(x = purpose)) + geom_bar()

#use recode() to create the new purpose_recode variable.
lendingclub$purpose_recode <- lendingclub$purpose %>% recode( 
        "credit_card" = "debt_related",
        "debt_consolidation" = "debt_related", 
        "medical" = "debt_related",
        "car" = "big_purchase", 
        "major_purchase" = "big_purchase", 
        "vacation" = "big_purchase",
        "moving" = "life_change", 
        "small_business" = "life_change", 
        "wedding" = "life_change",
        "house" = "home_related", 
        "home_improvement" = "home_related"
        )


#build a linear regression model, stored as purpose_recode_model
purpose_recode_model <- lm(funded_amnt ~ purpose_recode, data = lendingclub)

#look at results of purpose_recode_model
summary(purpose_recode_model)
## 
## Call:
## lm(formula = funded_amnt ~ purpose_recode, data = lendingclub)
## 
## Residuals:
##    Min     1Q Median     3Q    Max 
## -14472  -6251  -1322   4678  25761 
## 
## Coefficients:
##                                Estimate Std. Error t value Pr(>|t|)    
## (Intercept)                      9888.1     1248.9   7.917 4.69e-15 ***
## purpose_recodedebt_related       5433.5     1270.5   4.277 2.02e-05 ***
## purpose_recodehome_related       4845.0     1501.0   3.228  0.00127 ** 
## purpose_recodelife_change        4095.3     2197.2   1.864  0.06254 .  
## purpose_recodeother              -649.3     1598.3  -0.406  0.68461    
## purpose_recoderenewable_energy  -1796.4     4943.3  -0.363  0.71636    
## ---
## Signif. codes:  0 '***' 0.001 '**' 0.01 '*' 0.05 '.' 0.1 ' ' 1
## 
## Residual standard error: 8284 on 1494 degrees of freedom
## Multiple R-squared:  0.03473,    Adjusted R-squared:  0.0315 
## F-statistic: 10.75 on 5 and 1494 DF,  p-value: 3.598e-10
#get anova results and save as purpose_recode_anova
purpose_recode_anova <- anova(purpose_recode_model)

# look at the class of purpose_recode_anova
class(purpose_recode_anova)
## [1] "anova"      "data.frame"
#Use aov() to build purpose_recode_aov
purpose_recode_aov <- aov(funded_amnt ~ purpose_recode, data = lendingclub)

#Conduct Tukey's HSD test to create tukey_output
tukey_output <- TukeyHSD(purpose_recode_aov)

#tidy tukey_output to make sense of the results
broom::tidy(tukey_output)
## # A tibble: 15 x 6
##    term       comparison           estimate conf.low conf.high adj.p.value
##    <chr>      <chr>                   <dbl>    <dbl>     <dbl>       <dbl>
##  1 purpose_r~ debt_related-big_pu~    5434.    1808.     9059.     2.91e-4
##  2 purpose_r~ home_related-big_pu~    4845.     562.     9128.     1.61e-2
##  3 purpose_r~ life_change-big_pur~    4095.   -2174.    10365.     4.25e-1
##  4 purpose_r~ other-big_purchase      -649.   -5210.     3911.     9.99e-1
##  5 purpose_r~ renewable_energy-bi~   -1796.  -15902.    12309.     9.99e-1
##  6 purpose_r~ home_related-debt_r~    -589.   -3056.     1879.     9.84e-1
##  7 purpose_r~ life_change-debt_re~   -1338.   -6539.     3863.     9.78e-1
##  8 purpose_r~ other-debt_related     -6083.   -9005.    -3160.     5.32e-8
##  9 purpose_r~ renewable_energy-de~   -7230.  -20894.     6434.     6.58e-1
## 10 purpose_r~ life_change-home_re~    -750.   -6429.     4929.     9.99e-1
## 11 purpose_r~ other-home_related     -5494.   -9201.    -1787.     3.58e-4
## 12 purpose_r~ renewable_energy-ho~   -6641.  -20494.     7212.     7.46e-1
## 13 purpose_r~ other-life_change      -4745.  -10636.     1147.     1.95e-1
## 14 purpose_r~ renewable_energy-li~   -5892.  -20482.     8698.     8.59e-1
## 15 purpose_r~ renewable_energy-ot~   -1147.  -15088.    12794.    10.00e-1
#Use aov() to build purpose_emp_aov
purpose_emp_aov <- aov(funded_amnt ~ purpose_recode + emp_length, data=lendingclub)

#print purpose_emp_aov to the console
purpose_emp_aov
## Call:
##    aov(formula = funded_amnt ~ purpose_recode + emp_length, data = lendingclub)
## 
## Terms:
##                 purpose_recode   emp_length    Residuals
## Sum of Squares      3688783338   2044273211 100488872355
## Deg. of Freedom              5           11         1483
## 
## Residual standard error: 8231.679
## Estimated effects may be unbalanced
#call summary() to see the p-values
summary(purpose_emp_aov)
##                  Df    Sum Sq   Mean Sq F value   Pr(>F)    
## purpose_recode    5 3.689e+09 737756668  10.888 2.63e-10 ***
## emp_length       11 2.044e+09 185843019   2.743  0.00161 ** 
## Residuals      1483 1.005e+11  67760534                     
## ---
## Signif. codes:  0 '***' 0.001 '**' 0.01 '*' 0.05 '.' 0.1 ' ' 1
#examine the summary of int_rate
summary(lendingclub$int_rate)
##    Min. 1st Qu.  Median    Mean 3rd Qu.    Max. 
##    5.32    9.99   12.99   13.31   16.29   26.77
#examine int_rate by grade
lendingclub %>% 
    group_by(grade) %>% 
    summarise(mean = mean(int_rate), var = var(int_rate), median = median(int_rate))
## # A tibble: 7 x 4
##   grade  mean   var median
##   <chr> <dbl> <dbl>  <dbl>
## 1 A      7.27 0.961   7.26
## 2 B     10.9  2.08   11.0 
## 3 C     14.0  1.42   14.0 
## 4 D     17.4  1.62   17.6 
## 5 E     20.1  2.71   20.0 
## 6 F     23.6  2.87   23.5 
## 7 G     26.1  0.198  25.9
#make a boxplot of int_rate by grade
ggplot(lendingclub, aes(x = grade, y = int_rate)) + geom_boxplot()

#use aov() to create grade_aov plus call summary() to print results
grade_aov <- aov(int_rate ~ grade, data = lendingclub)
summary(grade_aov)
##               Df Sum Sq Mean Sq F value Pr(>F)    
## grade          6  27013    4502    2637 <2e-16 ***
## Residuals   1493   2549       2                   
## ---
## Signif. codes:  0 '***' 0.001 '**' 0.01 '*' 0.05 '.' 0.1 ' ' 1
#for a 2x2 grid of plots:
par(mfrow=c(2, 2))

#plot grade_aov
plot(grade_aov)

#back to defaults
par(mfrow=c(1, 1))

#Bartlett's test for homogeneity of variance
bartlett.test(int_rate ~ grade, data=lendingclub)
## 
##  Bartlett test of homogeneity of variances
## 
## data:  int_rate by grade
## Bartlett's K-squared = 78.549, df = 6, p-value = 7.121e-15
#use the correct function from pwr to find the sample size
pwr::pwr.t.test(n=NULL, d=0.2, sig.level=0.05, 
                type="two.sample", alternative="two.sided", power=0.8
                )
## 
##      Two-sample t test power calculation 
## 
##               n = 393.4057
##               d = 0.2
##       sig.level = 0.05
##           power = 0.8
##     alternative = two.sided
## 
## NOTE: n is number in *each* group
lc_A <- c(11976148, 1203719, 54998739, 5801830, 31587242, 7711391, 54494666, 57663583, 8967787, 21760921, 44765721, 8596988, 5794746, 59501253, 10578432, 36058744, 11727607, 357888, 51936863, 1178593, 57315811, 5705168, 46024211, 12947039, 57345207, 55299831, 28763037, 49763149, 20077511, 60216198, 12295190, 1570287, 61408414, 59121340, 32349527, 5773180, 26899704, 55412161, 2217935, 16462713, 9196065, 27802028, 40949245, 56007625, 56935379, 62187473, 20178048, 604912, 58533358, 652594, 44066849, 38942161, 6414816, 65617953, 51816492, 43489983, 6794967, 42345315, 59532019, 13107597, 63249029, 7371829, 12335467, 8560739, 7337238, 887484, 23493355, 41031080, 60537197, 12816159, 38446687, 51026618, 6374688, 18685270, 296645, 44439325, 4915968, 63449566, 25256236, 63407874, 36753301, 20728660, 7937228, 13058684, 636359, 50527238, 40450502, 1018943, 12438198, 3065732, 1510626, 5764344, 37840363, 27460227, 39751366, 5028066, 43956700, 56109033, 1412622, 44289534, 41770436, 49956562, 44409121, 47168726, 60953428, 52189251, 64281487, 51928150, 1002880, 4537354, 12605849, 477843, 6808167, 38629237, 33311208, 36109419, 58593881, 40362979, 440300, 9848361, 30656060, 15691500, 4375269, 15360849, 7077904, 66076532, 33350264, 4175651, 44006939, 21130605, 54098234, 53192890, 7371114, 12967808, 58061230, 34803392, 5544911, 28843825, 63244663, 38504887, 68565204, 1211255, 63427670, 56472411, 10548622, 43957279, 59313014, 5768723, 66210490, 25507112, 55472659, 61339767, 65684813, 45544639, 43710238, 46833245, 13028661, 13167268, 3064642, 62072249, 27631726, 65825964, 15540990, 64320858, 8605358, 17795606, 9894584, 543619, 2380700, 20959552, 57743104, 63917130, 38480348, 61393540, 19916851)
lc_A <- c(lc_A, 12528162, 7264617, 61480809, 36411752, 20139228, 21290880, 390228, 45584424, 17755019, 23413261, 15490914, 1254285, 875004, 24274579, 51006600, 11458143, 5125832, 37802077, 57327243, 41059894, 64978360, 58683523, 4290736, 40919379, 65029207, 7096004, 42285591, 7388784, 65914238, 46833088, 21221678, 62855006, 10557733, 44915714, 23083224, 67289213, 9746670, 349608, 66610322, 1595886, 3635144, 38419356, 9715410, 9726377, 621152, 23213635, 18685424, 65782663, 57304429, 20770003, 8865120, 58664359, 1454540, 42404539, 60952405, 61339308, 7367648, 11215938, 41207320, 23553299, 1681376, 7617266, 30485630, 10604792, 46044414, 63094909, 59189668, 10106916, 52058386, 17763104, 6396213, 8981232, 48070364, 10615808, 11956507, 38444903, 60216940, 58310439, 10099562, 7504691, 17533228, 62236540, 38626163, 55657128, 7728107, 42415348, 42454693, 4777573, 23834164, 25157042, 1339435, 50587486, 55998961, 32950014, 28422748, 492346, 50607472, 11335041, 4254623, 65058537, 5375256, 5646680, 44430975, 4054992, 55253292, 68375791, 16822421, 64978226, 59859214, 65424555, 10112206, 6908772, 67879649, 4794842, 31227479, 17423361, 64049774, 58624386, 14829134, 50233873, 44389635, 29684724, 452267, 43044890, 55942742, 19516366, 34443897, 57135665, 34392172, 17352839, 12896521, 40451807, 43255228, 40372428, 8568706, 68364520, 3486848, 40991148, 19196658, 8658538, 65885614, 38352455, 65674149, 1029473, 39290483, 47420355, 65364529, 32318884, 13115811, 48484348, 65975356, 56129109, 3378980, 31026386, 55231010, 41113253, 1480114, 51406116, 2445051, 8627441, 60942818, 55453270, 58573102, 25767158, 9655554, 49783137, 42273770, 32038806, 681948, 65059359, 48546050, 20169281, 68546780, 7065575, 46387142, 66180493, 58430918, 1390497, 41950574, 39888056, 11774847, 55308824, 51969105, 7936525, 5960208, 7700566, 14529825, 14688918, 43024566, 21110140, 55797803, 31236439, 6817136, 1467168, 36028128, 60781310, 66595886, 57548184, 3194733, 8589175, 1546517, 17654773, 40572454, 63284984, 5780985, 39660177, 64050493, 55081623, 51346675, 1235123, 65633931, 66390924, 17413278, 57950994, 55911330, 11814853, 31357211, 56038385, 40038565, 64400706, 35034758, 60296238, 6527713, 5685238, 1062701, 63406447, 64008930, 63476297, 5114652, 20060374, 10085133, 61328568, 9435001, 56057656, 49934674, 39661404, 19616499, 34342717, 46653815, 45614269, 59290211, 31296803, 50605437, 46928301, 58562582, 63879452, 65733359, 51086476, 40601201, 9845217, 29213549, 41227222, 7337659, 46517072, 38610653, 9694813, 21350102, 46716202, 50535150, 39729407, 22263578, 25987787, 64913590, 19636684, 59311687, 4295372, 571012, 20588847, 63424767, 1099384, 3810242, 5604591, 39760687, 43739869, 56019939, 51526987, 45494853, 4302122, 21009984, 66210827, 67255219, 46613149, 63345017, 43570211, 62002161, 2214708, 4234697, 51055338, 19647002, 28593783, 6804647, 40542044, 42263319, 4784593, 19636686, 44015285, 55697847, 5814660, 15409525, 2307393, 54404433, 15490230, 62245810, 64969544, 48120716, 41040511, 51176224, 6376426, 60386775, 826517, 27601385, 8185587, 28564285, 68613325, 58623041, 60941473, 1635691, 7729270, 46417835, 57285778, 55960993, 66510262, 60285691, 61902329, 68565071)


lc_B <- c(62012715, 49974687, 27570947, 63417796, 61449107, 12906517, 57074291, 21021086, 404854, 15139172, 46774978, 50486061, 4305577, 65783354, 48544529, 31667129, 36980133, 19117791, 3845908, 846821, 40381968, 64018601, 57184860, 49963980, 44142706, 6327771, 20811335, 67336862, 3628833, 31247310, 4764984, 1619549, 56492219, 67959628, 61672211, 1472227, 55268407, 13497237, 57538143, 43096178, 35723158, 226780, 2307012, 1210773, 50273799, 28903599, 50839792, 44916418, 9714937, 51876659, 3919804, 12968154, 54978278, 6938022, 53854432, 63350177, 39692948, 67216234, 22253060, 59099446, 46135199, 11717805, 48596572, 8475061, 61462130, 21480483, 2014943, 41430440, 43196143, 243173, 61543762, 66562164, 67878273, 41100627, 11915326, 28753020, 12617369, 59090559, 55583726, 31256585, 544537, 61430245, 1681767, 7670078, 38506546, 36500594, 31367711, 46694948, 2080069, 38457330, 54524836, 27651989, 63358477, 62002922, 8995111, 45694307, 61470409, 17933815, 27370082, 66612753, 1536521, 54948920, 57548472, 876991, 40127147, 57365210, 1904740, 3195692, 743529, 67408356, 8766184, 23643466, 51336378, 13397002, 3700020, 49935259, 38455198, 63506356, 11386690, 32479126, 6300017, 67427011, 63344398, 51366616, 727247, 59291548, 21551336, 8776003, 16111335, 1051513, 61973285, 60764833, 59190150, 25406927, 10138072, 61361677, 32279884, 63337618, 49933340, 30565592, 3217416, 61883095, 63436296, 58290318, 29884855, 50353289, 14699170, 67625637, 6815821, 2286867, 6274586, 17853756, 55948157, 6995898, 44126015, 66643915, 41338910, 8626219, 67858810, 38597465, 45884338, 565018, 46436141, 15259622, 6594706, 39479497, 5535388, 5855546, 48734782, 2896555, 67296211, 713979, 33110251, 8987918, 1224687, 5637315, 484473, 9814600, 29694710, 60902260, 25897153, 40705483, 1439301, 3055155, 26319992, 6245002, 66441896, 46427698, 36330836, 8915199, 46205024, 62459417, 3497439, 54888931, 30475522, 38998249, 12636103, 60536957)
lc_B <- c(lc_B, 27521279, 2365984, 361549, 43430210, 35843833, 9768308, 12705933, 59179388, 60830121, 67929084, 36138408, 854552, 8865548, 13096420, 23836169, 61502149, 1621627, 11426617, 48274995, 41123011, 7296181, 29635336, 30565882, 8145149, 46116481, 21119590, 43894290, 65866235, 44143687, 873468, 12419378, 26378681, 55140334, 56964922, 61682200, 14338072, 65047247, 57267246, 59581503, 41093708, 48524124, 513842, 1685090, 42723216, 60647576, 55341080, 9735578, 41110083, 30255415, 56010965, 63214550, 67828966, 671468, 38540004, 65107371, 18645038, 26017706, 660734, 573283, 9454644, 64017354, 617449, 7645594, 43286428, 55941273, 8636865, 31226902, 46194753, 6160505, 1412225, 65741544, 24084859, 58532795, 41880754, 45515321, 60585561, 65272380, 7937327, 1489732, 17553239, 7638498, 1473206, 38162164, 3355990, 15610681, 57025137, 6254978, 38162571, 52768311, 5938741, 58101279, 18895673, 30175739, 38222417, 55909312, 65663878, 6607837, 24725076, 61722475, 11895058, 28182084, 185962, 55259655, 16241080, 66602227, 5781939, 60801476, 6996130, 12346893, 65672013, 19076244, 1475379, 9056893, 59492895, 56864322, 60942704, 44015940, 62225220, 39739191, 66435524, 44199929, 59471139, 38547168, 6205030, 38615829, 6698930, 66514563, 1623685, 60545969, 46703319, 39739315, 12636426, 65364691, 16403147, 9204637, 19306532, 66270322, 65653692, 22313524, 59082682, 19796545, 10766253, 50436003, 49363132, 27600713, 44865530, 57763719, 47857115, 48535477, 65986020, 58603818, 42934257, 1167844, 66390187, 58281312, 63888770, 48596526, 67385135, 24775459, 55090096, 12347068, 37317537, 64007908, 1683908, 11976597, 41019342, 6855113, 7964638, 65701227, 44037648, 23133074, 9787718, 61389384, 38418035, 33130454, 13038119, 14639242, 38505864, 65725266, 62904623, 68513661, 36039498, 6538734, 51857455, 59139740, 64341225, 21430833, 55455899, 17795459, 65128493, 46428798, 43216120, 59199242, 50364311, 41079485, 27711293, 63218354, 65492649, 50819365, 40737432, 377507, 65736437, 61488876, 44886450, 31467727, 46651816, 11914779, 65352381, 24726593, 52989922, 43105128, 34322310, 8669148, 12795739, 38485516, 39559934, 4280915, 63437401, 7103037, 44946049, 15400322, 28583975, 59592185, 877645, 56019484, 3372858, 60556772, 19846532, 11658194, 6894823, 61414862, 52708301, 48806212, 12204849, 60863986, 3919883, 37661631, 47210580, 14689912, 23393084, 60961679, 6170889, 55191727, 14690280, 42415518, 65855022, 62156039, 38536464, 44603544, 63527328, 48182146, 25867085, 61952845, 4744682, 20110370, 65854766, 57722242, 11438361, 34111919, 53262232, 12247443, 64210396, 37630339, 41237564, 46722148, 65791211, 16882760, 7719304, 37622016, 3220774, 51906280, 12446784, 50064210, 57733299, 63437152, 38445791, 3730324, 56052115, 57354312, 58010576, 626701, 7224706, 64079786, 62167132, 8396526, 7625377, 12707224, 35084508, 56022111, 52027979, 43215589, 50425264, 59253209, 28312549, 67376619, 30795837, 43869662, 20849433, 55351366, 39549686, 22972745, 1025579)


# The specific member IDs in lc_A and lc_B are not in dataset lendingclub
lendingclub_ab <- lendingclub %>%
    mutate(Group=ifelse(member_id %in% lc_A, "A", ifelse(member_id %in% lc_B, "B", "C")))


# ggplot(lendingclub_ab, aes(x=Group, y=loan_amnt)) + geom_boxplot()

#conduct a two-sided t-test
# t.test(loan_amnt ~ Group, data=lendingclub_ab)


#build lendingclub_multi
# lendingclub_multi <-lm(loan_amnt ~ Group + grade + verification_status, data=lendingclub_ab)

#examine lendingclub_multi results
# broom::tidy(lendingclub_multi)

Chapter 3 - Randomized Complete (and Balanced Incomplete) Block Designs

Intro to NHANES Dataset and Sampling:

  • NHANES is the National Health and Nutrition Examination Study, run once every 2 years in the US since the late 1990s (was run on different frequency since the 1960s)
  • NHANES individuals are sampled from a scheme to match the US demographics - upsampling of elderly and minorities for sufficient sample size for statistical conclusions
  • Two key types of sampling
    • Probability sampling - probability is used to select the sample (will be covered in this course)
    • Non-probability sampling - voluntary (whoever responds), convenience (whoever the researcher can find)
  • Many types of random sampling can be run in R
    • Simple Random Sampling - sample()
    • Stratified Sampling - dataset %>% group_by(strata_variable) %>% sample_n() # sample a specified number of people inside each segment
    • Cluster Sampling - cluster(dataset, cluster_var_name, number_to_select, method = “option”) # select everyone in each randomly select cluster
    • Systematic Sampling - every 5th or 10th or etc. person (implemented by custom functions)
    • Multi-Stage Sampling - combinations of 2+ of the above approaches in a sensible and structured manner

Randomized Complete Block Designs (RCBD):

  • RCBD is run when there is a potential nuisance factor in the data that might otherwise impact the results and conclusions
    • Randomized - treatment is assigned randomly inside each block
    • Complete - each treatment is used the same number of times inside each block
    • Block - experimental groups are blocked to be similar (differences within the group are expected to be lesser than differences across the groups)
    • Design - the experiment
    • “Block what you can, randomize what you cannot”
  • The library(agricolae) allows for drawing some of the experimental designs such as an RCBD
    • library(agricolae)
    • trt <- letters[1:4]
    • rep <- 4
    • design.rcbd <- design.rcbd(trt, r = rep, seed = 42, serie = 0) # serie has to do with tagging of number blocks
    • design.rcbd$sketch

Balanced Incomplete Block Designs (BIBD):

  • Incomplete blocaks are when you cannot fully fit a treatment inside a block
    • Balanced - each pair of treatments occur together in a block an equal number of times
    • Incomplete - not every treatment will appear in every block
    • Block - experimental groups are blocked to be similar (differences within the group are expected to be lesser than differences across the groups
    • Design - the experiment
  • Suppose that t is the number of treatments, k is the number of treatments per block, and r is the number of replications
    • lambda = r * (k - 1) / (t - 1)
    • If lambda is a whole number, then a BIBD is possible; otherwise, it is not

Example code includes:

nhanes_demo <- readr::read_csv("./RInputFiles/nhanes_demo.csv")
## Parsed with column specification:
## cols(
##   .default = col_integer(),
##   wtint2yr = col_double(),
##   wtmec2yr = col_double(),
##   indfmpir = col_double()
## )
## See spec(...) for full column specifications.
nhanes_medical <- readr::read_csv("./RInputFiles/nhanes_medicalconditions.csv")
## Parsed with column specification:
## cols(
##   .default = col_integer(),
##   mcq230d = col_character(),
##   mcq240b = col_character(),
##   mcq240c = col_character(),
##   mcq240d = col_character(),
##   mcq240dk = col_character(),
##   mcq240h = col_character(),
##   mcq240i = col_character(),
##   mcq240k = col_character(),
##   mcq240q = col_character(),
##   mcq240r = col_character(),
##   mcq240s = col_character(),
##   mcq240v = col_character(),
##   mcq240y = col_character()
## )
## See spec(...) for full column specifications.
nhanes_bodymeasures <- readr::read_csv("./RInputFiles/nhanes_bodymeasures.csv")
## Parsed with column specification:
## cols(
##   .default = col_double(),
##   seqn = col_integer(),
##   bmdstats = col_integer(),
##   bmiwt = col_integer(),
##   bmirecum = col_integer(),
##   bmihead = col_character(),
##   bmiht = col_integer(),
##   bmdbmic = col_integer(),
##   bmileg = col_integer(),
##   bmiarml = col_integer(),
##   bmiarmc = col_integer(),
##   bmiwaist = col_integer(),
##   bmdsadcm = col_integer()
## )
## See spec(...) for full column specifications.
dummy_nhanes_final <- readr::read_csv("./RInputFiles/nhanes_final.csv")
## Parsed with column specification:
## cols(
##   .default = col_integer(),
##   wtint2yr = col_double(),
##   wtmec2yr = col_double(),
##   indfmpir = col_double(),
##   mcq230d = col_character(),
##   mcq240b = col_character(),
##   mcq240c = col_character(),
##   mcq240d = col_character(),
##   mcq240dk = col_character(),
##   mcq240h = col_character(),
##   mcq240i = col_character(),
##   mcq240k = col_character(),
##   mcq240q = col_character(),
##   mcq240r = col_character(),
##   mcq240s = col_character(),
##   mcq240v = col_character(),
##   mcq240y = col_character(),
##   bmxwt = col_double(),
##   bmxrecum = col_double(),
##   bmxhead = col_character(),
##   bmihead = col_character()
##   # ... with 11 more columns
## )
## See spec(...) for full column specifications.
#merge the 3 datasets you just created to create nhanes_combined
nhanes_combined <- list(nhanes_demo, nhanes_medical, nhanes_bodymeasures) %>%
  Reduce(function(df1, df2) inner_join(df1, df2, by="seqn"), .)


#fill in the dplyr code
nhanes_combined %>% group_by(mcq365d) %>% summarise(mean = mean(bmxwt, na.rm = TRUE))
## # A tibble: 4 x 2
##   mcq365d  mean
##     <int> <dbl>
## 1       1  90.7
## 2       2  76.5
## 3       9  90.8
## 4      NA  33.5
#fill in the ggplot2 code
nhanes_combined %>% filter(ridageyr > 16) %>% 
  ggplot(aes(x=as.factor(mcq365d), y=bmxwt)) +
  geom_boxplot()
## Warning: Removed 70 rows containing non-finite values (stat_boxplot).

#filter out anyone less than 16
nhanes_filter <- nhanes_combined %>% filter(ridageyr > 16)

#use simputation & impute bmxwt to fill in missing values
nhanes_final <- simputation::impute_median(nhanes_filter, bmxwt ~ riagendr)

#recode mcq365d with ifelse() & examine with table()
nhanes_final$mcq365d <- ifelse(nhanes_final$mcq365d==9, 2, nhanes_final$mcq365d)
table(nhanes_final$mcq365d)
## 
##    1    2 
## 1802 4085
#use sample() to create nhanes_srs
nhanes_srs <- nhanes_final[sample(nrow(nhanes_final), 2500), ]

#create nhanes_stratified with group_by() and sample_n()
nhanes_stratified <- nhanes_final %>%
  group_by(riagendr) %>%
  sample_n(2000)
table(nhanes_stratified$riagendr)
## 
##    1    2 
## 2000 2000
#load sampling package and create nhanes_cluster with cluster()
nhanes_cluster <- sampling::cluster(nhanes_final, "indhhin2", 6, method = "srswor")


#use str() to view design.rcbd's criteria
str(agricolae::design.rcbd)
## function (trt, r, serie = 2, seed = 0, kinds = "Super-Duper", first = TRUE, 
##     continue = FALSE, randomization = TRUE)
#build trt and rep
trt <- LETTERS[1:5]
rep <- 4

#Use trt and rep to build my.design.rcbd and view the sketch part of the object
my_design_rcbd <- agricolae::design.rcbd(trt, r=rep, seed = 42, serie=0)
my_design_rcbd$sketch
##      [,1] [,2] [,3] [,4] [,5]
## [1,] "D"  "E"  "A"  "C"  "B" 
## [2,] "B"  "C"  "A"  "E"  "D" 
## [3,] "C"  "D"  "A"  "E"  "B" 
## [4,] "A"  "C"  "B"  "D"  "E"
#make nhanes_final$riagendr a factor variable
nhanes_final$riagendr <- factor(nhanes_final$riagendr)

#use aov() to create nhanes_rcbd
nhanes_rcbd <- aov(bmxwt ~ mcq365d + riagendr, data=nhanes_final)

#check the results of nhanes_rcbd with summary()
summary(nhanes_rcbd)
##               Df  Sum Sq Mean Sq F value Pr(>F)    
## mcq365d        1  228651  228651   568.8 <2e-16 ***
## riagendr       1  159706  159706   397.3 <2e-16 ***
## Residuals   5884 2365187     402                   
## ---
## Signif. codes:  0 '***' 0.001 '**' 0.01 '*' 0.05 '.' 0.1 ' ' 1
#print the difference in weights by mcq365d and riagendr
nhanes_final %>% group_by(mcq365d, riagendr) %>% summarise(mean_wt = mean(bmxwt))
## # A tibble: 4 x 3
## # Groups:   mcq365d [?]
##   mcq365d riagendr mean_wt
##     <dbl> <fct>      <dbl>
## 1       1 1           95.1
## 2       1 2           86.7
## 3       2 1           82.6
## 4       2 2           71.3
#set up the 2x2 plotting grid and then plot nhanes_rcbd
par(mfrow=c(2, 2))
plot(nhanes_rcbd)

par(mfrow=c(1, 1))

#run the code to view the interaction plots
with(nhanes_final, interaction.plot(mcq365d, riagendr, bmxwt))

#run the code to view the interaction plots
with(nhanes_final, interaction.plot(riagendr, mcq365d, bmxwt))

#create my_design_bibd_1
# my_design_bibd_1 <- design.bib(LETTERS[1:3], k = 4, r = 16, serie = 0, seed = 42)  # will throw an error

#create my_design_bibd_2
# my_design_bibd_2 <- design.bib(letters[1:2], k = 3, r = 5, serie = 0, seed = 42)  # will throw warning

#create my_design_bibd_3
my_design_bibd_3 <- agricolae::design.bib(letters[1:4], k = 4, r = 6, serie = 0, seed = 42)
## 
## Parameters BIB
## ==============
## Lambda     : 6
## treatmeans : 4
## Block size : 4
## Blocks     : 6
## Replication: 6 
## 
## Efficiency factor 1 
## 
## <<< Book >>>
my_design_bibd_3$sketch
##      [,1] [,2] [,3] [,4]
## [1,] "d"  "b"  "a"  "c" 
## [2,] "d"  "c"  "b"  "a" 
## [3,] "c"  "d"  "b"  "a" 
## [4,] "a"  "b"  "d"  "c" 
## [5,] "b"  "d"  "a"  "c" 
## [6,] "a"  "b"  "d"  "c"
lambda <- function(t, k, r){
  return((r*(k-1)) / (t-1))
}

#calculate lambda
lambda(4, 3, 3)
## [1] 2
#build the data.frame
creatinine <- c(1.98, 1.97, 2.35, 2.09, 1.87, 1.95, 2.08, 2.01, 1.84, 2.06, 1.97, 2.22)
food <- as.factor(c("A", "C", "D", "A", "B", "C", "B", "C", "D", "A", "B", "D"))
color <- as.factor(rep(c("Black", "White", "Orange", "Spotted"), each = 3))
cat_experiment <- as.data.frame(cbind(creatinine, food, color))

#create cat_model & then wrong_cat_model and examine them with summary()
cat_model <- aov(creatinine ~ food + color, data=cat_experiment)
summary(cat_model)
##             Df  Sum Sq  Mean Sq F value Pr(>F)
## food         1 0.01204 0.012042   0.530  0.485
## color        1 0.00697 0.006971   0.307  0.593
## Residuals    9 0.20461 0.022735
#calculate lambda
lambda(3, 3, 2)
## [1] 2
#create weightlift_model & examine results (variable does not exist in dataset)
# weightlift_model <- aov(bmxarmc ~ weightlift_treat + ridreth1, data=nhanes_final)
# summary(weightlift_model)

Chapter 4 - Latin Squares, Graeco-Latin Squares, Factorial Experiments

Latin Squares have two blocking factors, assumed not to interact with each other or the treatment, and each with the same number of levels:

  • Latin squares can be analyzed just like an RCBD
  • In a Latin square, both the rows and the columns are the blocking factors
  • Can use nyc_scores dataset containing reading, writing, and math scores from all accredited high schools
    • Goal is to assess the impact of a (fabricated) tutoring program on the scores by school

Graeco-Latin Squares builds on Latin squares by adding an additional blocking factor:

  • Three blocking factors, all with the same number of levels, and assumed not to interact with each other or the treatment
    • Greek letters added next to the Latin letters indicate the third blocking factors (can use Latin and numbers instead)
    • All of the combinations occur only once (each letter once per row/column, and each number once per letter)

Factorial Experiments - designs in which 2+ variables are crossed in an experiment, with each combination considered a factor:

  • Example of testing all combinations of high/low water and high/low light - each combination is tested, with TukeyHSD() applied after
  • This course will focus on 2^k factor experiments, meaning that each level has only a High/Low (or similar) possibility

Next steps:

  • Many other types of factorial designs - do not all need to be 2**k, with many factor levels
    • Might consider a fractional factorial design to minimize the analytical burden
  • Design should be a valued and integrated part of the process
  • There will always be some unmeasured confounders, but good design can help to reduce that noise

Example code includes:

nyc_scores <- readr::read_csv("./RInputFiles/nyc_scores.csv")
## Parsed with column specification:
## cols(
##   .default = col_character(),
##   Zip_Code = col_integer(),
##   Latitude = col_double(),
##   Longitude = col_double(),
##   Start_Time = col_time(format = ""),
##   End_Time = col_time(format = ""),
##   Student_Enrollment = col_integer(),
##   Percent_White = col_double(),
##   Percent_Black = col_double(),
##   Percent_Hispanic = col_double(),
##   Percent_Asian = col_double(),
##   Average_Score_SAT_Math = col_integer(),
##   Average_Score_SAT_Reading = col_integer(),
##   Average_Score_SAT_Writing = col_integer(),
##   Percent_Tested = col_double()
## )
## See spec(...) for full column specifications.
glimpse(nyc_scores)
## Observations: 435
## Variables: 22
## $ School_ID                 <chr> "02M260", "06M211", "01M539", "02M29...
## $ School_Name               <chr> "Clinton School Writers and Artists"...
## $ Borough                   <chr> "Manhattan", "Manhattan", "Manhattan...
## $ Building_Code             <chr> "M933", "M052", "M022", "M445", "M44...
## $ Street_Address            <chr> "425 West 33rd Street", "650 Academy...
## $ City                      <chr> "Manhattan", "Manhattan", "Manhattan...
## $ State                     <chr> "NY", "NY", "NY", "NY", "NY", "NY", ...
## $ Zip_Code                  <int> 10001, 10002, 10002, 10002, 10002, 1...
## $ Latitude                  <dbl> 40.75321, 40.86605, 40.71873, 40.716...
## $ Longitude                 <dbl> -73.99786, -73.92486, -73.97943, -73...
## $ Phone_Number              <chr> "212-695-9114", "718-935-3660", "212...
## $ Start_Time                <time>       NA, 08:30:00, 08:15:00, 08:00...
## $ End_Time                  <time>       NA, 15:00:00, 16:00:00, 14:45...
## $ Student_Enrollment        <int> NA, 87, 1735, 358, 383, 416, 255, 54...
## $ Percent_White             <dbl> NA, 0.03, 0.29, 0.12, 0.03, 0.02, 0....
## $ Percent_Black             <dbl> NA, 0.22, 0.13, 0.39, 0.28, 0.03, 0....
## $ Percent_Hispanic          <dbl> NA, 0.68, 0.18, 0.41, 0.57, 0.06, 0....
## $ Percent_Asian             <dbl> NA, 0.05, 0.39, 0.06, 0.09, 0.89, 0....
## $ Average_Score_SAT_Math    <int> NA, NA, 657, 395, 418, 613, 410, 634...
## $ Average_Score_SAT_Reading <int> NA, NA, 601, 411, 428, 453, 406, 641...
## $ Average_Score_SAT_Writing <int> NA, NA, 601, 387, 415, 463, 381, 639...
## $ Percent_Tested            <dbl> NA, NA, 0.91, 0.79, 0.65, 0.96, 0.60...
tEL <- c('PhD', 'BA', 'BA', 'MA', 'MA', 'PhD', 'MA', 'MA', 'BA', 'PhD', 'College Student', 'College Student', 'Grad Student', 'MA', 'MA', 'MA', 'BA', 'MA', 'BA', 'MA', 'College Student', 'PhD', 'MA', 'MA', 'BA', 'MA', 'College Student', 'BA', 'PhD', 'Grad Student', 'MA', 'Grad Student', 'MA', 'College Student', 'Grad Student', 'MA', 'Grad Student', 'BA', 'BA', 'College Student', 'Grad Student', 'College Student', 'BA', 'BA', 'PhD', 'BA', 'Grad Student', 'Grad Student', 'College Student', 'College Student', 'BA', 'PhD', 'College Student', 'PhD', 'PhD', 'PhD', 'College Student', 'Grad Student', 'MA', 'MA', 'BA', 'PhD', 'College Student', 'MA', 'MA', 'College Student', 'Grad Student', 'MA', 'PhD', 'MA', 'College Student', 'MA', 'PhD', 'MA', 'College Student', 'College Student', 'Grad Student', 'PhD', 'MA', 'MA', 'Grad Student', 'MA', 'MA', 'Grad Student', 'PhD', 'Grad Student', 'Grad Student', 'Grad Student', 'MA', 'PhD', 'BA', 'MA', 'Grad Student', 'BA', 'College Student', 'MA', 'College Student', 'Grad Student', 'Grad Student', 'College Student', 'MA', 'BA', 'BA', 'MA', 'MA', 'Grad Student', 'MA', 'Grad Student', 'MA', 'Grad Student', 'College Student', 'College Student', 'College Student', 'MA', 'BA', 'Grad Student', 'Grad Student', 'MA', 'College Student', 'BA', 'Grad Student', 'MA', 'Grad Student', 'PhD', 'MA', 'MA', 'College Student', 'MA', 'College Student', 'PhD', 'College Student', 'MA', 'MA', 'MA', 'MA', 'College Student', 'MA', 'BA', 'MA', 'Grad Student', 'BA', 'MA', 'MA', 'Grad Student', 'MA', 'MA', 'College Student', 'MA', 'MA', 'BA', 'MA', 'College Student', 'Grad Student', 'College Student', 'MA', 'BA', 'MA', 'BA', 'College Student', 'Grad Student', 'Grad Student', 'Grad Student', 'Grad Student', 'Grad Student', 'MA', 'BA', 'MA', 'BA', 'College Student', 'MA', 'BA', 'MA', 'Grad Student', 'MA', 'PhD', 'MA', 'BA', 'Grad Student', 'MA', 'BA', 'BA', 'MA', 'BA', 'College Student', 'BA', 'MA', 'MA', 'BA', 'MA', 'College Student', 'BA', 'Grad Student', 'MA', 'BA', 'MA', 'MA', 'MA', 'BA', 'College Student', 'College Student')
tEL <- c(tEL, 'BA', 'Grad Student', 'BA', 'BA', 'MA', 'Grad Student', 'BA', 'MA', 'BA', 'PhD', 'MA', 'MA', 'MA', 'BA', 'College Student', 'PhD', 'BA', 'Grad Student', 'BA', 'College Student', 'BA', 'MA', 'College Student', 'MA', 'College Student', 'Grad Student', 'College Student', 'MA', 'PhD', 'BA', 'PhD', 'Grad Student', 'BA', 'BA', 'MA', 'MA', 'BA', 'PhD', 'College Student', 'MA', 'BA', 'College Student', 'BA', 'MA', 'College Student', 'MA', 'College Student', 'BA', 'MA', 'BA', 'BA', 'MA', 'PhD', 'BA', 'MA', 'Grad Student', 'College Student', 'MA', 'College Student', 'MA', 'MA', 'PhD', 'College Student', 'College Student', 'Grad Student', 'Grad Student', 'MA', 'College Student', 'Grad Student', 'Grad Student', 'Grad Student', 'MA', 'Grad Student', 'MA', 'BA', 'College Student', 'MA', 'Grad Student', 'College Student', 'MA', 'BA', 'BA', 'College Student', 'College Student', 'College Student', 'College Student', 'College Student', 'PhD', 'MA', 'College Student', 'MA', 'MA', 'MA', 'PhD', 'College Student', 'College Student', 'MA', 'MA', 'MA', 'PhD', 'MA', 'MA', 'PhD', 'MA', 'Grad Student', 'MA', 'Grad Student', 'MA', 'Grad Student', 'MA', 'MA', 'PhD', 'BA', 'BA', 'Grad Student', 'Grad Student', 'PhD', 'BA', 'BA', 'Grad Student', 'College Student', 'BA', 'College Student', 'MA', 'MA', 'MA', 'Grad Student', 'BA', 'BA', 'MA', 'Grad Student', 'PhD', 'BA', 'Grad Student', 'Grad Student', 'Grad Student', 'BA', 'MA', 'BA', 'College Student', 'College Student', 'Grad Student', 'MA', 'Grad Student', 'Grad Student', 'BA', 'BA', 'MA', 'College Student', 'BA', 'Grad Student', 'Grad Student', 'College Student', 'Grad Student', 'College Student', 'PhD', 'BA', 'MA', 'MA', 'BA', 'College Student', 'College Student', 'PhD', 'MA', 'BA', 'MA', 'MA', 'Grad Student', 'MA', 'PhD', 'MA', 'MA', 'Grad Student', 'College Student', 'MA', 'BA', 'BA', 'College Student', 'Grad Student', 'BA', 'MA', 'MA', 'Grad Student', 'BA', 'Grad Student', 'Grad Student', 'MA', 'PhD', 'Grad Student', 'Grad Student', 'MA', 'MA', 'PhD', 'College Student', 'College Student', 'MA', 'BA', 'MA', 'College Student', 'MA', 'PhD', 'BA', 'MA', 'College Student', 'PhD', 'PhD', 'College Student', 'MA', 'MA', 'MA', 'PhD', 'MA', 'BA', 'College Student', 'BA', 'BA', 'MA', 'MA', 'College Student', 'College Student', 'Grad Student', 'College Student', 'MA', 'MA', 'MA', 'Grad Student', 'MA', 'College Student', 'Grad Student', 'BA', 'Grad Student', 'BA', 'MA', 'College Student', 'MA')


nyc_scores <- nyc_scores %>%
    mutate(Teacher_Education_Level=tEL)
glimpse(nyc_scores)
## Observations: 435
## Variables: 23
## $ School_ID                 <chr> "02M260", "06M211", "01M539", "02M29...
## $ School_Name               <chr> "Clinton School Writers and Artists"...
## $ Borough                   <chr> "Manhattan", "Manhattan", "Manhattan...
## $ Building_Code             <chr> "M933", "M052", "M022", "M445", "M44...
## $ Street_Address            <chr> "425 West 33rd Street", "650 Academy...
## $ City                      <chr> "Manhattan", "Manhattan", "Manhattan...
## $ State                     <chr> "NY", "NY", "NY", "NY", "NY", "NY", ...
## $ Zip_Code                  <int> 10001, 10002, 10002, 10002, 10002, 1...
## $ Latitude                  <dbl> 40.75321, 40.86605, 40.71873, 40.716...
## $ Longitude                 <dbl> -73.99786, -73.92486, -73.97943, -73...
## $ Phone_Number              <chr> "212-695-9114", "718-935-3660", "212...
## $ Start_Time                <time>       NA, 08:30:00, 08:15:00, 08:00...
## $ End_Time                  <time>       NA, 15:00:00, 16:00:00, 14:45...
## $ Student_Enrollment        <int> NA, 87, 1735, 358, 383, 416, 255, 54...
## $ Percent_White             <dbl> NA, 0.03, 0.29, 0.12, 0.03, 0.02, 0....
## $ Percent_Black             <dbl> NA, 0.22, 0.13, 0.39, 0.28, 0.03, 0....
## $ Percent_Hispanic          <dbl> NA, 0.68, 0.18, 0.41, 0.57, 0.06, 0....
## $ Percent_Asian             <dbl> NA, 0.05, 0.39, 0.06, 0.09, 0.89, 0....
## $ Average_Score_SAT_Math    <int> NA, NA, 657, 395, 418, 613, 410, 634...
## $ Average_Score_SAT_Reading <int> NA, NA, 601, 411, 428, 453, 406, 641...
## $ Average_Score_SAT_Writing <int> NA, NA, 601, 387, 415, 463, 381, 639...
## $ Percent_Tested            <dbl> NA, NA, 0.91, 0.79, 0.65, 0.96, 0.60...
## $ Teacher_Education_Level   <chr> "PhD", "BA", "BA", "MA", "MA", "PhD"...
#mean, var, and median of Math score
nyc_scores %>%
    group_by(Borough) %>% 
    summarise(mean = mean(Average_Score_SAT_Math, na.rm=TRUE),
              var = var(Average_Score_SAT_Math, na.rm=TRUE),
              median = median(Average_Score_SAT_Math, na.rm=TRUE))
## # A tibble: 5 x 4
##   Borough        mean   var median
##   <chr>         <dbl> <dbl>  <dbl>
## 1 Bronx          404. 2727.   396.
## 2 Brooklyn       416. 3658.   395 
## 3 Manhattan      456. 7026.   433 
## 4 Queens         462. 5168.   448 
## 5 Staten Island  486. 6911.   466.
#mean, var, and median of Math score
nyc_scores %>%
    group_by(Teacher_Education_Level) %>% 
    summarise(mean = mean(Average_Score_SAT_Math, na.rm=TRUE),
              var = var(Average_Score_SAT_Math, na.rm=TRUE),
              median = median(Average_Score_SAT_Math, na.rm=TRUE))
## # A tibble: 5 x 4
##   Teacher_Education_Level  mean   var median
##   <chr>                   <dbl> <dbl>  <dbl>
## 1 BA                       438. 5536.   418 
## 2 College Student          424. 4807.   400.
## 3 Grad Student             437. 7071.   410 
## 4 MA                       432. 4304.   415 
## 5 PhD                      435. 4869.   420.
#mean, var, and median of Math score
nyc_scores %>%
    group_by(Borough, Teacher_Education_Level) %>% 
    summarise(mean = mean(Average_Score_SAT_Math, na.rm=TRUE),
              var = var(Average_Score_SAT_Math, na.rm=TRUE),
              median = median(Average_Score_SAT_Math, na.rm=TRUE))
## # A tibble: 24 x 5
## # Groups:   Borough [?]
##    Borough  Teacher_Education_Level  mean   var median
##    <chr>    <chr>                   <dbl> <dbl>  <dbl>
##  1 Bronx    BA                       428. 7446.   407 
##  2 Bronx    College Student          384.  493.   382 
##  3 Bronx    Grad Student             400. 1776.   397 
##  4 Bronx    MA                       401.  901.   395 
##  5 Bronx    PhD                      400. 2468.   386 
##  6 Brooklyn BA                       425. 4005.   405 
##  7 Brooklyn College Student          396. 3035.   382 
##  8 Brooklyn Grad Student             436. 5756.   408 
##  9 Brooklyn MA                       414. 2401.   395 
## 10 Brooklyn PhD                      402  1868.   394.
## # ... with 14 more rows
# If we want to use SAT scores as our outcome, we need to examine their missingness
# First, look at the pattern of missingness using md.pattern() from the mice package
# There are 60 scores missing in each of the scores
# There are many R packages which help with more advanced forms of imputation, such as MICE, Amelia, mi, and more
# We will use the simputation andimpute_median() as we did previously

#examine missingness with md.pattern()
mice::md.pattern(nyc_scores)

##     School_ID School_Name Borough Building_Code Street_Address City State
## 374         1           1       1             1              1    1     1
## 11          1           1       1             1              1    1     1
## 42          1           1       1             1              1    1     1
## 4           1           1       1             1              1    1     1
## 1           1           1       1             1              1    1     1
## 3           1           1       1             1              1    1     1
##             0           0       0             0              0    0     0
##     Zip_Code Latitude Longitude Phone_Number Teacher_Education_Level
## 374        1        1         1            1                       1
## 11         1        1         1            1                       1
## 42         1        1         1            1                       1
## 4          1        1         1            1                       1
## 1          1        1         1            1                       1
## 3          1        1         1            1                       1
##            0        0         0            0                       0
##     Start_Time End_Time Student_Enrollment Percent_White Percent_Black
## 374          1        1                  1             1             1
## 11           1        1                  1             1             1
## 42           1        1                  1             1             1
## 4            1        1                  0             0             0
## 1            0        0                  1             1             1
## 3            0        0                  0             0             0
##              4        4                  7             7             7
##     Percent_Hispanic Percent_Asian Percent_Tested Average_Score_SAT_Math
## 374                1             1              1                      1
## 11                 1             1              1                      0
## 42                 1             1              0                      0
## 4                  0             0              0                      0
## 1                  1             1              1                      1
## 3                  0             0              0                      0
##                    7             7             49                     60
##     Average_Score_SAT_Reading Average_Score_SAT_Writing    
## 374                         1                         1   0
## 11                          0                         0   3
## 42                          0                         0   4
## 4                           0                         0   9
## 1                           1                         1   2
## 3                           0                         0  11
##                            60                        60 272
#impute the Math, Writing, and Reading scores by Borough
nyc_scores_2 <- simputation::impute_median(nyc_scores, Average_Score_SAT_Math ~ Borough)

#convert Math score to numeric
nyc_scores_2$Average_Score_SAT_Math <- as.numeric(nyc_scores_2$Average_Score_SAT_Math)

#examine scores by Borough in both datasets, before and after imputation
nyc_scores %>% 
  group_by(Borough) %>% 
  summarise(median = median(Average_Score_SAT_Math, na.rm = TRUE), mean = mean(Average_Score_SAT_Math, na.rm = TRUE))
## # A tibble: 5 x 3
##   Borough       median  mean
##   <chr>          <dbl> <dbl>
## 1 Bronx           396.  404.
## 2 Brooklyn        395   416.
## 3 Manhattan       433   456.
## 4 Queens          448   462.
## 5 Staten Island   466.  486.
nyc_scores_2 %>% 
  group_by(Borough) %>% 
  summarise(median = median(Average_Score_SAT_Math, na.rm = TRUE), mean = mean(Average_Score_SAT_Math, na.rm = TRUE))
## # A tibble: 5 x 3
##   Borough       median  mean
##   <chr>          <dbl> <dbl>
## 1 Bronx           395   403.
## 2 Brooklyn        399   418.
## 3 Manhattan       418   446.
## 4 Queens          448   460.
## 5 Staten Island   466.  486.
#design a LS with 5 treatments A:E then look at the sketch
my_design_lsd <- agricolae::design.lsd(LETTERS[1:5], serie=0, seed=42)
my_design_lsd$sketch
##      [,1] [,2] [,3] [,4] [,5]
## [1,] "B"  "E"  "D"  "A"  "C" 
## [2,] "A"  "D"  "C"  "E"  "B" 
## [3,] "E"  "C"  "B"  "D"  "A" 
## [4,] "C"  "A"  "E"  "B"  "D" 
## [5,] "D"  "B"  "A"  "C"  "E"
# To execute a Latin Square design on this data, suppose we want to know the effect of of our tutoring program, which includes one-on-one tutoring, two small groups, and an in and after school SAT prep class
# A new dataset nyc_scores_ls is available that represents this experiment. Feel free to explore the dataset in the console.

# We'll block by Borough and Teacher_Education_Level to reduce their known variance on the score outcome
# Borough is a good blocking factor because schools in America are funded partly based on taxes paid in each city, so it will likely make a difference on quality of education

lsID <- c('11X290', '10X342', '09X260', '09X412', '12X479', '14K478', '32K554', '14K685', '22K405', '17K382', '05M692', '02M427', '02M308', '03M402', '02M282', '30Q501', '26Q495', '24Q455', '29Q326', '25Q670', '31R450', '31R445', '31R080', '31R460', '31R455')
lsTP <- c('One-on-One', 'Small Groups (2-3)', 'Small Groups (4-6)', 'SAT Prep Class (school hours)', 'SAT Prep Class (after school)', 'Small Groups (2-3)', 'Small Groups (4-6)', 'SAT Prep Class (school hours)', 'SAT Prep Class (after school)', 'One-on-One', 'Small Groups (4-6)', 'SAT Prep Class (school hours)', 'SAT Prep Class (after school)', 'One-on-One', 'Small Groups (2-3)', 'SAT Prep Class (school hours)', 'SAT Prep Class (after school)', 'One-on-One', 'Small Groups (2-3)', 'Small Groups (4-6)', 'SAT Prep Class (after school)', 'One-on-One', 'Small Groups (2-3)', 'Small Groups (4-6)', 'SAT Prep Class (school hours)')

nyc_scores_ls <- nyc_scores_2 %>%
    filter(School_ID %in% lsID) %>%
    mutate(Tutoring_Program=lsTP)


#build nyc_scores_ls_lm
nyc_scores_ls_lm <- lm(Average_Score_SAT_Math ~ Tutoring_Program + Borough + Teacher_Education_Level,
                       data=nyc_scores_ls
                       )

#tidy the results with broom
nyc_scores_ls_lm %>% broom::tidy()
## # A tibble: 13 x 5
##    term                               estimate std.error statistic p.value
##    <chr>                                 <dbl>     <dbl>     <dbl>   <dbl>
##  1 (Intercept)                           389.       71.6     5.44  1.50e-4
##  2 Tutoring_ProgramSAT Prep Class (a~    -11.2      50.4    -0.223 8.27e-1
##  3 Tutoring_ProgramSAT Prep Class (s~     19.3      64.2     0.301 7.69e-1
##  4 Tutoring_ProgramSmall Groups (2-3)    -41.3      59.4    -0.696 5.00e-1
##  5 Tutoring_ProgramSmall Groups (4-6)    -47.4      50.4    -0.941 3.65e-1
##  6 BoroughBrooklyn                        66.5      60.3     1.10  2.92e-1
##  7 BoroughManhattan                       52.2      53.8     0.970 3.51e-1
##  8 BoroughQueens                          88.3      59.9     1.47  1.67e-1
##  9 BoroughStaten Island                   54.1      49.9     1.09  2.99e-1
## 10 Teacher_Education_LevelCollege St~     29.1      82.2     0.354 7.29e-1
## 11 Teacher_Education_LevelGrad Stude~     79.7      65.2     1.22  2.45e-1
## 12 Teacher_Education_LevelMA              16.2      47.1     0.343 7.37e-1
## 13 Teacher_Education_LevelPhD            -70.7     103.     -0.686 5.06e-1
#examine the results with anova
nyc_scores_ls_lm %>% anova()
## Analysis of Variance Table
## 
## Response: Average_Score_SAT_Math
##                         Df Sum Sq Mean Sq F value Pr(>F)
## Tutoring_Program         4  41411 10352.8  1.7582 0.2021
## Borough                  4  13297  3324.3  0.5646 0.6931
## Teacher_Education_Level  4  16734  4183.5  0.7105 0.6003
## Residuals               12  70658  5888.2
#create a boxplot of Math scores by Borough, with a title and x/y axis labels
ggplot(nyc_scores, aes(x=Borough, y=Average_Score_SAT_Math)) + 
  geom_boxplot() + 
  ggtitle("Average SAT Math Scores by Borough, NYC") + 
  xlab("Borough (NYC)") + 
  ylab("Average SAT Math Scores (2014-15)")
## Warning: Removed 60 rows containing non-finite values (stat_boxplot).

#create trt1 and trt2
trt1 <- LETTERS[1:5]
trt2 <- 1:5

#create my_graeco_design
my_graeco_design <- agricolae::design.graeco(trt1, trt2, serie=0, seed=42)

#examine the parameters and sketch
my_graeco_design$parameters
## $design
## [1] "graeco"
## 
## $trt1
## [1] "A" "B" "C" "D" "E"
## 
## $trt2
## [1] 1 2 3 4 5
## 
## $r
## [1] 5
## 
## $serie
## [1] 0
## 
## $seed
## [1] 42
## 
## $kinds
## [1] "Super-Duper"
## 
## [[8]]
## [1] TRUE
my_graeco_design$sketch
##      [,1]  [,2]  [,3]  [,4]  [,5] 
## [1,] "D 2" "E 3" "A 1" "C 5" "B 4"
## [2,] "E 1" "A 5" "C 4" "B 2" "D 3"
## [3,] "A 4" "C 2" "B 3" "D 1" "E 5"
## [4,] "C 3" "B 1" "D 5" "E 4" "A 2"
## [5,] "B 5" "D 4" "E 2" "A 3" "C 1"
glsID <- c('09X241', '10X565', '09X260', '07X259', '11X455', '18K563', '23K697', '32K403', '22K425', '16K688', '02M135', '06M348', '02M419', '02M489', '04M495', '30Q502', '24Q530', '30Q555', '24Q560', '27Q650', '31R440', '31R064', '31R450', '31R445', '31R460')
glsTP <- c('SAT Prep Class (school hours)', 'SAT Prep Class (after school)', 'One-on-One', 'Small Groups (4-6)', 'Small Groups (2-3)', 'SAT Prep Class (after school)', 'One-on-One', 'Small Groups (4-6)', 'Small Groups (2-3)', 'SAT Prep Class (school hours)', 'One-on-One', 'Small Groups (4-6)', 'Small Groups (2-3)', 'SAT Prep Class (school hours)', 'SAT Prep Class (after school)', 'Small Groups (4-6)', 'Small Groups (2-3)', 'SAT Prep Class (school hours)', 'SAT Prep Class (after school)', 'One-on-One', 'Small Groups (2-3)', 'SAT Prep Class (school hours)', 'SAT Prep Class (after school)', 'One-on-One', 'Small Groups (4-6)')
glsHT <- c('Small Group', 'Large Group', 'Individual', 'Mix of Large Group/Individual', 'Mix of Small Group/Individual', 'Individual', 'Mix of Large Group/Individual', 'Mix of Small Group/Individual', 'Small Group', 'Large Group', 'Mix of Small Group/Individual', 'Small Group', 'Large Group', 'Individual', 'Mix of Large Group/Individual', 'Large Group', 'Individual', 'Mix of Large Group/Individual', 'Mix of Small Group/Individual', 'Small Group', 'Mix of Large Group/Individual', 'Mix of Small Group/Individual', 'Small Group', 'Large Group', 'Individual')


nyc_scores_gls <- nyc_scores_2 %>%
    filter(School_ID %in% glsID) %>%
    mutate(Tutoring_Program=glsTP, Homework_Type=glsHT)


#build nyc_scores_gls_lm
nyc_scores_gls_lm <- lm(Average_Score_SAT_Math ~ Tutoring_Program + Borough + Teacher_Education_Level + Homework_Type, data=nyc_scores_gls)

#tidy the results with broom
nyc_scores_gls_lm %>% broom::tidy()
## # A tibble: 17 x 5
##    term                             estimate std.error statistic   p.value
##    <chr>                               <dbl>     <dbl>     <dbl>     <dbl>
##  1 (Intercept)                        366.        27.7    13.2     1.01e-6
##  2 Tutoring_ProgramSAT Prep Class ~    48.6       23.4     2.08    7.13e-2
##  3 Tutoring_ProgramSAT Prep Class ~    31.9       25.3     1.26    2.42e-1
##  4 Tutoring_ProgramSmall Groups (2~    37.0       23.5     1.57    1.55e-1
##  5 Tutoring_ProgramSmall Groups (4~    63.3       23.6     2.68    2.81e-2
##  6 BoroughBrooklyn                    -20.6       24.8    -0.828   4.32e-1
##  7 BoroughManhattan                     8.16      24.1     0.339   7.44e-1
##  8 BoroughQueens                       42.9       21.4     2.01    7.96e-2
##  9 BoroughStaten Island                26.8       19.7     1.36    2.12e-1
## 10 Teacher_Education_LevelCollege ~    -4.76      26.3    -0.181   8.61e-1
## 11 Teacher_Education_LevelGrad Stu~    37.0       34.5     1.07    3.15e-1
## 12 Teacher_Education_LevelMA           16.8       19.7     0.852   4.19e-1
## 13 Teacher_Education_LevelPhD          13.8       31.3     0.443   6.70e-1
## 14 Homework_TypeLarge Group             5.25      22.2     0.236   8.19e-1
## 15 Homework_TypeMix of Large Group~    -7.21      22.8    -0.317   7.60e-1
## 16 Homework_TypeMix of Small Group~    12.4       21.5     0.575   5.81e-1
## 17 Homework_TypeSmall Group            56.0       24.4     2.30    5.04e-2
#examine the results with anova
nyc_scores_gls_lm %>% anova()
## Analysis of Variance Table
## 
## Response: Average_Score_SAT_Math
##                         Df  Sum Sq Mean Sq F value  Pr(>F)  
## Tutoring_Program         4 18568.4  4642.1  5.1436 0.02384 *
## Borough                  4  5321.8  1330.5  1.4742 0.29623  
## Teacher_Education_Level  4  3449.6   862.4  0.9556 0.48085  
## Homework_Type            4 10153.2  2538.3  2.8125 0.09956 .
## Residuals                8  7220.0   902.5                  
## ---
## Signif. codes:  0 '***' 0.001 '**' 0.01 '*' 0.05 '.' 0.1 ' ' 1
pctTHL <- c(1, 1, 2, 2, 2, 2, 1, 2, 2, 1, 2, 2, 2, 2, 2, 1, 1, 1, 2, 2, 2, 1, 2, 2, 2, 1, 2, 2, 1, 2, 2, 1, 2, 1, 2, 2, 1, 1, 2, 2, 2, 2, 1, 1, 2, 2, 1, 1, 2, 1, 2, 2, 2, 2, 1, 2, 1, 1, 2, 2, 1, 2, 1, 2, 1, 2, 1, 1, 2, 2, 1, 2, 1, 2, 2, 2, 2, 1, 1, 2, 2, 2, 2, 1, 2, 1, 1, 1, 2, 2, 1, 1, 1, 1, 1, 2, 1, 1, 1, 2, 1, 1, 2, 2, 2, 2, 1, 2, 2, 1, 2, 2, 2, 2, 1, 2, 1, 1, 2, 1, 2, 1, 1, 1, 1, 1, 2, 1, 2, 1, 1, 2, 1, 2, 1, 1, 1, 1, 1, 2, 2, 2, 2, 1, 1, 1, 1, 2, 1, 1, 1, 1, 1, 1, 2, 2, 1, 1, 2, 1, 1, 2, 1, 1, 1, 1, 2, 1, 2, 1, 1, 2, 1, 1, 2, 2, 1, 2, 1, 1, 1, 1, 1, 1, 1, 1, 2, 1, 2, 2, 2, 2, 2, 2, 1, 2, 1, 1, 1, 2, 2, 1, 1, 2, 1, 1, 1, 2, 2, 1, 1, 1, 1, 2, 2, 2, 2, 2, 2, 1, 2, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 2, 1, 1, 2, 1, 2, 2, 2, 1, 2, 2, 1, 2, 2, 2, 1, 1, 2, 1, 2, 2, 2, 1, 2, 2, 1, 2, 2, 1, 1, 1, 1, 1, 2, 2, 2, 2, 2, 1, 2, 1, 1, 1, 2, 1, 2, 1, 1, 1, 1, 1, 1, 1, 1, 1, 2, 1, 1, 1, 1, 1, 1, 1, 2, 1, 2, 2, 1, 1, 2, 2, 1, 2, 2, 2, 1, 2, 1, 1, 1, 1, 2, 2, 2, 2, 2, 2, 1, 2, 2, 2, 2, 1, 2, 2, 2, 2, 1, 2, 1, 1, 1, 1, 1, 2, 2, 2, 1, 2, 1, 2, 2, 2, 1, 2, 1, 2, 2, 2, 2, 2, 2, 1, 1, 2, 1, 1, 1, 1, 1, 2, 1, 2, 2, 1, 2, 1, 1, 2, 1, 2, 1, 1, 1, 2, 2, 2, 2, 2, 2, 2, 2, 2, 2, 2, 2, 2, 1, 1, 1, 2, 1, 2, 1, 1, 2, 1, 1, 2, 2, 2, 2, 2, 2, 1, 2, 1, 1, 1, 1, 2, 1, 1, 2, 2, 2, 2, 2, 1, 2, 2, 2, 2, 1, 1, 1, 1, 2, 1, 1, 2, 1, 2)
pctBHL <- c(2, 1, 1, 2, 1, 1, 1, 1, 2, 2, 1, 2, 1, 1, 1, 1, 1, 1, 1, 2, 1, 2, 1, 2, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 2, 1, 2, 1, 1, 1, 2, 1, 1, 2, 1, 1, 2, 1, 1, 1, 1, 2, 2, 1, 2, 2, 1, 1, 2, 1, 1, 2, 1, 1, 1, 2, 2, 1, 2, 2, 2, 1, 1, 1, 1, 1, 2, 2, 1, 2, 1, 1, 1, 2, 2, 2, 2, 1, 1, 2, 2, 1, 1, 2, 1, 1, 1, 1, 1, 1, 2, 1, 1, 1, 2, 1, 2, 1, 1, 1, 1, 1, 1, 1, 1, 2, 1, 1, 2, 2, 2, 2, 1, 1, 1, 1, 1, 1, 1, 1, 2, 2, 1, 2, 1, 2, 2, 1, 1, 2, 1, 1, 1, 2, 1, 2, 1, 1, 2, 2, 2, 1, 2, 2, 2, 2, 1, 1, 1, 1, 2, 2, 2, 1, 2, 1, 1, 2, 2, 1, 2, 1, 2, 2, 1, 1, 2, 1, 1, 1, 2, 1, 2, 1, 1, 2, 2, 2, 1, 2, 1, 1, 2, 2, 2, 2, 2, 2, 2, 2, 1, 1, 1, 1, 1, 1, 1, 2, 1, 2, 2, 2, 1, 2, 2, 1, 1, 1, 1, 1, 1, 2, 2, 2, 1, 1, 2, 2, 1, 1, 2, 2, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 2, 1, 2, 2, 2, 2, 2, 2, 2, 2, 2, 2, 2, 2, 2, 2, 2, 2, 2, 1, 1, 2, 2, 2, 1, 1, 2, 2, 2, 2, 2, 2, 2, 2, 2, 2, 2, 1, 2, 2, 2, 2, 1, 2, 2, 1, 2, 2, 2, 2, 1, 2, 1, 2, 2, 2, 2, 2, 2, 2, 2, 1, 1, 1, 1, 2, 1, 2, 1, 2, 2, 2, 2, 2, 1, 2, 1, 1, 2, 2, 2, 1, 2, 2, 2, 1, 2, 2, 2, 2, 2, 2, 2, 2, 2, 2, 2, 1, 1, 2, 1, 2, 2, 2, 1, 2, 2, 2, 2, 2, 2, 2, 2, 2, 2, 1, 2, 1, 1, 1, 2, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 2, 2, 2, 2, 2, 2, 2, 2, 2, 1, 1, 1, 1, 1, 2, 2, 2, 2, 2, 2, 2, 2, 2, 2, 2, 1, 2, 2, 1, 2, 2, 2, 2, 2, 2, 2, 2, 2, 1)
tP <- c('Yes', 'No', 'Yes', 'No', 'Yes', 'No', 'Yes', 'No', 'Yes', 'No', 'Yes', 'No', 'Yes', 'No', 'Yes', 'No', 'Yes', 'No', 'Yes', 'No', 'Yes', 'No', 'Yes', 'No', 'Yes', 'No', 'Yes', 'No', 'Yes', 'No', 'Yes', 'No', 'Yes', 'No', 'Yes', 'No', 'Yes', 'No', 'Yes', 'No', 'Yes', 'No', 'Yes', 'No', 'Yes', 'No', 'Yes', 'No', 'Yes', 'No', 'Yes', 'No', 'Yes', 'No', 'Yes', 'No', 'Yes', 'No', 'Yes', 'No', 'Yes', 'No', 'Yes', 'No', 'Yes', 'No', 'Yes', 'No', 'Yes', 'No', 'Yes', 'No', 'Yes', 'No', 'Yes', 'No', 'Yes', 'No', 'Yes', 'No', 'Yes', 'No', 'Yes', 'No', 'Yes', 'No', 'Yes', 'No', 'Yes', 'No', 'Yes', 'No', 'Yes', 'No', 'Yes', 'No', 'Yes', 'No', 'Yes', 'No', 'Yes', 'No', 'Yes', 'No', 'Yes', 'No', 'Yes', 'No', 'Yes', 'No', 'Yes', 'No', 'Yes', 'No', 'Yes', 'No', 'Yes', 'No', 'Yes', 'No', 'Yes', 'No', 'Yes', 'No', 'Yes', 'No', 'Yes', 'No', 'Yes', 'No', 'Yes', 'No', 'Yes', 'No', 'Yes', 'No', 'Yes', 'No', 'Yes', 'No', 'Yes', 'No', 'Yes', 'No', 'Yes', 'No', 'Yes', 'No', 'Yes', 'No', 'Yes', 'No', 'Yes', 'No', 'Yes', 'No', 'Yes', 'No', 'Yes', 'No', 'Yes', 'No', 'Yes', 'No', 'Yes', 'No', 'Yes', 'No', 'Yes', 'No', 'Yes', 'No', 'Yes', 'No', 'Yes', 'No', 'Yes', 'No', 'Yes', 'No', 'Yes', 'No', 'Yes', 'No', 'Yes', 'No', 'Yes', 'No', 'Yes', 'No', 'Yes', 'No', 'Yes', 'No', 'Yes', 'No', 'Yes', 'No', 'Yes', 'No', 'Yes', 'No', 'Yes', 'No', 'Yes', 'No', 'Yes', 'No', 'Yes', 'No', 'Yes', 'No', 'Yes', 'No', 'Yes', 'No', 'Yes', 'No', 'Yes', 'No', 'Yes', 'No', 'Yes', 'No', 'Yes', 'No', 'Yes', 'No', 'Yes', 'No', 'Yes', 'No', 'Yes', 'No', 'Yes', 'No', 'Yes', 'No', 'Yes', 'No', 'Yes', 'No', 'Yes', 'No', 'Yes', 'No', 'Yes', 'No', 'Yes', 'No', 'Yes', 'No', 'Yes', 'No', 'Yes', 'No', 'Yes', 'No', 'Yes', 'No', 'Yes', 'No', 'Yes', 'No', 'Yes', 'No', 'Yes', 'No', 'Yes', 'No', 'Yes', 'No', 'Yes', 'No', 'Yes', 'No', 'Yes', 'No', 'Yes', 'No', 'Yes', 'No', 'Yes', 'No', 'Yes', 'No', 'Yes', 'No', 'Yes', 'No', 'Yes', 'No', 'Yes', 'No', 'Yes', 'No', 'Yes', 'No', 'Yes', 'No', 'Yes', 'No', 'Yes', 'No', 'Yes', 'No', 'Yes', 'No', 'Yes', 'No', 'Yes', 'No', 'Yes', 'No', 'Yes', 'No', 'Yes', 'No', 'Yes', 'No', 'Yes', 'No', 'Yes', 'No', 'Yes', 'No', 'Yes', 'No', 'Yes', 'No', 'Yes', 'No', 'Yes', 'No', 'Yes', 'No', 'Yes', 'No', 'Yes', 'No', 'Yes', 'No', 'Yes', 'No', 'Yes', 'No', 'Yes', 'No', 'Yes', 'No', 'Yes', 'No', 'Yes', 'No', 'Yes', 'No', 'Yes', 'No', 'Yes', 'No', 'Yes', 'No', 'Yes', 'No', 'Yes', 'No', 'Yes', 'No', 'Yes', 'No', 'Yes', 'No', 'Yes', 'No', 'Yes', 'No', 'Yes', 'No', 'Yes', 'No', 'Yes', 'No', 'Yes', 'No', 'Yes', 'No', 'Yes', 'No', 'Yes', 'No', 'Yes', 'No', 'Yes', 'No', 'Yes', 'No', 'Yes', 'No', 'Yes', 'No', 'Yes', 'No', 'Yes', 'No', 'Yes', 'No', 'Yes', 'No', 'Yes', 'No', 'Yes', 'No', 'Yes', 'No', 'Yes', 'No', 'Yes', 'No', 'Yes', 'No', 'Yes', 'No', 'Yes', 'No', 'Yes', 'No', 'Yes', 'No', 'Yes', 'No', 'Yes', 'No', 'Yes', 'No', 'No')

nyc_scores <- nyc_scores %>%
    select(-Teacher_Education_Level) %>%
    mutate(Percent_Tested_HL=factor(pctTHL), Percent_Black_HL=factor(pctBHL), Tutoring_Program=factor(tP))


#build the boxplots for all 3 factor variables: tutoring program, pct black, pct tested
ggplot(nyc_scores, aes(x=Tutoring_Program, y=Average_Score_SAT_Math)) + 
    geom_boxplot()
## Warning: Removed 60 rows containing non-finite values (stat_boxplot).

ggplot(nyc_scores, aes(x=Percent_Black_HL, y=Average_Score_SAT_Math)) + 
    geom_boxplot()
## Warning: Removed 60 rows containing non-finite values (stat_boxplot).

ggplot(nyc_scores, aes(x=Percent_Tested_HL, y=Average_Score_SAT_Math)) + 
    geom_boxplot()
## Warning: Removed 60 rows containing non-finite values (stat_boxplot).

#create nyc_scores_factorial and examine the results
nyc_scores_factorial <- aov(Average_Score_SAT_Math ~ Percent_Tested_HL * Percent_Black_HL * Tutoring_Program, data=nyc_scores)
broom::tidy(nyc_scores_factorial)
## # A tibble: 8 x 6
##   term                               df   sumsq meansq statistic   p.value
##   <chr>                           <dbl>   <dbl>  <dbl>     <dbl>     <dbl>
## 1 Percent_Tested_HL                   1  3.92e5 3.92e5   116.     1.21e-23
## 2 Percent_Black_HL                    1  1.87e5 1.87e5    55.3    7.52e-13
## 3 Tutoring_Program                    1  9.42e3 9.42e3     2.78   9.63e- 2
## 4 Percent_Tested_HL:Percent_Blac~     1  8.88e4 8.88e4    26.2    4.94e- 7
## 5 Percent_Tested_HL:Tutoring_Pro~     1  1.98e3 1.98e3     0.584  4.45e- 1
## 6 Percent_Black_HL:Tutoring_Prog~     1  5.16e3 5.16e3     1.52   2.18e- 1
## 7 Percent_Tested_HL:Percent_Blac~     1  7.77e3 7.77e3     2.29   1.31e- 1
## 8 Residuals                         367  1.24e6 3.39e3    NA     NA
#use shapiro.test() to test the outcome
shapiro.test(nyc_scores$Average_Score_SAT_Math)
## 
##  Shapiro-Wilk normality test
## 
## data:  nyc_scores$Average_Score_SAT_Math
## W = 0.84672, p-value < 2.2e-16
#plot nyc_scores_factorial to examine residuals
par(mfrow = c(2, 2))
plot(nyc_scores_factorial)

par(mfrow = c(1, 1))

Structural Equation Modeling with lavaan in R

Chapter 1 - One-Factor Models

Model Specification - Structural Equation Models (SEM) - explore relationships between variables:

  • Can confirm the structure of a developed model also
  • Two variable types - manifest (directly measured) which are represented by squares, and latent (abstract underlying phenomenon) represented as circles
    • The manifest variables are assumed to be driven by the latent variables (such as intelligence)
  • Can set up an analysis in R using lavaan based on 1939 intelligence data
    • library(lavaan)
    • data(HolzingerSwineford1939)
    • example model <- ‘latent_variable =~ manifest_variable1 + manifest_variable2 + …’ # latent_variable can have any name not in dataset, =~ is direction of prediction
    • visual.model <- ‘visual =~ x1 + x2 + x3 + x7 + x8 + x9’ # x1, x2, x3, x7, x8, x9 are visual components inside the 1939 dataset

Model Analysis:

  • Degrees of freedom are based on df = Possible Values - Estimated Values
    • Possible Values = Manifest Variables * (Manifest Variables + 1) / 2
    • Models need to have at least 3 manifest variables and df > 0
    • Can use scaling and constraints to control degrees of freedom - managed inside lavaan but can modify defaults
  • Can run the models using lavaan in R
    • visual.model <- ‘visual =~ x1 + x2 + x3 + x7 + x8 + x9’
    • visual.fit <- cfa(model = visual.model, data = HolzingerSwineford1939) # include the previously defined model and the data frame
    • summary(visual.fit) # basic information about the model
    • The loadings (weightings) for each of the manifest variables will be shown, typically with the first coefficient set to 1 as per the scaling
    • The variance estimates are also provided for each of the variables - should be positive, but can be negative (needs to be troubleshot)

Model Assessment:

  • Standardized loadings measure the strength of the relationships between the manifest variables and the latent variables
    • Can be measured based on the estimates, relative to the variable that was set as 1.00
    • Can instead use the standardized solution based on the z-scores
    • summary(visual.fit, standardized = TRUE) # to get the standardized solution (Std.all column, with close to 1 being best; Std.lv being scaled like the loading variable)
  • The model fit measures how well the data fit the specified model
    • Goodness of fit indices like the Comparative Fit Index or the Tucker Lewis Index - goal is closer to 1 and 0.9+
    • Badness of fit indices like RMSE Approximation or Standardized Root Mean Square Residual (SRMR) - goal is lower and 0.1-
    • summary(visual.fit, standardized = TRUE, fit.measures = TRUE) # will show most common fit meaasures

Example code includes:

#Load the lavaan library
library(lavaan)
## This is lavaan 0.6-2
## lavaan is BETA software! Please report any bugs.
#Look at the dataset
data(HolzingerSwineford1939, package="lavaan")
head(HolzingerSwineford1939[ , 7:15])
##         x1   x2    x3       x4   x5        x6       x7   x8       x9
## 1 3.333333 7.75 0.375 2.333333 5.75 1.2857143 3.391304 5.75 6.361111
## 2 5.333333 5.25 2.125 1.666667 3.00 1.2857143 3.782609 6.25 7.916667
## 3 4.500000 5.25 1.875 1.000000 1.75 0.4285714 3.260870 3.90 4.416667
## 4 5.333333 7.75 3.000 2.666667 4.50 2.4285714 3.000000 5.30 4.861111
## 5 4.833333 4.75 0.875 2.666667 4.00 2.5714286 3.695652 6.30 5.916667
## 6 5.333333 5.00 2.250 1.000000 3.00 0.8571429 4.347826 6.65 7.500000
#Define your model specification
text.model <- "textspeed =~ x4 + x5 + x6 + x7 + x8 + x9"

#Analyze the model with cfa()
text.fit <- lavaan::cfa(model=text.model, data=HolzingerSwineford1939)

#Summarize the model
summary(text.fit)
## lavaan 0.6-2 ended normally after 20 iterations
## 
##   Optimization method                           NLMINB
##   Number of free parameters                         12
## 
##   Number of observations                           301
## 
##   Estimator                                         ML
##   Model Fit Test Statistic                     149.786
##   Degrees of freedom                                 9
##   P-value (Chi-square)                           0.000
## 
## Parameter Estimates:
## 
##   Information                                 Expected
##   Information saturated (h1) model          Structured
##   Standard Errors                             Standard
## 
## Latent Variables:
##                    Estimate  Std.Err  z-value  P(>|z|)
##   textspeed =~                                        
##     x4                1.000                           
##     x5                1.130    0.067   16.946    0.000
##     x6                0.925    0.056   16.424    0.000
##     x7                0.196    0.067    2.918    0.004
##     x8                0.186    0.062    2.984    0.003
##     x9                0.279    0.062    4.539    0.000
## 
## Variances:
##                    Estimate  Std.Err  z-value  P(>|z|)
##    .x4                0.383    0.048    7.903    0.000
##    .x5                0.424    0.059    7.251    0.000
##    .x6                0.368    0.044    8.419    0.000
##    .x7                1.146    0.094   12.217    0.000
##    .x8                0.988    0.081   12.215    0.000
##    .x9                0.940    0.077   12.142    0.000
##     textspeed         0.968    0.112    8.647    0.000
summary(text.fit, standardized=TRUE)
## lavaan 0.6-2 ended normally after 20 iterations
## 
##   Optimization method                           NLMINB
##   Number of free parameters                         12
## 
##   Number of observations                           301
## 
##   Estimator                                         ML
##   Model Fit Test Statistic                     149.786
##   Degrees of freedom                                 9
##   P-value (Chi-square)                           0.000
## 
## Parameter Estimates:
## 
##   Information                                 Expected
##   Information saturated (h1) model          Structured
##   Standard Errors                             Standard
## 
## Latent Variables:
##                    Estimate  Std.Err  z-value  P(>|z|)   Std.lv  Std.all
##   textspeed =~                                                          
##     x4                1.000                               0.984    0.846
##     x5                1.130    0.067   16.946    0.000    1.112    0.863
##     x6                0.925    0.056   16.424    0.000    0.910    0.832
##     x7                0.196    0.067    2.918    0.004    0.193    0.177
##     x8                0.186    0.062    2.984    0.003    0.183    0.181
##     x9                0.279    0.062    4.539    0.000    0.275    0.273
## 
## Variances:
##                    Estimate  Std.Err  z-value  P(>|z|)   Std.lv  Std.all
##    .x4                0.383    0.048    7.903    0.000    0.383    0.284
##    .x5                0.424    0.059    7.251    0.000    0.424    0.256
##    .x6                0.368    0.044    8.419    0.000    0.368    0.308
##    .x7                1.146    0.094   12.217    0.000    1.146    0.969
##    .x8                0.988    0.081   12.215    0.000    0.988    0.967
##    .x9                0.940    0.077   12.142    0.000    0.940    0.926
##     textspeed         0.968    0.112    8.647    0.000    1.000    1.000
summary(text.fit, fit.measures=TRUE)
## lavaan 0.6-2 ended normally after 20 iterations
## 
##   Optimization method                           NLMINB
##   Number of free parameters                         12
## 
##   Number of observations                           301
## 
##   Estimator                                         ML
##   Model Fit Test Statistic                     149.786
##   Degrees of freedom                                 9
##   P-value (Chi-square)                           0.000
## 
## Model test baseline model:
## 
##   Minimum Function Test Statistic              681.336
##   Degrees of freedom                                15
##   P-value                                        0.000
## 
## User model versus baseline model:
## 
##   Comparative Fit Index (CFI)                    0.789
##   Tucker-Lewis Index (TLI)                       0.648
## 
## Loglikelihood and Information Criteria:
## 
##   Loglikelihood user model (H0)              -2476.130
##   Loglikelihood unrestricted model (H1)      -2401.237
## 
##   Number of free parameters                         12
##   Akaike (AIC)                                4976.261
##   Bayesian (BIC)                              5020.746
##   Sample-size adjusted Bayesian (BIC)         4982.689
## 
## Root Mean Square Error of Approximation:
## 
##   RMSEA                                          0.228
##   90 Percent Confidence Interval          0.197  0.261
##   P-value RMSEA <= 0.05                          0.000
## 
## Standardized Root Mean Square Residual:
## 
##   SRMR                                           0.148
## 
## Parameter Estimates:
## 
##   Information                                 Expected
##   Information saturated (h1) model          Structured
##   Standard Errors                             Standard
## 
## Latent Variables:
##                    Estimate  Std.Err  z-value  P(>|z|)
##   textspeed =~                                        
##     x4                1.000                           
##     x5                1.130    0.067   16.946    0.000
##     x6                0.925    0.056   16.424    0.000
##     x7                0.196    0.067    2.918    0.004
##     x8                0.186    0.062    2.984    0.003
##     x9                0.279    0.062    4.539    0.000
## 
## Variances:
##                    Estimate  Std.Err  z-value  P(>|z|)
##    .x4                0.383    0.048    7.903    0.000
##    .x5                0.424    0.059    7.251    0.000
##    .x6                0.368    0.044    8.419    0.000
##    .x7                1.146    0.094   12.217    0.000
##    .x8                0.988    0.081   12.215    0.000
##    .x9                0.940    0.077   12.142    0.000
##     textspeed         0.968    0.112    8.647    0.000
#Look at the dataset
data(PoliticalDemocracy, package="lavaan")
head(PoliticalDemocracy)
##      y1       y2       y3       y4       y5       y6       y7       y8
## 1  2.50 0.000000 3.333333 0.000000 1.250000 0.000000 3.726360 3.333333
## 2  1.25 0.000000 3.333333 0.000000 6.250000 1.100000 6.666666 0.736999
## 3  7.50 8.800000 9.999998 9.199991 8.750000 8.094061 9.999998 8.211809
## 4  8.90 8.800000 9.999998 9.199991 8.907948 8.127979 9.999998 4.615086
## 5 10.00 3.333333 9.999998 6.666666 7.500000 3.333333 9.999998 6.666666
## 6  7.50 3.333333 6.666666 6.666666 6.250000 1.100000 6.666666 0.368500
##         x1       x2       x3
## 1 4.442651 3.637586 2.557615
## 2 5.384495 5.062595 3.568079
## 3 5.961005 6.255750 5.224433
## 4 6.285998 7.567863 6.267495
## 5 5.863631 6.818924 4.573679
## 6 5.533389 5.135798 3.892270
#Define your model specification
politics.model <- "poldemo60 =~ y1 + y2 + y3 + y4"

#Analyze the model with cfa()
politics.fit <- lavaan::cfa(model = politics.model, data = PoliticalDemocracy)

#Summarize the model
summary(politics.fit, standardized=TRUE, fit.measures=TRUE)
## lavaan 0.6-2 ended normally after 26 iterations
## 
##   Optimization method                           NLMINB
##   Number of free parameters                          8
## 
##   Number of observations                            75
## 
##   Estimator                                         ML
##   Model Fit Test Statistic                      10.006
##   Degrees of freedom                                 2
##   P-value (Chi-square)                           0.007
## 
## Model test baseline model:
## 
##   Minimum Function Test Statistic              159.183
##   Degrees of freedom                                 6
##   P-value                                        0.000
## 
## User model versus baseline model:
## 
##   Comparative Fit Index (CFI)                    0.948
##   Tucker-Lewis Index (TLI)                       0.843
## 
## Loglikelihood and Information Criteria:
## 
##   Loglikelihood user model (H0)               -704.138
##   Loglikelihood unrestricted model (H1)       -699.135
## 
##   Number of free parameters                          8
##   Akaike (AIC)                                1424.275
##   Bayesian (BIC)                              1442.815
##   Sample-size adjusted Bayesian (BIC)         1417.601
## 
## Root Mean Square Error of Approximation:
## 
##   RMSEA                                          0.231
##   90 Percent Confidence Interval          0.103  0.382
##   P-value RMSEA <= 0.05                          0.014
## 
## Standardized Root Mean Square Residual:
## 
##   SRMR                                           0.046
## 
## Parameter Estimates:
## 
##   Information                                 Expected
##   Information saturated (h1) model          Structured
##   Standard Errors                             Standard
## 
## Latent Variables:
##                    Estimate  Std.Err  z-value  P(>|z|)   Std.lv  Std.all
##   poldemo60 =~                                                          
##     y1                1.000                               2.133    0.819
##     y2                1.404    0.197    7.119    0.000    2.993    0.763
##     y3                1.089    0.167    6.529    0.000    2.322    0.712
##     y4                1.370    0.167    8.228    0.000    2.922    0.878
## 
## Variances:
##                    Estimate  Std.Err  z-value  P(>|z|)   Std.lv  Std.all
##    .y1                2.239    0.512    4.371    0.000    2.239    0.330
##    .y2                6.412    1.293    4.960    0.000    6.412    0.417
##    .y3                5.229    0.990    5.281    0.000    5.229    0.492
##    .y4                2.530    0.765    3.306    0.001    2.530    0.229
##     poldemo60         4.548    1.106    4.112    0.000    1.000    1.000

Chapter 2 - Multi-Factor Models

Multifactor Specification - exploring multiple latent relationships, and their relationships to each other:

  • Combining manifest variables that represent different latent variables often results in a model with poor fit
  • Can instead convert each of the manifest variables to the appropriate latent variable, for example
    • visual.model <- ‘visual =~ x1 + x2 + x3’
    • visual.fit <- cfa(model = visual.model, data = HolzingerSwineford1939)
    • speed.model <- ‘speed =~ x7 + x8 + x9’
    • speed.fit <- cfa(model = speed.model, data = HolzingerSwineford1939)
  • However, having too many models can lead to having zero degrees of freedom; constraints (such as same loading for x2/x3) are used to address this
    • visual.model <- ‘visual =~ x1 + ax2 + ax3’ # The a means that x2 and x3 will be set equal to each other, while a number rather than a would use that exact number
  • One larger model can sometimes better capture all the relationships
    • twofactor.model <- ‘visual =~ x1 + x2 + x3 speed =~ x7 + x8 + x9’ # adding them all at the same time (must have new line for new model)
    • twofactor.fit <- cfa(model = twofactor.model, data = HolzingerSwineford1939)
    • summary(twofactor.fit, standardized = TRUE, fit.measures = TRUE)

Model Structure:

  • The two-factor model assumes there is a covariant relationship between the latent variables - basically, one latent variable can predict another
  • Can see the correlation between the standardized variables using the summary() function - technically shows R-squared
    • =~ creates latent variables
    • ~~ creates covariances between variables
    • ~ creates direct prediction between variables
    • if there is a newline followed by ’speed ~~ 0*visual’ then speed will be assumed NOT to vary at all with visual
    • if there is a newline followed by ‘speed ~ visual’ then there is assumed to be a direct relationship between these variables

Modification Indices:

  • If a model has a poor fit, can examine the standardized solutions - desire is to see loading greater than 0.3
  • Model problems can often be identified by variances that are very high relative to the raw data
  • Modification indices can help show the improvement in the model when an additional index is added
    • modificationindices(twofactor.fit, sort = TRUE)
    • Output will be lhs op rhs (left-hand side, operator, right-hand-side) followed by mi (modification index, a form of chi-squared)
    • Parameters should be added one at a time, and only if they “make theoretical sense”
    • Take the desired path(s) and add them as new lines in the model

Model Comparison:

  • Can create and save two models, then analyze both using the same cfa(), then use anova() to compare the models
    • anova(twofactor.fit, twofactor.fit1)
    • This is only useful for nested models that otherwise share the same variables
  • Can also compare the fit indices using more detailed criteria
    • fitmeasures(twofactor.fit)
    • AIC (lower is better, including more negative better than less negative)
    • ECVI is the likelihood of replicating the model with the same sample size and population (lower is better)
    • fitmeasures(twofactor.fit1, c(“aic”, “ecvi”))

Example code includes:

#Create your text model specification
text.model <- 'text =~ x4 + x5 + x6'

#Analyze the model
text.fit <- cfa(model=text.model, data=HolzingerSwineford1939)

#Summarize the model
summary(text.fit, standardized = TRUE, fit.measures = TRUE)
## lavaan 0.6-2 ended normally after 15 iterations
## 
##   Optimization method                           NLMINB
##   Number of free parameters                          6
## 
##   Number of observations                           301
## 
##   Estimator                                         ML
##   Model Fit Test Statistic                       0.000
##   Degrees of freedom                                 0
## 
## Model test baseline model:
## 
##   Minimum Function Test Statistic              497.430
##   Degrees of freedom                                 3
##   P-value                                        0.000
## 
## User model versus baseline model:
## 
##   Comparative Fit Index (CFI)                    1.000
##   Tucker-Lewis Index (TLI)                       1.000
## 
## Loglikelihood and Information Criteria:
## 
##   Loglikelihood user model (H0)              -1181.065
##   Loglikelihood unrestricted model (H1)      -1181.065
## 
##   Number of free parameters                          6
##   Akaike (AIC)                                2374.130
##   Bayesian (BIC)                              2396.372
##   Sample-size adjusted Bayesian (BIC)         2377.344
## 
## Root Mean Square Error of Approximation:
## 
##   RMSEA                                          0.000
##   90 Percent Confidence Interval          0.000  0.000
##   P-value RMSEA <= 0.05                             NA
## 
## Standardized Root Mean Square Residual:
## 
##   SRMR                                           0.000
## 
## Parameter Estimates:
## 
##   Information                                 Expected
##   Information saturated (h1) model          Structured
##   Standard Errors                             Standard
## 
## Latent Variables:
##                    Estimate  Std.Err  z-value  P(>|z|)   Std.lv  Std.all
##   text =~                                                               
##     x4                1.000                               0.984    0.847
##     x5                1.133    0.067   16.906    0.000    1.115    0.866
##     x6                0.924    0.056   16.391    0.000    0.910    0.832
## 
## Variances:
##                    Estimate  Std.Err  z-value  P(>|z|)   Std.lv  Std.all
##    .x4                0.382    0.049    7.805    0.000    0.382    0.283
##    .x5                0.416    0.059    7.038    0.000    0.416    0.251
##    .x6                0.369    0.044    8.367    0.000    0.369    0.308
##     text              0.969    0.112    8.640    0.000    1.000    1.000
#Update the model specification by setting two paths to the label a
text.model <- 'text =~ x4 + a*x5 + a*x6'

#Analyze the model
text.fit <- cfa(model = text.model, data = HolzingerSwineford1939)

#Summarize the model
summary(text.fit, standardized = TRUE, fit.measures = TRUE)
## lavaan 0.6-2 ended normally after 14 iterations
## 
##   Optimization method                           NLMINB
##   Number of free parameters                          6
##   Number of equality constraints                     1
## 
##   Number of observations                           301
## 
##   Estimator                                         ML
##   Model Fit Test Statistic                      11.227
##   Degrees of freedom                                 1
##   P-value (Chi-square)                           0.001
## 
## Model test baseline model:
## 
##   Minimum Function Test Statistic              497.430
##   Degrees of freedom                                 3
##   P-value                                        0.000
## 
## User model versus baseline model:
## 
##   Comparative Fit Index (CFI)                    0.979
##   Tucker-Lewis Index (TLI)                       0.938
## 
## Loglikelihood and Information Criteria:
## 
##   Loglikelihood user model (H0)              -1186.678
##   Loglikelihood unrestricted model (H1)      -1181.065
## 
##   Number of free parameters                          5
##   Akaike (AIC)                                2383.357
##   Bayesian (BIC)                              2401.892
##   Sample-size adjusted Bayesian (BIC)         2386.035
## 
## Root Mean Square Error of Approximation:
## 
##   RMSEA                                          0.184
##   90 Percent Confidence Interval          0.098  0.288
##   P-value RMSEA <= 0.05                          0.007
## 
## Standardized Root Mean Square Residual:
## 
##   SRMR                                           0.073
## 
## Parameter Estimates:
## 
##   Information                                 Expected
##   Information saturated (h1) model          Structured
##   Standard Errors                             Standard
## 
## Latent Variables:
##                    Estimate  Std.Err  z-value  P(>|z|)   Std.lv  Std.all
##   text =~                                                               
##     x4                1.000                               0.983    0.846
##     x5         (a)    1.009    0.054   18.747    0.000    0.992    0.815
##     x6         (a)    1.009    0.054   18.747    0.000    0.992    0.866
## 
## Variances:
##                    Estimate  Std.Err  z-value  P(>|z|)   Std.lv  Std.all
##    .x4                0.383    0.050    7.631    0.000    0.383    0.284
##    .x5                0.499    0.054    9.164    0.000    0.499    0.336
##    .x6                0.328    0.045    7.285    0.000    0.328    0.250
##     text              0.967    0.113    8.585    0.000    1.000    1.000
#Create a two-factor model of text and speed variables
twofactor.model <- 'text =~ x4 + x5 + x6
speed =~ x7 + x8 + x9'

#Previous one-factor model output
summary(text.fit, standardized = TRUE, fit.measures = TRUE)
## lavaan 0.6-2 ended normally after 14 iterations
## 
##   Optimization method                           NLMINB
##   Number of free parameters                          6
##   Number of equality constraints                     1
## 
##   Number of observations                           301
## 
##   Estimator                                         ML
##   Model Fit Test Statistic                      11.227
##   Degrees of freedom                                 1
##   P-value (Chi-square)                           0.001
## 
## Model test baseline model:
## 
##   Minimum Function Test Statistic              497.430
##   Degrees of freedom                                 3
##   P-value                                        0.000
## 
## User model versus baseline model:
## 
##   Comparative Fit Index (CFI)                    0.979
##   Tucker-Lewis Index (TLI)                       0.938
## 
## Loglikelihood and Information Criteria:
## 
##   Loglikelihood user model (H0)              -1186.678
##   Loglikelihood unrestricted model (H1)      -1181.065
## 
##   Number of free parameters                          5
##   Akaike (AIC)                                2383.357
##   Bayesian (BIC)                              2401.892
##   Sample-size adjusted Bayesian (BIC)         2386.035
## 
## Root Mean Square Error of Approximation:
## 
##   RMSEA                                          0.184
##   90 Percent Confidence Interval          0.098  0.288
##   P-value RMSEA <= 0.05                          0.007
## 
## Standardized Root Mean Square Residual:
## 
##   SRMR                                           0.073
## 
## Parameter Estimates:
## 
##   Information                                 Expected
##   Information saturated (h1) model          Structured
##   Standard Errors                             Standard
## 
## Latent Variables:
##                    Estimate  Std.Err  z-value  P(>|z|)   Std.lv  Std.all
##   text =~                                                               
##     x4                1.000                               0.983    0.846
##     x5         (a)    1.009    0.054   18.747    0.000    0.992    0.815
##     x6         (a)    1.009    0.054   18.747    0.000    0.992    0.866
## 
## Variances:
##                    Estimate  Std.Err  z-value  P(>|z|)   Std.lv  Std.all
##    .x4                0.383    0.050    7.631    0.000    0.383    0.284
##    .x5                0.499    0.054    9.164    0.000    0.499    0.336
##    .x6                0.328    0.045    7.285    0.000    0.328    0.250
##     text              0.967    0.113    8.585    0.000    1.000    1.000
#Two-factor model specification
twofactor.model <- 'text =~ x4 + x5 + x6
speed =~ x7 + x8 + x9'

#Use cfa() to analyze the model
twofactor.fit <- cfa(model=twofactor.model, data=HolzingerSwineford1939)

#Use summary() to view the fitted model
summary(twofactor.fit, standardized = TRUE, fit.measures = TRUE)
## lavaan 0.6-2 ended normally after 24 iterations
## 
##   Optimization method                           NLMINB
##   Number of free parameters                         13
## 
##   Number of observations                           301
## 
##   Estimator                                         ML
##   Model Fit Test Statistic                      14.354
##   Degrees of freedom                                 8
##   P-value (Chi-square)                           0.073
## 
## Model test baseline model:
## 
##   Minimum Function Test Statistic              681.336
##   Degrees of freedom                                15
##   P-value                                        0.000
## 
## User model versus baseline model:
## 
##   Comparative Fit Index (CFI)                    0.990
##   Tucker-Lewis Index (TLI)                       0.982
## 
## Loglikelihood and Information Criteria:
## 
##   Loglikelihood user model (H0)              -2408.414
##   Loglikelihood unrestricted model (H1)      -2401.237
## 
##   Number of free parameters                         13
##   Akaike (AIC)                                4842.828
##   Bayesian (BIC)                              4891.021
##   Sample-size adjusted Bayesian (BIC)         4849.792
## 
## Root Mean Square Error of Approximation:
## 
##   RMSEA                                          0.051
##   90 Percent Confidence Interval          0.000  0.093
##   P-value RMSEA <= 0.05                          0.425
## 
## Standardized Root Mean Square Residual:
## 
##   SRMR                                           0.039
## 
## Parameter Estimates:
## 
##   Information                                 Expected
##   Information saturated (h1) model          Structured
##   Standard Errors                             Standard
## 
## Latent Variables:
##                    Estimate  Std.Err  z-value  P(>|z|)   Std.lv  Std.all
##   text =~                                                               
##     x4                1.000                               0.984    0.847
##     x5                1.132    0.067   16.954    0.000    1.114    0.865
##     x6                0.925    0.056   16.438    0.000    0.911    0.833
##   speed =~                                                              
##     x7                1.000                               0.674    0.619
##     x8                1.150    0.165    6.990    0.000    0.775    0.766
##     x9                0.878    0.123    7.166    0.000    0.592    0.587
## 
## Covariances:
##                    Estimate  Std.Err  z-value  P(>|z|)   Std.lv  Std.all
##   text ~~                                                               
##     speed             0.173    0.052    3.331    0.001    0.261    0.261
## 
## Variances:
##                    Estimate  Std.Err  z-value  P(>|z|)   Std.lv  Std.all
##    .x4                0.382    0.049    7.854    0.000    0.382    0.283
##    .x5                0.418    0.059    7.113    0.000    0.418    0.252
##    .x6                0.367    0.044    8.374    0.000    0.367    0.307
##    .x7                0.729    0.084    8.731    0.000    0.729    0.616
##    .x8                0.422    0.084    5.039    0.000    0.422    0.413
##    .x9                0.665    0.071    9.383    0.000    0.665    0.655
##     text              0.969    0.112    8.647    0.000    1.000    1.000
##     speed             0.454    0.096    4.728    0.000    1.000    1.000
#Load the library and data
data(epi, package="psych")

#Specify a three-factor model with one correlation set to zero
epi.model <- 'extraversion =~ V1 + V3 + V5 + V8
neuroticism =~ V2 + V4 + V7 + V9
lying =~ V6 + V12 + V18 + V24
extraversion ~~ 0*neuroticism'

#Run the model
epi.fit <- cfa(model = epi.model, data = epi)

#Examine the output 
summary(epi.fit, standardized = TRUE, fit.measures = TRUE)
## lavaan 0.6-2 ended normally after 118 iterations
## 
##   Optimization method                           NLMINB
##   Number of free parameters                         26
## 
##                                                   Used       Total
##   Number of observations                          3193        3570
## 
##   Estimator                                         ML
##   Model Fit Test Statistic                     584.718
##   Degrees of freedom                                52
##   P-value (Chi-square)                           0.000
## 
## Model test baseline model:
## 
##   Minimum Function Test Statistic             2196.019
##   Degrees of freedom                                66
##   P-value                                        0.000
## 
## User model versus baseline model:
## 
##   Comparative Fit Index (CFI)                    0.750
##   Tucker-Lewis Index (TLI)                       0.683
## 
## Loglikelihood and Information Criteria:
## 
##   Loglikelihood user model (H0)             -23208.145
##   Loglikelihood unrestricted model (H1)     -22915.787
## 
##   Number of free parameters                         26
##   Akaike (AIC)                               46468.291
##   Bayesian (BIC)                             46626.077
##   Sample-size adjusted Bayesian (BIC)        46543.464
## 
## Root Mean Square Error of Approximation:
## 
##   RMSEA                                          0.057
##   90 Percent Confidence Interval          0.053  0.061
##   P-value RMSEA <= 0.05                          0.004
## 
## Standardized Root Mean Square Residual:
## 
##   SRMR                                           0.058
## 
## Parameter Estimates:
## 
##   Information                                 Expected
##   Information saturated (h1) model          Structured
##   Standard Errors                             Standard
## 
## Latent Variables:
##                    Estimate  Std.Err  z-value  P(>|z|)   Std.lv  Std.all
##   extraversion =~                                                       
##     V1                1.000                               0.052    0.115
##     V3                1.360    0.329    4.127    0.000    0.070    0.141
##     V5               -2.829    0.554   -5.109    0.000   -0.146   -0.391
##     V8                7.315    1.832    3.992    0.000    0.377    0.797
##   neuroticism =~                                                        
##     V2                1.000                               0.228    0.457
##     V4                0.424    0.053    8.004    0.000    0.097    0.196
##     V7                1.395    0.093   15.023    0.000    0.318    0.648
##     V9                1.205    0.078   15.506    0.000    0.275    0.553
##   lying =~                                                              
##     V6                1.000                               0.135    0.272
##     V12              -0.851    0.132   -6.435    0.000   -0.115   -0.291
##     V18              -0.785    0.122   -6.421    0.000   -0.106   -0.289
##     V24               1.086    0.161    6.734    0.000    0.147    0.339
## 
## Covariances:
##                    Estimate  Std.Err  z-value  P(>|z|)   Std.lv  Std.all
##   extraversion ~~                                                       
##     neuroticism       0.000                               0.000    0.000
##     lying            -0.002    0.001   -3.313    0.001   -0.258   -0.258
##   neuroticism ~~                                                        
##     lying            -0.014    0.002   -6.867    0.000   -0.469   -0.469
## 
## Variances:
##                    Estimate  Std.Err  z-value  P(>|z|)   Std.lv  Std.all
##    .V1                0.198    0.005   39.567    0.000    0.198    0.987
##    .V3                0.243    0.006   39.278    0.000    0.243    0.980
##    .V5                0.118    0.005   23.900    0.000    0.118    0.847
##    .V8                0.082    0.026    3.084    0.002    0.082    0.364
##    .V2                0.197    0.006   32.516    0.000    0.197    0.791
##    .V4                0.235    0.006   38.906    0.000    0.235    0.962
##    .V7                0.140    0.007   19.412    0.000    0.140    0.580
##    .V9                0.172    0.006   26.591    0.000    0.172    0.694
##    .V6                0.228    0.007   34.520    0.000    0.228    0.926
##    .V12               0.143    0.004   33.670    0.000    0.143    0.916
##    .V18               0.124    0.004   33.753    0.000    0.124    0.917
##    .V24               0.166    0.005   31.021    0.000    0.166    0.885
##     extraversion      0.003    0.001    2.480    0.013    1.000    1.000
##     neuroticism       0.052    0.005   10.010    0.000    1.000    1.000
##     lying             0.018    0.004    4.500    0.000    1.000    1.000
#Specify a three-factor model where lying is predicted by neuroticism
epi.model <- 'extraversion =~ V1 + V3 + V5 + V8
neuroticism =~ V2 + V4 + V7 + V9
lying =~ V6 + V12 + V18 + V24
lying ~ neuroticism'


#Run the model
epi.fit <- cfa(model = epi.model, data = epi)

#Examine the output 
summary(epi.fit, standardized = TRUE, fit.measures = TRUE)
## lavaan 0.6-2 ended normally after 120 iterations
## 
##   Optimization method                           NLMINB
##   Number of free parameters                         26
## 
##                                                   Used       Total
##   Number of observations                          3193        3570
## 
##   Estimator                                         ML
##   Model Fit Test Statistic                     534.426
##   Degrees of freedom                                52
##   P-value (Chi-square)                           0.000
## 
## Model test baseline model:
## 
##   Minimum Function Test Statistic             2196.019
##   Degrees of freedom                                66
##   P-value                                        0.000
## 
## User model versus baseline model:
## 
##   Comparative Fit Index (CFI)                    0.774
##   Tucker-Lewis Index (TLI)                       0.713
## 
## Loglikelihood and Information Criteria:
## 
##   Loglikelihood user model (H0)             -23183.000
##   Loglikelihood unrestricted model (H1)     -22915.787
## 
##   Number of free parameters                         26
##   Akaike (AIC)                               46417.999
##   Bayesian (BIC)                             46575.786
##   Sample-size adjusted Bayesian (BIC)        46493.173
## 
## Root Mean Square Error of Approximation:
## 
##   RMSEA                                          0.054
##   90 Percent Confidence Interval          0.050  0.058
##   P-value RMSEA <= 0.05                          0.058
## 
## Standardized Root Mean Square Residual:
## 
##   SRMR                                           0.053
## 
## Parameter Estimates:
## 
##   Information                                 Expected
##   Information saturated (h1) model          Structured
##   Standard Errors                             Standard
## 
## Latent Variables:
##                    Estimate  Std.Err  z-value  P(>|z|)   Std.lv  Std.all
##   extraversion =~                                                       
##     V1                1.000                               0.052    0.115
##     V3                1.135    0.268    4.230    0.000    0.059    0.118
##     V5               -2.497    0.443   -5.638    0.000   -0.129   -0.346
##     V8                8.223    2.008    4.096    0.000    0.425    0.898
##   neuroticism =~                                                        
##     V2                1.000                               0.223    0.447
##     V4                0.462    0.054    8.493    0.000    0.103    0.209
##     V7                1.435    0.093   15.368    0.000    0.320    0.652
##     V9                1.214    0.078   15.570    0.000    0.271    0.545
##   lying =~                                                              
##     V6                1.000                               0.125    0.252
##     V12              -0.943    0.150   -6.274    0.000   -0.118   -0.298
##     V18              -0.905    0.143   -6.339    0.000   -0.113   -0.308
##     V24               1.187    0.182    6.509    0.000    0.148    0.342
## 
## Regressions:
##                    Estimate  Std.Err  z-value  P(>|z|)   Std.lv  Std.all
##   lying ~                                                               
##     neuroticism      -0.298    0.043   -6.943    0.000   -0.532   -0.532
## 
## Covariances:
##                    Estimate  Std.Err  z-value  P(>|z|)   Std.lv  Std.all
##   extraversion ~~                                                       
##     neuroticism       0.003    0.001    3.761    0.000    0.240    0.240
## 
## Variances:
##                    Estimate  Std.Err  z-value  P(>|z|)   Std.lv  Std.all
##    .V1                0.198    0.005   39.671    0.000    0.198    0.987
##    .V3                0.244    0.006   39.651    0.000    0.244    0.986
##    .V5                0.123    0.004   28.256    0.000    0.123    0.881
##    .V8                0.043    0.033    1.302    0.193    0.043    0.193
##    .V2                0.200    0.006   33.262    0.000    0.200    0.800
##    .V4                0.233    0.006   38.804    0.000    0.233    0.956
##    .V7                0.139    0.007   20.087    0.000    0.139    0.575
##    .V9                0.174    0.006   27.907    0.000    0.174    0.703
##    .V6                0.231    0.007   35.398    0.000    0.231    0.936
##    .V12               0.143    0.004   33.349    0.000    0.143    0.911
##    .V18               0.122    0.004   32.825    0.000    0.122    0.905
##    .V24               0.166    0.005   30.854    0.000    0.166    0.883
##     extraversion      0.003    0.001    2.643    0.008    1.000    1.000
##     neuroticism       0.050    0.005    9.947    0.000    1.000    1.000
##    .lying             0.011    0.003    3.970    0.000    0.717    0.717
#Calculate the variance of V1
var(epi$V1, na.rm=TRUE)
## [1] 0.2018335
#Examine the modification indices
modificationindices(epi.fit, sort=TRUE)
##              lhs op   rhs      mi    epc sepc.lv sepc.all sepc.nox
## 39   neuroticism =~    V3 169.990 -0.704  -0.157   -0.316   -0.316
## 38   neuroticism =~    V1 125.582  0.545   0.122    0.271    0.271
## 47         lying =~    V3 119.773  1.294   0.162    0.325    0.325
## 69            V3 ~~    V7  77.456 -0.034  -0.034   -0.186   -0.186
## 57            V1 ~~    V2  76.872  0.033   0.033    0.164    0.164
## 46         lying =~    V1  64.865 -0.857  -0.107   -0.239   -0.239
## 58            V1 ~~    V4  27.288  0.020   0.020    0.093    0.093
## 34  extraversion =~    V6  24.201 -0.948  -0.049   -0.099   -0.099
## 121  neuroticism ~~ lying  23.184  0.020   0.854    0.854    0.854
## 120 extraversion ~~ lying  23.184 -0.001  -0.205   -0.205   -0.205
## 122  neuroticism  ~ lying  23.184  1.798   1.008    1.008    1.008
## 102           V4 ~~   V12  18.360  0.015   0.015    0.079    0.079
## 88            V8 ~~    V6  17.629 -0.016  -0.016   -0.161   -0.161
## 49         lying =~    V8  17.324 -0.641  -0.080   -0.170   -0.170
## 66            V3 ~~    V8  16.886  0.042   0.042    0.411    0.411
## 74            V3 ~~   V24  16.332  0.015   0.015    0.075    0.075
## 31  extraversion =~    V4  15.808  0.781   0.040    0.082    0.082
## 50         lying =~    V2  15.345  0.713   0.089    0.179    0.179
## 56            V1 ~~    V8  14.184 -0.035  -0.035   -0.373   -0.373
## 112           V9 ~~   V18  13.078  0.011   0.011    0.076    0.076
## 45   neuroticism =~   V24  10.674  0.319   0.071    0.164    0.164
## 65            V3 ~~    V5  10.297 -0.011  -0.011   -0.064   -0.064
## 67            V3 ~~    V2   9.800 -0.013  -0.013   -0.058   -0.058
## 83            V5 ~~   V24   9.658  0.008   0.008    0.058    0.058
## 85            V8 ~~    V4   9.532  0.012   0.012    0.118    0.118
## 98            V2 ~~   V24   8.780  0.011   0.011    0.060    0.060
## 115           V6 ~~   V18   8.093  0.010   0.010    0.062    0.062
## 63            V1 ~~   V18   7.944  0.008   0.008    0.052    0.052
## 116           V6 ~~   V24   7.436  0.012   0.012    0.063    0.063
## 84            V8 ~~    V2   7.279 -0.010  -0.010   -0.112   -0.112
## 110           V9 ~~    V6   7.179  0.011   0.011    0.055    0.055
## 70            V3 ~~    V9   7.091 -0.011  -0.011   -0.052   -0.052
## 60            V1 ~~    V9   6.550  0.009   0.009    0.050    0.050
## 73            V3 ~~   V18   6.533 -0.008  -0.008   -0.047   -0.047
## 30  extraversion =~    V2   6.090 -0.487  -0.025   -0.050   -0.050
## 44   neuroticism =~   V18   5.972  0.186   0.042    0.113    0.113
## 51         lying =~    V4   5.278 -0.411  -0.051   -0.104   -0.104
## 33  extraversion =~    V9   4.903 -0.446  -0.023   -0.046   -0.046
## 87            V8 ~~    V9   4.841 -0.009  -0.009   -0.099   -0.099
## 59            V1 ~~    V7   4.588  0.007   0.007    0.045    0.045
## 68            V3 ~~    V4   4.293  0.009   0.009    0.037    0.037
## 106           V7 ~~    V6   4.219 -0.009  -0.009   -0.048   -0.048
## 93            V2 ~~    V7   4.179  0.014   0.014    0.082    0.082
## 75            V5 ~~    V8   3.508  0.056   0.056    0.775    0.775
## 99            V4 ~~    V7   3.431 -0.009  -0.009   -0.048   -0.048
## 95            V2 ~~    V6   3.106  0.007   0.007    0.034    0.034
## 55            V1 ~~    V5   2.977  0.005   0.005    0.034    0.034
## 94            V2 ~~    V9   2.860  0.009   0.009    0.051    0.051
## 35  extraversion =~   V12   2.777  0.256   0.013    0.033    0.033
## 37  extraversion =~   V24   2.668 -0.275  -0.014   -0.033   -0.033
## 48         lying =~    V5   2.453  0.155   0.019    0.052    0.052
## 109           V7 ~~   V24   2.021  0.005   0.005    0.035    0.035
## 89            V8 ~~   V12   1.910  0.004   0.004    0.054    0.054
## 91            V8 ~~   V24   1.733 -0.004  -0.004   -0.052   -0.052
## 86            V8 ~~    V7   1.640  0.005   0.005    0.068    0.068
## 80            V5 ~~    V6   1.631  0.004   0.004    0.023    0.023
## 97            V2 ~~   V18   1.600 -0.004  -0.004   -0.025   -0.025
## 82            V5 ~~   V18   1.301  0.003   0.003    0.021    0.021
## 54            V1 ~~    V3   1.227 -0.004  -0.004   -0.020   -0.020
## 100           V4 ~~    V9   1.198 -0.005  -0.005   -0.024   -0.024
## 64            V1 ~~   V24   1.153  0.004   0.004    0.020    0.020
## 53         lying =~    V9   0.995 -0.189  -0.024   -0.048   -0.048
## 41   neuroticism =~    V8   0.823  0.163   0.036    0.077    0.077
## 62            V1 ~~   V12   0.814  0.003   0.003    0.016    0.016
## 90            V8 ~~   V18   0.797  0.003   0.003    0.035    0.035
## 76            V5 ~~    V2   0.714  0.003   0.003    0.016    0.016
## 117          V12 ~~   V18   0.698 -0.003  -0.003   -0.019   -0.019
## 71            V3 ~~    V6   0.637 -0.003  -0.003   -0.014   -0.014
## 36  extraversion =~   V18   0.579  0.109   0.006    0.015    0.015
## 61            V1 ~~    V6   0.468  0.003   0.003    0.012    0.012
## 113           V9 ~~   V24   0.404 -0.002  -0.002   -0.014   -0.014
## 118          V12 ~~   V24   0.343 -0.002  -0.002   -0.014   -0.014
## 96            V2 ~~   V12   0.341 -0.002  -0.002   -0.012   -0.012
## 43   neuroticism =~   V12   0.337  0.047   0.010    0.026    0.026
## 77            V5 ~~    V4   0.334  0.002   0.002    0.010    0.010
## 107           V7 ~~   V12   0.324 -0.002  -0.002   -0.014   -0.014
## 119          V18 ~~   V24   0.296 -0.002  -0.002   -0.014   -0.014
## 52         lying =~    V7   0.285  0.111   0.014    0.028    0.028
## 111           V9 ~~   V12   0.279 -0.002  -0.002   -0.011   -0.011
## 114           V6 ~~   V12   0.253  0.002   0.002    0.011    0.011
## 105           V7 ~~    V9   0.242 -0.004  -0.004   -0.027   -0.027
## 101           V4 ~~    V6   0.210 -0.002  -0.002   -0.008   -0.008
## 104           V4 ~~   V24   0.161  0.001   0.001    0.008    0.008
## 108           V7 ~~   V18   0.159 -0.001  -0.001   -0.010   -0.010
## 78            V5 ~~    V7   0.144  0.001   0.001    0.009    0.009
## 79            V5 ~~    V9   0.137 -0.001  -0.001   -0.008   -0.008
## 92            V2 ~~    V4   0.137  0.002   0.002    0.007    0.007
## 42   neuroticism =~    V6   0.128 -0.033  -0.007   -0.015   -0.015
## 32  extraversion =~    V7   0.021  0.031   0.002    0.003    0.003
## 81            V5 ~~   V12   0.017  0.000   0.000   -0.002   -0.002
## 103           V4 ~~   V18   0.009  0.000   0.000   -0.002   -0.002
## 40   neuroticism =~    V5   0.001 -0.002   0.000   -0.001   -0.001
## 72            V3 ~~   V12   0.000  0.000   0.000    0.000    0.000
#Edit the model specification
epi.model1 <- 'extraversion =~ V1 + V3 + V5 + V8
neuroticism =~ V2 + V4 + V7 + V9
lying =~ V6 + V12 + V18 + V24
neuroticism =~ V3'

#Reanalyze the model
epi.fit1 <- cfa(model = epi.model1, data = epi)

#Summarize the updated model
summary(epi.fit1, standardized = TRUE, fit.measures = TRUE)
## lavaan 0.6-2 ended normally after 126 iterations
## 
##   Optimization method                           NLMINB
##   Number of free parameters                         28
## 
##                                                   Used       Total
##   Number of observations                          3193        3570
## 
##   Estimator                                         ML
##   Model Fit Test Statistic                     332.891
##   Degrees of freedom                                50
##   P-value (Chi-square)                           0.000
## 
## Model test baseline model:
## 
##   Minimum Function Test Statistic             2196.019
##   Degrees of freedom                                66
##   P-value                                        0.000
## 
## User model versus baseline model:
## 
##   Comparative Fit Index (CFI)                    0.867
##   Tucker-Lewis Index (TLI)                       0.825
## 
## Loglikelihood and Information Criteria:
## 
##   Loglikelihood user model (H0)             -23082.232
##   Loglikelihood unrestricted model (H1)     -22915.787
## 
##   Number of free parameters                         28
##   Akaike (AIC)                               46220.465
##   Bayesian (BIC)                             46390.389
##   Sample-size adjusted Bayesian (BIC)        46301.421
## 
## Root Mean Square Error of Approximation:
## 
##   RMSEA                                          0.042
##   90 Percent Confidence Interval          0.038  0.046
##   P-value RMSEA <= 0.05                          0.999
## 
## Standardized Root Mean Square Residual:
## 
##   SRMR                                           0.040
## 
## Parameter Estimates:
## 
##   Information                                 Expected
##   Information saturated (h1) model          Structured
##   Standard Errors                             Standard
## 
## Latent Variables:
##                    Estimate  Std.Err  z-value  P(>|z|)   Std.lv  Std.all
##   extraversion =~                                                       
##     V1                1.000                               0.068    0.152
##     V3                1.798    0.325    5.532    0.000    0.123    0.246
##     V5               -2.268    0.360   -6.291    0.000   -0.155   -0.414
##     V8                5.077    0.887    5.725    0.000    0.346    0.732
##   neuroticism =~                                                        
##     V2                1.000                               0.222    0.445
##     V4                0.432    0.053    8.134    0.000    0.096    0.194
##     V7                1.493    0.093   16.025    0.000    0.331    0.675
##     V9                1.186    0.074   15.938    0.000    0.263    0.530
##   lying =~                                                              
##     V6                1.000                               0.135    0.272
##     V12              -0.851    0.127   -6.699    0.000   -0.115   -0.290
##     V18              -0.799    0.119   -6.728    0.000   -0.108   -0.294
##     V24               1.115    0.157    7.087    0.000    0.151    0.347
##   neuroticism =~                                                        
##     V3               -0.732    0.066  -11.074    0.000   -0.163   -0.327
## 
## Covariances:
##                    Estimate  Std.Err  z-value  P(>|z|)   Std.lv  Std.all
##   extraversion ~~                                                       
##     neuroticism       0.004    0.001    4.953    0.000    0.283    0.283
##     lying            -0.003    0.001   -4.380    0.000   -0.346   -0.346
##   neuroticism ~~                                                        
##     lying            -0.016    0.002   -7.337    0.000   -0.521   -0.521
## 
## Variances:
##                    Estimate  Std.Err  z-value  P(>|z|)   Std.lv  Std.all
##    .V1                0.196    0.005   39.250    0.000    0.196    0.977
##    .V3                0.217    0.006   34.642    0.000    0.217    0.878
##    .V5                0.116    0.004   29.066    0.000    0.116    0.828
##    .V8                0.104    0.014    7.603    0.000    0.104    0.465
##    .V2                0.200    0.006   33.875    0.000    0.200    0.802
##    .V4                0.235    0.006   39.046    0.000    0.235    0.962
##    .V7                0.131    0.007   19.577    0.000    0.131    0.544
##    .V9                0.178    0.006   29.830    0.000    0.178    0.720
##    .V6                0.228    0.007   34.969    0.000    0.228    0.926
##    .V12               0.144    0.004   34.186    0.000    0.144    0.916
##    .V18               0.123    0.004   34.035    0.000    0.123    0.914
##    .V24               0.166    0.005   31.188    0.000    0.166    0.879
##     extraversion      0.005    0.001    3.265    0.001    1.000    1.000
##     neuroticism       0.049    0.005   10.127    0.000    1.000    1.000
##     lying             0.018    0.004    4.651    0.000    1.000    1.000
#Analyze the original model
epi.fit <- cfa(model = epi.model, data = epi)

#Analyze the updated model
epi.fit1 <- cfa(model = epi.model1, data = epi)

#Compare those models
anova(epi.fit, epi.fit1)
## Chi Square Difference Test
## 
##          Df   AIC   BIC  Chisq Chisq diff Df diff Pr(>Chisq)    
## epi.fit1 50 46220 46390 332.89                                  
## epi.fit  52 46418 46576 534.43     201.53       2  < 2.2e-16 ***
## ---
## Signif. codes:  0 '***' 0.001 '**' 0.01 '*' 0.05 '.' 0.1 ' ' 1
#Analyze the original model
epi.fit <- cfa(model = epi.model, data = epi)

#Find the fit indices for the original model
fitmeasures(epi.fit)[c("aic", "ecvi")]
##          aic         ecvi 
## 4.641800e+04 1.836599e-01
#Analyze the updated model
epi.fit1 <- cfa(model = epi.model1, data = epi)

#Find the fit indices for the updated model
fitmeasures(epi.fit1)[c("aic", "ecvi")]
##          aic         ecvi 
## 46220.464546     0.121795

Chapter 3 - Troubleshooting Model Errors and Diagrams

Heywood Cases on the Latent Variable:

  • Heywood cases (defined by Heywood in 1931) are cases where correlations (greater than 1) or variances (negative) are out of bounds
  • The lavaan package will throw a warning that the matrix of latent variables is “not positive definite”
    • Usually occurs because one of the latent variables is really a combination of the others
    • Can then identify the highly correlated variables, and collapse them in to a single equation (fewer factors or the like)

Heywood Cases on the Manifest Variable (negative error variances):

  • Generally occur dur to a mis-specified (under-specified) model, small sample sizes, manifest variables on vastly different scales, etc.
  • The lavaan package will throw a warning that “model has not converged”
    • summary(negative.fit, standardized = TRUE, fit.measures = TRUE, rsquare = TRUE) # rsquare can help to identify the issue; variance in each manifest variable should be (0, 1)
  • Can just freeze the variance of one of the wonky variables to its variance in the raw data
    • negative.model <- ’latent1 =~ V1 + V2 + V32 =~ V4 + V5 + V62 ~~ 18.83833*V2’ # 18.84 is var(V2)

Create Diagrams with semPaths():

  • The semPlot library allows for diagramming the fit models
    • library(semPlot)
    • twofactor.model <- ‘text =~ x4 + x5 + x6=~ x7 + x8 + x9’
    • twofactor.fit <- cfa(model = twofactor.model, data = HolzingerSwineford1939)
    • semPaths(object = twofactor.fit)
  • The double-headed arrows on the manifest variables are variances, and the double-headed arrows on the latent variables are covariances
  • There are many options for semPaths, and allow a few will be covered here
    • semPaths(object = twofactor.fit, whatLabels = “std”, edge.label.cex = 1) # std is standardized while par is parameters; edge.label.cex is the font size for the edges
    • semPaths(object = twofactor.fit, whatLabels = “std”, edge.label.cex = 1, layout = “circle”) # “tree” is the default for layouts
    • semPaths(object = twofactor.fit, whatLabels = “std”, edge.label.cex = 1, layout = “tree”, rotation = 2) # rotation can only be used for trees; 2 means left/right
    • semPaths(object = twofactor.fit, whatLabels = “std”, edge.label.cex = 1, layout = “tree”, rotation = 2, what = “std”, edge.color = “purple”) # what colors arrows by strength

Example code includes:

badlatentdata <- readr::read_csv("./RInputFiles/badlatentdata.csv")
## Warning: Missing column names filled in: 'X1' [1]
## Parsed with column specification:
## cols(
##   X1 = col_integer(),
##   V1 = col_double(),
##   V2 = col_double(),
##   V3 = col_double(),
##   V4 = col_double(),
##   V5 = col_double(),
##   V6 = col_double()
## )
badvardata <- readr::read_csv("./RInputFiles/badvardata.csv")
## Warning: Missing column names filled in: 'X1' [1]
## Parsed with column specification:
## cols(
##   X1 = col_integer(),
##   V1 = col_double(),
##   V2 = col_double(),
##   V3 = col_double(),
##   V4 = col_double(),
##   V5 = col_double(),
##   V6 = col_double()
## )
adoptsurvey <- badlatentdata %>%
    select(-X1) %>%
    rename(pictures=V1, background=V2, loveskids=V3, energy=V4, wagstail=V5, playful=V6)

#Look at the data
str(adoptsurvey, give.attr=FALSE)
## Classes 'tbl_df', 'tbl' and 'data.frame':    100 obs. of  6 variables:
##  $ pictures  : num  3.66318 -0.00508 2.99697 -0.90249 4.54211 ...
##  $ background: num  3.07 7.7 1.51 3.03 7.22 ...
##  $ loveskids : num  10.31 3.06 6.61 1.54 3.38 ...
##  $ energy    : num  3.68 2.42 3.51 -3.04 12.93 ...
##  $ wagstail  : num  5.26 7.05 4.25 2.17 6.23 ...
##  $ playful   : num  8.275 11.727 0.675 2.457 13.43 ...
head(adoptsurvey)
## # A tibble: 6 x 6
##   pictures background loveskids energy wagstail playful
##      <dbl>      <dbl>     <dbl>  <dbl>    <dbl>   <dbl>
## 1  3.66          3.07     10.3    3.68     5.26   8.28 
## 2 -0.00508       7.70      3.06   2.42     7.05  11.7  
## 3  3.00          1.51      6.61   3.51     4.25   0.675
## 4 -0.902         3.03      1.54  -3.04     2.17   2.46 
## 5  4.54          7.22      3.38  12.9      6.23  13.4  
## 6  0.0257       -4.35     -1.95  -6.07     3.13   5.60
#Build the model
adopt.model <- 'goodstory =~ pictures + background + loveskids
inperson =~ energy + wagstail + playful'

#Analyze the model
adopt.fit <- cfa(model = adopt.model, data = adoptsurvey)
## Warning in lav_object_post_check(object): lavaan WARNING: covariance matrix of latent variables
##                 is not positive definite;
##                 use lavInspect(fit, "cov.lv") to investigate.
lavInspect(adopt.fit, "cov.lv")
##           gdstry inprsn
## goodstory 0.397        
## inperson  4.780  4.505
summary(adopt.fit, standardized=TRUE, fit.measures=TRUE)
## lavaan 0.6-2 ended normally after 61 iterations
## 
##   Optimization method                           NLMINB
##   Number of free parameters                         13
## 
##   Number of observations                           100
## 
##   Estimator                                         ML
##   Model Fit Test Statistic                      15.674
##   Degrees of freedom                                 8
##   P-value (Chi-square)                           0.047
## 
## Model test baseline model:
## 
##   Minimum Function Test Statistic               74.694
##   Degrees of freedom                                15
##   P-value                                        0.000
## 
## User model versus baseline model:
## 
##   Comparative Fit Index (CFI)                    0.871
##   Tucker-Lewis Index (TLI)                       0.759
## 
## Loglikelihood and Information Criteria:
## 
##   Loglikelihood user model (H0)              -1666.548
##   Loglikelihood unrestricted model (H1)      -1658.711
## 
##   Number of free parameters                         13
##   Akaike (AIC)                                3359.096
##   Bayesian (BIC)                              3392.963
##   Sample-size adjusted Bayesian (BIC)         3351.906
## 
## Root Mean Square Error of Approximation:
## 
##   RMSEA                                          0.098
##   90 Percent Confidence Interval          0.010  0.170
##   P-value RMSEA <= 0.05                          0.126
## 
## Standardized Root Mean Square Residual:
## 
##   SRMR                                           0.080
## 
## Parameter Estimates:
## 
##   Information                                 Expected
##   Information saturated (h1) model          Structured
##   Standard Errors                             Standard
## 
## Latent Variables:
##                    Estimate  Std.Err  z-value  P(>|z|)   Std.lv  Std.all
##   goodstory =~                                                          
##     pictures          1.000                               0.630    0.200
##     background        1.089    0.347    3.135    0.002    0.686    0.168
##     loveskids         0.041    0.259    0.158    0.874    0.026    0.006
##   inperson =~                                                           
##     energy            1.000                               2.122    0.538
##     wagstail          1.134    0.300    3.780    0.000    2.406    0.473
##     playful           0.601    0.213    2.823    0.005    1.275    0.329
## 
## Covariances:
##                    Estimate  Std.Err  z-value  P(>|z|)   Std.lv  Std.all
##   goodstory ~~                                                          
##     inperson          4.780    1.248    3.830    0.000    3.575    3.575
## 
## Variances:
##                    Estimate  Std.Err  z-value  P(>|z|)   Std.lv  Std.all
##    .pictures          9.570    1.749    5.471    0.000    9.570    0.960
##    .background       16.198    2.641    6.133    0.000   16.198    0.972
##    .loveskids        21.675    3.065    7.071    0.000   21.675    1.000
##    .energy           11.031    1.920    5.745    0.000   11.031    0.710
##    .wagstail         20.085    3.199    6.278    0.000   20.085    0.776
##    .playful          13.382    1.955    6.845    0.000   13.382    0.892
##     goodstory         0.397    1.176    0.338    0.736    1.000    1.000
##     inperson          4.505    1.910    2.359    0.018    1.000    1.000
#Edit the original model 
adopt.model <- 'goodstory =~ pictures + background + loveskids + energy + wagstail + playful'

#Analyze the model
adopt.fit <- cfa(model = adopt.model, data = adoptsurvey)

#Look for Heywood cases
summary(adopt.fit, standardized = TRUE, fit.measures = TRUE)
## lavaan 0.6-2 ended normally after 49 iterations
## 
##   Optimization method                           NLMINB
##   Number of free parameters                         12
## 
##   Number of observations                           100
## 
##   Estimator                                         ML
##   Model Fit Test Statistic                      27.071
##   Degrees of freedom                                 9
##   P-value (Chi-square)                           0.001
## 
## Model test baseline model:
## 
##   Minimum Function Test Statistic               74.694
##   Degrees of freedom                                15
##   P-value                                        0.000
## 
## User model versus baseline model:
## 
##   Comparative Fit Index (CFI)                    0.697
##   Tucker-Lewis Index (TLI)                       0.495
## 
## Loglikelihood and Information Criteria:
## 
##   Loglikelihood user model (H0)              -1672.246
##   Loglikelihood unrestricted model (H1)      -1658.711
## 
##   Number of free parameters                         12
##   Akaike (AIC)                                3368.493
##   Bayesian (BIC)                              3399.755
##   Sample-size adjusted Bayesian (BIC)         3361.856
## 
## Root Mean Square Error of Approximation:
## 
##   RMSEA                                          0.142
##   90 Percent Confidence Interval          0.082  0.205
##   P-value RMSEA <= 0.05                          0.009
## 
## Standardized Root Mean Square Residual:
## 
##   SRMR                                           0.086
## 
## Parameter Estimates:
## 
##   Information                                 Expected
##   Information saturated (h1) model          Structured
##   Standard Errors                             Standard
## 
## Latent Variables:
##                    Estimate  Std.Err  z-value  P(>|z|)   Std.lv  Std.all
##   goodstory =~                                                          
##     pictures          1.000                               1.773    0.562
##     background        0.892    0.337    2.650    0.008    1.581    0.387
##     loveskids         0.547    0.344    1.587    0.112    0.969    0.208
##     energy            1.194    0.372    3.214    0.001    2.118    0.537
##     wagstail          1.712    0.517    3.310    0.001    3.035    0.597
##     playful           0.773    0.312    2.480    0.013    1.371    0.354
## 
## Variances:
##                    Estimate  Std.Err  z-value  P(>|z|)   Std.lv  Std.all
##    .pictures          6.824    1.323    5.160    0.000    6.824    0.685
##    .background       14.168    2.228    6.359    0.000   14.168    0.850
##    .loveskids        20.736    3.009    6.891    0.000   20.736    0.957
##    .energy           11.051    2.049    5.394    0.000   11.051    0.711
##    .wagstail         16.661    3.486    4.779    0.000   16.661    0.644
##    .playful          13.128    2.021    6.496    0.000   13.128    0.875
##     goodstory         3.143    1.369    2.296    0.022    1.000    1.000
adoptsurvey <- badvardata %>%
    select(-X1) %>%
    rename(pictures=V1, background=V2, loveskids=V3, energy=V4, wagstail=V5, playful=V6)
str(adoptsurvey, give.attr=FALSE)
## Classes 'tbl_df', 'tbl' and 'data.frame':    100 obs. of  6 variables:
##  $ pictures  : num  3.71 1.24 1.19 -1.26 4.58 ...
##  $ background: num  -0.964 6.38 -4.329 5.196 -0.145 ...
##  $ loveskids : num  3.86 5.95 8.23 2.46 9.53 ...
##  $ energy    : num  -6.73 1.61 4.09 7.6 -3.13 ...
##  $ wagstail  : num  -1.199 0.532 4.59 3.699 2.546 ...
##  $ playful   : num  4.1 1.93 4.04 4.56 3.43 ...
summary(adoptsurvey)
##     pictures         background         loveskids          energy      
##  Min.   :-4.5482   Min.   :-4.83064   Min.   :-7.162   Min.   :-6.729  
##  1st Qu.:-0.5815   1st Qu.:-0.03834   1st Qu.: 1.751   1st Qu.: 0.386  
##  Median : 1.7705   Median : 3.33339   Median : 4.585   Median : 2.081  
##  Mean   : 1.7912   Mean   : 3.04096   Mean   : 5.178   Mean   : 2.362  
##  3rd Qu.: 3.6228   3rd Qu.: 5.57599   3rd Qu.: 8.709   3rd Qu.: 4.906  
##  Max.   : 9.4674   Max.   :14.81218   Max.   :18.237   Max.   :12.091  
##     wagstail         playful      
##  Min.   :-9.945   Min.   :-4.913  
##  1st Qu.:-1.226   1st Qu.: 1.811  
##  Median : 2.160   Median : 3.916  
##  Mean   : 2.346   Mean   : 3.711  
##  3rd Qu.: 5.242   3rd Qu.: 5.751  
##  Max.   :19.811   Max.   :11.446
#Build the model
adopt.model <- 'goodstory =~ pictures + background + loveskids
inperson =~ energy + wagstail + playful'

#Analyze the model
adopt.fit <- cfa(model=adopt.model, data=adoptsurvey)
## Warning in lav_object_post_check(object): lavaan WARNING: some estimated ov
## variances are negative
#Summarize the model to view the negative variances
summary(adopt.fit, standardized=TRUE, fit.measures=TRUE, rsquare=TRUE)
## lavaan 0.6-2 ended normally after 303 iterations
## 
##   Optimization method                           NLMINB
##   Number of free parameters                         13
## 
##   Number of observations                           100
## 
##   Estimator                                         ML
##   Model Fit Test Statistic                       7.134
##   Degrees of freedom                                 8
##   P-value (Chi-square)                           0.522
## 
## Model test baseline model:
## 
##   Minimum Function Test Statistic               25.380
##   Degrees of freedom                                15
##   P-value                                        0.045
## 
## User model versus baseline model:
## 
##   Comparative Fit Index (CFI)                    1.000
##   Tucker-Lewis Index (TLI)                       1.156
## 
## Loglikelihood and Information Criteria:
## 
##   Loglikelihood user model (H0)              -1649.956
##   Loglikelihood unrestricted model (H1)      -1646.389
## 
##   Number of free parameters                         13
##   Akaike (AIC)                                3325.912
##   Bayesian (BIC)                              3359.779
##   Sample-size adjusted Bayesian (BIC)         3318.722
## 
## Root Mean Square Error of Approximation:
## 
##   RMSEA                                          0.000
##   90 Percent Confidence Interval          0.000  0.109
##   P-value RMSEA <= 0.05                          0.686
## 
## Standardized Root Mean Square Residual:
## 
##   SRMR                                           0.050
## 
## Parameter Estimates:
## 
##   Information                                 Expected
##   Information saturated (h1) model          Structured
##   Standard Errors                             Standard
## 
## Latent Variables:
##                    Estimate  Std.Err  z-value  P(>|z|)   Std.lv  Std.all
##   goodstory =~                                                          
##     pictures          1.000                               1.360    0.437
##     background        1.471    0.763    1.928    0.054    2.000    0.521
##     loveskids         1.746    0.892    1.958    0.050    2.375    0.501
##   inperson =~                                                           
##     energy            1.000                               0.208    0.058
##     wagstail         45.262 1090.143    0.042    0.967    9.409    1.969
##     playful           0.869    1.110    0.783    0.434    0.181    0.054
## 
## Covariances:
##                    Estimate  Std.Err  z-value  P(>|z|)   Std.lv  Std.all
##   goodstory ~~                                                          
##     inperson         -0.014    0.332   -0.041    0.967   -0.048   -0.048
## 
## Variances:
##                    Estimate  Std.Err  z-value  P(>|z|)   Std.lv  Std.all
##    .pictures          7.814    1.514    5.162    0.000    7.814    0.809
##    .background       10.762    2.695    3.993    0.000   10.762    0.729
##    .loveskids        16.791    3.936    4.266    0.000   16.791    0.749
##    .energy           12.642    2.066    6.119    0.000   12.642    0.997
##    .wagstail        -65.677 2124.215   -0.031    0.975  -65.677   -2.875
##    .playful          11.148    1.760    6.335    0.000   11.148    0.997
##     goodstory         1.850    1.310    1.411    0.158    1.000    1.000
##     inperson          0.043    1.046    0.041    0.967    1.000    1.000
## 
## R-Square:
##                    Estimate
##     pictures          0.191
##     background        0.271
##     loveskids         0.251
##     energy            0.003
##     wagstail             NA
##     playful           0.003
#View the variance of the problem manifest variable
var(adoptsurvey$wagstail)
## [1] 23.07446
#Update the model using 5 decimal places
adopt.model2 <- 'goodstory =~ pictures + background + loveskids
inperson =~ energy + wagstail + playful
wagstail~~23.07446*wagstail'

#Analyze and summarize the updated model
adopt.fit2 <- cfa(model = adopt.model2, data = adoptsurvey)
summary(adopt.fit2, standardized=TRUE, fit.measures=TRUE, rsquare=TRUE)
## lavaan 0.6-2 ended normally after 69 iterations
## 
##   Optimization method                           NLMINB
##   Number of free parameters                         12
## 
##   Number of observations                           100
## 
##   Estimator                                         ML
##   Model Fit Test Statistic                       8.493
##   Degrees of freedom                                 9
##   P-value (Chi-square)                           0.485
## 
## Model test baseline model:
## 
##   Minimum Function Test Statistic               25.380
##   Degrees of freedom                                15
##   P-value                                        0.045
## 
## User model versus baseline model:
## 
##   Comparative Fit Index (CFI)                    1.000
##   Tucker-Lewis Index (TLI)                       1.081
## 
## Loglikelihood and Information Criteria:
## 
##   Loglikelihood user model (H0)              -1650.635
##   Loglikelihood unrestricted model (H1)      -1646.389
## 
##   Number of free parameters                         12
##   Akaike (AIC)                                3325.270
##   Bayesian (BIC)                              3356.532
##   Sample-size adjusted Bayesian (BIC)         3318.633
## 
## Root Mean Square Error of Approximation:
## 
##   RMSEA                                          0.000
##   90 Percent Confidence Interval          0.000  0.108
##   P-value RMSEA <= 0.05                          0.664
## 
## Standardized Root Mean Square Residual:
## 
##   SRMR                                           0.058
## 
## Parameter Estimates:
## 
##   Information                                 Expected
##   Information saturated (h1) model          Structured
##   Standard Errors                             Standard
## 
## Latent Variables:
##                    Estimate  Std.Err  z-value  P(>|z|)   Std.lv  Std.all
##   goodstory =~                                                          
##     pictures          1.000                               1.344    0.432
##     background        1.461    0.758    1.928    0.054    1.964    0.511
##     loveskids         1.818    0.947    1.919    0.055    2.444    0.516
##   inperson =~                                                           
##     energy            1.000                               0.959    0.269
##     wagstail          1.391    2.244    0.620    0.535    1.334    0.268
##     playful           0.807    1.640    0.492    0.623    0.774    0.231
## 
## Covariances:
##                    Estimate  Std.Err  z-value  P(>|z|)   Std.lv  Std.all
##   goodstory ~~                                                          
##     inperson         -0.077    0.450   -0.172    0.863   -0.060   -0.060
## 
## Variances:
##                    Estimate  Std.Err  z-value  P(>|z|)   Std.lv  Std.all
##    .wagstail         23.074                              23.074    0.928
##    .pictures          7.857    1.510    5.203    0.000    7.857    0.813
##    .background       10.906    2.672    4.082    0.000   10.906    0.739
##    .loveskids        16.461    4.103    4.012    0.000   16.461    0.734
##    .energy           11.765    2.683    4.385    0.000   11.765    0.928
##    .playful          10.582    2.082    5.084    0.000   10.582    0.946
##     goodstory         1.807    1.296    1.395    0.163    1.000    1.000
##     inperson          0.920    2.209    0.416    0.677    1.000    1.000
## 
## R-Square:
##                    Estimate
##     wagstail          0.072
##     pictures          0.187
##     background        0.261
##     loveskids         0.266
##     energy            0.072
##     playful           0.054
#Create a default picture
semPlot::semPaths(adopt.fit)

#Update the default picture
semPlot::semPaths(object = adopt.fit, layout="tree", rotation=2)

#Update the default picture
semPlot::semPaths(object = adopt.fit, layout = "tree", rotation = 2, whatLabels = "std", 
                  edge.label.cex = 1, what = "std", edge.color = "blue"
                  )


Chapter 4 - Full Example and Extension

Model WAIS-III IQ Scale:

  • WAIS-III is a four-factor model of intelligence, including verbal, working memory, perceptual organization, and processing speed
    • Idea is that Verbal IQ drives verbal and working memory, Performance IQ drives perceptual and processing, and Verbal/Performance drive each other
    • 4 latent variables, measured by 12 manifest variables, with 2 additional latent variables at a higher layer that drive the initial 4 latent variables

Update WAIS-III Model:

  • Once the model is stable, can look for additional areas to further improve the model
  • Variables that are poor on loadings and are also high in variance should be further explored
  • Can also use modification indices to better understand and model the data
    • modificationindices(wais.fit, sort = TRUE)

Hierarchical Model of IQ:

  • One overall IQ that is the latent variable for all of the other latent variable
    • wais.model3 <- ’verbalcomp =~ vocab + simil + inform + compreh
    • workingmemory =~ arith + digspan + lnseq
    • perceptorg =~ piccomp + block + matrixreason + digsym + symbolsearch
    • simil ~~ inform
    • general =~ verbalcomp + workingmemory + perceptorg’ # the general is a new latent variable, built from other latent variables
  • The updated model will often have the same fit indices (simply shifting parameters from covariances to loadings)

Wrap Up:

  • Learned model syntax for lavaan (=~ for latent, ~~ for covariance/correlation, and ~ for prediction)
  • Learned to add constraints and troubleshoot Heywood cases
  • Learned one-factor, multi-factor, and hierarchical models

Example code includes:

IQdata <- readr::read_csv("./RInputFiles/IQdata.csv")
## Warning: Missing column names filled in: 'X1' [1]
## Parsed with column specification:
## cols(
##   X1 = col_integer(),
##   inform = col_integer(),
##   simil = col_integer(),
##   vocab = col_integer(),
##   compreh = col_integer(),
##   digspan = col_integer(),
##   arith = col_integer(),
##   piccomp = col_integer(),
##   block = col_integer(),
##   matrixreason = col_integer(),
##   symbolsearch = col_integer(),
##   digsym = col_integer(),
##   lnseq = col_integer()
## )
glimpse(IQdata)
## Observations: 300
## Variables: 13
## $ X1           <int> 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15...
## $ inform       <int> 31, 15, 13, 13, 22, 25, 20, 18, 21, 22, 16, 23, 1...
## $ simil        <int> 23, 20, 22, 21, 21, 22, 25, 25, 22, 25, 25, 24, 1...
## $ vocab        <int> 63, 44, 40, 51, 55, 61, 45, 61, 57, 56, 62, 53, 4...
## $ compreh      <int> 27, 21, 28, 21, 28, 27, 23, 28, 27, 22, 28, 30, 2...
## $ digspan      <int> 20, 13, 14, 22, 17, 20, 13, 22, 14, 15, 15, 26, 1...
## $ arith        <int> 18, 12, 13, 13, 10, 20, 16, 14, 16, 10, 13, 21, 1...
## $ piccomp      <int> 18, 13, 13, 16, 13, 18, 16, 22, 16, 16, 20, 19, 1...
## $ block        <int> 50, 29, 28, 36, 22, 59, 33, 43, 40, 31, 35, 59, 4...
## $ matrixreason <int> 21, 17, 16, 14, 13, 18, 14, 18, 13, 13, 21, 16, 1...
## $ symbolsearch <int> 38, 24, 25, 27, 27, 38, 31, 42, 34, 29, 37, 40, 3...
## $ digsym       <int> 57, 56, 72, 67, 60, 78, 60, 45, 40, 57, 63, 87, 7...
## $ lnseq        <int> 15, 12, 13, 18, 15, 16, 12, 30, 19, 16, 23, 16, 1...
IQdata <- IQdata %>%
    select(-X1)
glimpse(IQdata)
## Observations: 300
## Variables: 12
## $ inform       <int> 31, 15, 13, 13, 22, 25, 20, 18, 21, 22, 16, 23, 1...
## $ simil        <int> 23, 20, 22, 21, 21, 22, 25, 25, 22, 25, 25, 24, 1...
## $ vocab        <int> 63, 44, 40, 51, 55, 61, 45, 61, 57, 56, 62, 53, 4...
## $ compreh      <int> 27, 21, 28, 21, 28, 27, 23, 28, 27, 22, 28, 30, 2...
## $ digspan      <int> 20, 13, 14, 22, 17, 20, 13, 22, 14, 15, 15, 26, 1...
## $ arith        <int> 18, 12, 13, 13, 10, 20, 16, 14, 16, 10, 13, 21, 1...
## $ piccomp      <int> 18, 13, 13, 16, 13, 18, 16, 22, 16, 16, 20, 19, 1...
## $ block        <int> 50, 29, 28, 36, 22, 59, 33, 43, 40, 31, 35, 59, 4...
## $ matrixreason <int> 21, 17, 16, 14, 13, 18, 14, 18, 13, 13, 21, 16, 1...
## $ symbolsearch <int> 38, 24, 25, 27, 27, 38, 31, 42, 34, 29, 37, 40, 3...
## $ digsym       <int> 57, 56, 72, 67, 60, 78, 60, 45, 40, 57, 63, 87, 7...
## $ lnseq        <int> 15, 12, 13, 18, 15, 16, 12, 30, 19, 16, 23, 16, 1...
#Build a four-factor model
wais.model <- 'verbalcomp =~ vocab + simil + inform + compreh 
workingmemory =~ arith + digspan + lnseq
perceptorg =~ piccomp + block + matrixreason
processing =~ digsym + symbolsearch'

#Analyze the model
wais.fit <- cfa(model=wais.model, data=IQdata)
## Warning in lav_object_post_check(object): lavaan WARNING: covariance matrix of latent variables
##                 is not positive definite;
##                 use lavInspect(fit, "cov.lv") to investigate.
#Summarize the model
summary(wais.fit, standardized=TRUE, fit.measures=TRUE, rsquare=TRUE)
## lavaan 0.6-2 ended normally after 153 iterations
## 
##   Optimization method                           NLMINB
##   Number of free parameters                         30
## 
##   Number of observations                           300
## 
##   Estimator                                         ML
##   Model Fit Test Statistic                     233.268
##   Degrees of freedom                                48
##   P-value (Chi-square)                           0.000
## 
## Model test baseline model:
## 
##   Minimum Function Test Statistic             1042.916
##   Degrees of freedom                                66
##   P-value                                        0.000
## 
## User model versus baseline model:
## 
##   Comparative Fit Index (CFI)                    0.810
##   Tucker-Lewis Index (TLI)                       0.739
## 
## Loglikelihood and Information Criteria:
## 
##   Loglikelihood user model (H0)              -9939.800
##   Loglikelihood unrestricted model (H1)      -9823.166
## 
##   Number of free parameters                         30
##   Akaike (AIC)                               19939.599
##   Bayesian (BIC)                             20050.713
##   Sample-size adjusted Bayesian (BIC)        19955.570
## 
## Root Mean Square Error of Approximation:
## 
##   RMSEA                                          0.113
##   90 Percent Confidence Interval          0.099  0.128
##   P-value RMSEA <= 0.05                          0.000
## 
## Standardized Root Mean Square Residual:
## 
##   SRMR                                           0.073
## 
## Parameter Estimates:
## 
##   Information                                 Expected
##   Information saturated (h1) model          Structured
##   Standard Errors                             Standard
## 
## Latent Variables:
##                    Estimate  Std.Err  z-value  P(>|z|)   Std.lv  Std.all
##   verbalcomp =~                                                         
##     vocab             1.000                               6.282    0.879
##     simil             0.296    0.031    9.470    0.000    1.859    0.581
##     inform            0.450    0.043   10.483    0.000    2.825    0.645
##     compreh           0.315    0.035    8.986    0.000    1.979    0.551
##   workingmemory =~                                                      
##     arith             1.000                               2.530    0.845
##     digspan           0.875    0.137    6.373    0.000    2.213    0.561
##     lnseq             0.225    0.106    2.130    0.033    0.570    0.142
##   perceptorg =~                                                         
##     piccomp           1.000                               1.391    0.596
##     block             3.988    0.421    9.477    0.000    5.546    0.719
##     matrixreason      0.909    0.127    7.171    0.000    1.264    0.494
##   processing =~                                                         
##     digsym            1.000                               2.809    0.239
##     symbolsearch      1.065    0.300    3.547    0.000    2.990    0.724
## 
## Covariances:
##                    Estimate  Std.Err  z-value  P(>|z|)   Std.lv  Std.all
##   verbalcomp ~~                                                         
##     workingmemory     6.120    1.232    4.969    0.000    0.385    0.385
##     perceptorg        5.644    0.868    6.503    0.000    0.646    0.646
##     processing       10.050    3.150    3.190    0.001    0.570    0.570
##   workingmemory ~~                                                      
##     perceptorg        2.437    0.371    6.561    0.000    0.693    0.693
##     processing        2.701    0.984    2.745    0.006    0.380    0.380
##   perceptorg ~~                                                         
##     processing        4.027    1.200    3.356    0.001    1.031    1.031
## 
## Variances:
##                    Estimate  Std.Err  z-value  P(>|z|)   Std.lv  Std.all
##    .vocab            11.573    2.656    4.357    0.000   11.573    0.227
##    .simil             6.792    0.620   10.951    0.000    6.792    0.663
##    .inform           11.201    1.084   10.330    0.000   11.201    0.584
##    .compreh           8.969    0.804   11.157    0.000    8.969    0.696
##    .arith             2.560    0.901    2.842    0.004    2.560    0.286
##    .digspan          10.653    1.102    9.666    0.000   10.653    0.685
##    .lnseq            15.750    1.294   12.173    0.000   15.750    0.980
##    .piccomp           3.505    0.323   10.851    0.000    3.505    0.644
##    .block            28.761    3.207    8.968    0.000   28.761    0.483
##    .matrixreason      4.957    0.431   11.509    0.000    4.957    0.756
##    .digsym          130.314   10.847   12.014    0.000  130.314    0.943
##    .symbolsearch      8.127    2.480    3.277    0.001    8.127    0.476
##     verbalcomp       39.459    4.757    8.294    0.000    1.000    1.000
##     workingmemory     6.399    1.122    5.703    0.000    1.000    1.000
##     perceptorg        1.934    0.371    5.211    0.000    1.000    1.000
##     processing        7.889    4.309    1.831    0.067    1.000    1.000
## 
## R-Square:
##                    Estimate
##     vocab             0.773
##     simil             0.337
##     inform            0.416
##     compreh           0.304
##     arith             0.714
##     digspan           0.315
##     lnseq             0.020
##     piccomp           0.356
##     block             0.517
##     matrixreason      0.244
##     digsym            0.057
##     symbolsearch      0.524
#Edit the original model
wais.model <- 'verbalcomp =~ vocab + simil + inform + compreh 
workingmemory =~ arith + digspan + lnseq
perceptorg =~ piccomp + block + matrixreason + digsym + symbolsearch'

#Analyze the model
wais.fit <- cfa(model=wais.model, data=IQdata)

#Summarize the model
summary(wais.fit, standardized=TRUE, fit.measures=TRUE, rsquare=TRUE)
## lavaan 0.6-2 ended normally after 110 iterations
## 
##   Optimization method                           NLMINB
##   Number of free parameters                         27
## 
##   Number of observations                           300
## 
##   Estimator                                         ML
##   Model Fit Test Statistic                     252.809
##   Degrees of freedom                                51
##   P-value (Chi-square)                           0.000
## 
## Model test baseline model:
## 
##   Minimum Function Test Statistic             1042.916
##   Degrees of freedom                                66
##   P-value                                        0.000
## 
## User model versus baseline model:
## 
##   Comparative Fit Index (CFI)                    0.793
##   Tucker-Lewis Index (TLI)                       0.733
## 
## Loglikelihood and Information Criteria:
## 
##   Loglikelihood user model (H0)              -9949.570
##   Loglikelihood unrestricted model (H1)      -9823.166
## 
##   Number of free parameters                         27
##   Akaike (AIC)                               19953.141
##   Bayesian (BIC)                             20053.143
##   Sample-size adjusted Bayesian (BIC)        19967.515
## 
## Root Mean Square Error of Approximation:
## 
##   RMSEA                                          0.115
##   90 Percent Confidence Interval          0.101  0.129
##   P-value RMSEA <= 0.05                          0.000
## 
## Standardized Root Mean Square Residual:
## 
##   SRMR                                           0.076
## 
## Parameter Estimates:
## 
##   Information                                 Expected
##   Information saturated (h1) model          Structured
##   Standard Errors                             Standard
## 
## Latent Variables:
##                    Estimate  Std.Err  z-value  P(>|z|)   Std.lv  Std.all
##   verbalcomp =~                                                         
##     vocab             1.000                               6.281    0.879
##     simil             0.296    0.031    9.483    0.000    1.861    0.581
##     inform            0.449    0.043   10.481    0.000    2.822    0.644
##     compreh           0.315    0.035    8.999    0.000    1.981    0.552
##   workingmemory =~                                                      
##     arith             1.000                               2.528    0.844
##     digspan           0.881    0.152    5.786    0.000    2.227    0.565
##     lnseq             0.205    0.107    1.920    0.055    0.518    0.129
##   perceptorg =~                                                         
##     piccomp           1.000                               1.517    0.650
##     block             3.739    0.390    9.583    0.000    5.672    0.735
##     matrixreason      0.832    0.117    7.099    0.000    1.262    0.493
##     digsym            1.603    0.507    3.160    0.002    2.431    0.207
##     symbolsearch      1.880    0.204    9.236    0.000    2.852    0.690
## 
## Covariances:
##                    Estimate  Std.Err  z-value  P(>|z|)   Std.lv  Std.all
##   verbalcomp ~~                                                         
##     workingmemory     6.132    1.234    4.970    0.000    0.386    0.386
##     perceptorg        5.892    0.886    6.647    0.000    0.618    0.618
##   workingmemory ~~                                                      
##     perceptorg        2.227    0.362    6.149    0.000    0.581    0.581
## 
## Variances:
##                    Estimate  Std.Err  z-value  P(>|z|)   Std.lv  Std.all
##    .vocab            11.577    2.651    4.367    0.000   11.577    0.227
##    .simil             6.787    0.620   10.950    0.000    6.787    0.662
##    .inform           11.218    1.085   10.342    0.000   11.218    0.585
##    .compreh           8.962    0.803   11.155    0.000    8.962    0.696
##    .arith             2.571    1.014    2.535    0.011    2.571    0.287
##    .digspan          10.590    1.161    9.121    0.000   10.590    0.681
##    .lnseq            15.807    1.297   12.183    0.000   15.807    0.983
##    .piccomp           3.138    0.317    9.913    0.000    3.138    0.577
##    .block            27.343    3.226    8.476    0.000   27.343    0.459
##    .matrixreason      4.960    0.441   11.243    0.000    4.960    0.757
##    .digsym          132.291   10.925   12.109    0.000  132.291    0.957
##    .symbolsearch      8.936    0.957    9.333    0.000    8.936    0.524
##     verbalcomp       39.455    4.754    8.299    0.000    1.000    1.000
##     workingmemory     6.388    1.215    5.259    0.000    1.000    1.000
##     perceptorg        2.301    0.408    5.646    0.000    1.000    1.000
## 
## R-Square:
##                    Estimate
##     vocab             0.773
##     simil             0.338
##     inform            0.415
##     compreh           0.304
##     arith             0.713
##     digspan           0.319
##     lnseq             0.017
##     piccomp           0.423
##     block             0.541
##     matrixreason      0.243
##     digsym            0.043
##     symbolsearch      0.476
#Update the default picture
semPlot::semPaths(object = wais.fit, layout = "tree", rotation = 1, whatLabels = "std", 
                  edge.label.cex = 1, what = "std", edge.color = "black"
                  )

#Examine modification indices 
modificationindices(wais.fit, sort = TRUE)
##               lhs op          rhs     mi     epc sepc.lv sepc.all sepc.nox
## 66          simil ~~       inform 35.879  -3.757  -3.757   -0.431   -0.431
## 56          vocab ~~       inform 28.377   9.783   9.783    0.858    0.858
## 48     perceptorg =~        vocab 21.865  -2.077  -3.151   -0.441   -0.441
## 115         block ~~ matrixreason 16.209  -3.622  -3.622   -0.311   -0.311
## 96          arith ~~        block 15.061   3.679   3.679    0.439    0.439
## 117         block ~~ symbolsearch 13.144   5.725   5.725    0.366    0.366
## 47  workingmemory =~ symbolsearch 12.272  -0.467  -1.181   -0.286   -0.286
## 81         inform ~~        block 12.269   4.358   4.358    0.249    0.249
## 64          vocab ~~       digsym 11.578 -11.261 -11.261   -0.288   -0.288
## 40  workingmemory =~        simil 11.383   0.278   0.703    0.220    0.220
## 72          simil ~~        block 10.605  -3.084  -3.084   -0.226   -0.226
## 45  workingmemory =~ matrixreason  9.685   0.267   0.675    0.264    0.264
## 95          arith ~~      piccomp  9.463  -0.892  -0.892   -0.314   -0.314
## 60          vocab ~~        lnseq  9.425  -3.486  -3.486   -0.258   -0.258
## 67          simil ~~      compreh  9.356   1.587   1.587    0.203    0.203
## 44  workingmemory =~        block  9.258   0.765   1.933    0.251    0.251
## 51     perceptorg =~      compreh  9.177   0.601   0.912    0.254    0.254
## 62          vocab ~~        block  8.712  -5.377  -5.377   -0.302   -0.302
## 73          simil ~~ matrixreason  8.672   1.065   1.065    0.184    0.184
## 106         lnseq ~~      piccomp  8.620   1.298   1.298    0.184    0.184
## 91        compreh ~~       digsym  8.155   5.908   5.908    0.172    0.172
## 59          vocab ~~      digspan  8.127   2.849   2.849    0.257    0.257
## 37     verbalcomp =~       digsym  7.803  -0.464  -2.917   -0.248   -0.248
## 68          simil ~~        arith  7.534   1.064   1.064    0.255    0.255
## 99          arith ~~ symbolsearch  7.468  -1.391  -1.391   -0.290   -0.290
## 57          vocab ~~      compreh  7.107  -3.508  -3.508   -0.344   -0.344
## 87        compreh ~~        lnseq  7.001   1.887   1.887    0.159    0.159
## 97          arith ~~ matrixreason  6.391   0.848   0.848    0.237    0.237
## 107         lnseq ~~        block  5.677   3.289   3.289    0.158    0.158
## 34     verbalcomp =~      piccomp  5.507   0.071   0.447    0.192    0.192
## 78         inform ~~      digspan  5.435  -1.649  -1.649   -0.151   -0.151
## 33     verbalcomp =~        lnseq  5.250  -0.104  -0.652   -0.163   -0.163
## 54     perceptorg =~        lnseq  4.644   0.512   0.777    0.194    0.194
## 39  workingmemory =~        vocab  4.638  -0.406  -1.025   -0.143   -0.143
## 102       digspan ~~        block  4.564  -2.689  -2.689   -0.158   -0.158
## 35     verbalcomp =~        block  4.551  -0.218  -1.371   -0.178   -0.178
## 88        compreh ~~      piccomp  4.455   0.728   0.728    0.137    0.137
## 112       piccomp ~~ matrixreason  4.306   0.568   0.568    0.144    0.144
## 101       digspan ~~      piccomp  4.218   0.808   0.808    0.140    0.140
## 46  workingmemory =~       digsym  4.139  -0.852  -2.152   -0.183   -0.183
## 71          simil ~~      piccomp  4.029   0.607   0.607    0.132    0.132
## 76         inform ~~      compreh  3.789  -1.367  -1.367   -0.136   -0.136
## 70          simil ~~        lnseq  3.693  -1.200  -1.200   -0.116   -0.116
## 50     perceptorg =~       inform  3.487   0.444   0.673    0.154    0.154
## 58          vocab ~~        arith  3.451  -1.457  -1.457   -0.267   -0.267
## 55          vocab ~~        simil  3.393   2.239   2.239    0.253    0.253
## 113       piccomp ~~       digsym  3.375   2.419   2.419    0.119    0.119
## 93          arith ~~      digspan  3.274   7.960   7.960    1.526    1.526
## 86        compreh ~~      digspan  3.234  -1.110  -1.110   -0.114   -0.114
## 80         inform ~~      piccomp  2.871  -0.672  -0.672   -0.113   -0.113
## 104       digspan ~~       digsym  2.754  -3.822  -3.822   -0.102   -0.102
## 114       piccomp ~~ symbolsearch  2.677  -0.731  -0.731   -0.138   -0.138
## 89        compreh ~~        block  2.551   1.725   1.725    0.110    0.110
## 90        compreh ~~ matrixreason  2.342  -0.632  -0.632   -0.095   -0.095
## 74          simil ~~       digsym  2.021  -2.575  -2.575   -0.086   -0.086
## 43  workingmemory =~      piccomp  1.899  -0.104  -0.262   -0.113   -0.113
## 49     perceptorg =~        simil  1.675   0.227   0.345    0.108    0.108
## 92        compreh ~~ symbolsearch  1.646   0.764   0.764    0.085    0.085
## 111       piccomp ~~        block  1.591  -1.084  -1.084   -0.117   -0.117
## 85        compreh ~~        arith  1.350  -0.514  -0.514   -0.107   -0.107
## 32     verbalcomp =~      digspan  1.224   0.058   0.365    0.092    0.092
## 79         inform ~~        lnseq  0.998  -0.815  -0.815   -0.061   -0.061
## 69          simil ~~      digspan  0.996   0.540   0.540    0.064    0.064
## 53     perceptorg =~      digspan  0.942  -0.710  -1.077   -0.273   -0.273
## 77         inform ~~        arith  0.890   0.480   0.480    0.089    0.089
## 116         block ~~       digsym  0.805   3.770   3.770    0.063    0.063
## 120        digsym ~~ symbolsearch  0.724   1.948   1.948    0.057    0.057
## 100       digspan ~~        lnseq  0.703  -0.688  -0.688   -0.053   -0.053
## 83         inform ~~       digsym  0.667   1.935   1.935    0.050    0.050
## 36     verbalcomp =~ matrixreason  0.543   0.025   0.159    0.062    0.062
## 61          vocab ~~      piccomp  0.529   0.414   0.414    0.069    0.069
## 105       digspan ~~ symbolsearch  0.481  -0.475  -0.475   -0.049   -0.049
## 52     perceptorg =~        arith  0.478  -0.694  -1.052   -0.352   -0.352
## 98          arith ~~       digsym  0.474  -1.135  -1.135   -0.062   -0.062
## 94          arith ~~        lnseq  0.430  -0.496  -0.496   -0.078   -0.078
## 31     verbalcomp =~        arith  0.237  -0.029  -0.182   -0.061   -0.061
## 103       digspan ~~ matrixreason  0.226   0.221   0.221    0.030    0.030
## 42  workingmemory =~      compreh  0.190  -0.041  -0.103   -0.029   -0.029
## 75          simil ~~ symbolsearch  0.188  -0.227  -0.227   -0.029   -0.029
## 63          vocab ~~ matrixreason  0.143  -0.253  -0.253   -0.033   -0.033
## 109         lnseq ~~       digsym  0.128  -0.951  -0.951   -0.021   -0.021
## 38     verbalcomp =~ symbolsearch  0.077   0.015   0.094    0.023    0.023
## 118  matrixreason ~~       digsym  0.060  -0.380  -0.380   -0.015   -0.015
## 41  workingmemory =~       inform  0.037   0.021   0.053    0.012    0.012
## 119  matrixreason ~~ symbolsearch  0.031  -0.085  -0.085   -0.013   -0.013
## 108         lnseq ~~ matrixreason  0.017   0.069   0.069    0.008    0.008
## 110         lnseq ~~ symbolsearch  0.009   0.072   0.072    0.006    0.006
## 65          vocab ~~ symbolsearch  0.005  -0.068  -0.068   -0.007   -0.007
## 84         inform ~~ symbolsearch  0.004  -0.045  -0.045   -0.004   -0.004
## 82         inform ~~ matrixreason  0.004   0.029   0.029    0.004    0.004
#Update the three-factor model
wais.model2 <- 'verbalcomp =~ vocab + simil + inform + compreh 
workingmemory =~ arith + digspan + lnseq
perceptorg =~ piccomp + block + matrixreason + digsym + symbolsearch
simil ~~ inform'

#Analyze the three-factor model where data is IQdata
wais.fit2 <- cfa(model=wais.model2, data=IQdata)

#Summarize the three-factor model 
summary(wais.fit2, standardized=TRUE, fit.measures=TRUE, rsquare=TRUE)
## lavaan 0.6-2 ended normally after 114 iterations
## 
##   Optimization method                           NLMINB
##   Number of free parameters                         28
## 
##   Number of observations                           300
## 
##   Estimator                                         ML
##   Model Fit Test Statistic                     212.813
##   Degrees of freedom                                50
##   P-value (Chi-square)                           0.000
## 
## Model test baseline model:
## 
##   Minimum Function Test Statistic             1042.916
##   Degrees of freedom                                66
##   P-value                                        0.000
## 
## User model versus baseline model:
## 
##   Comparative Fit Index (CFI)                    0.833
##   Tucker-Lewis Index (TLI)                       0.780
## 
## Loglikelihood and Information Criteria:
## 
##   Loglikelihood user model (H0)              -9929.572
##   Loglikelihood unrestricted model (H1)      -9823.166
## 
##   Number of free parameters                         28
##   Akaike (AIC)                               19915.144
##   Bayesian (BIC)                             20018.850
##   Sample-size adjusted Bayesian (BIC)        19930.051
## 
## Root Mean Square Error of Approximation:
## 
##   RMSEA                                          0.104
##   90 Percent Confidence Interval          0.090  0.119
##   P-value RMSEA <= 0.05                          0.000
## 
## Standardized Root Mean Square Residual:
## 
##   SRMR                                           0.071
## 
## Parameter Estimates:
## 
##   Information                                 Expected
##   Information saturated (h1) model          Structured
##   Standard Errors                             Standard
## 
## Latent Variables:
##                    Estimate  Std.Err  z-value  P(>|z|)   Std.lv  Std.all
##   verbalcomp =~                                                         
##     vocab             1.000                               5.888    0.824
##     simil             0.361    0.035   10.184    0.000    2.125    0.664
##     inform            0.525    0.048   10.857    0.000    3.090    0.706
##     compreh           0.334    0.036    9.349    0.000    1.965    0.547
##   workingmemory =~                                                      
##     arith             1.000                               2.565    0.857
##     digspan           0.857    0.149    5.768    0.000    2.199    0.558
##     lnseq             0.193    0.104    1.850    0.064    0.495    0.123
##   perceptorg =~                                                         
##     piccomp           1.000                               1.515    0.650
##     block             3.737    0.390    9.581    0.000    5.662    0.734
##     matrixreason      0.843    0.118    7.176    0.000    1.278    0.499
##     digsym            1.615    0.508    3.181    0.001    2.446    0.208
##     symbolsearch      1.875    0.203    9.218    0.000    2.841    0.688
## 
## Covariances:
##                    Estimate  Std.Err  z-value  P(>|z|)   Std.lv  Std.all
##  .simil ~~                                                              
##    .inform           -3.738    0.606   -6.169    0.000   -3.738   -0.503
##   verbalcomp ~~                                                         
##     workingmemory     6.278    1.181    5.315    0.000    0.416    0.416
##     perceptorg        5.654    0.859    6.583    0.000    0.634    0.634
##   workingmemory ~~                                                      
##     perceptorg        2.237    0.363    6.172    0.000    0.576    0.576
## 
## Variances:
##                    Estimate  Std.Err  z-value  P(>|z|)   Std.lv  Std.all
##    .vocab            16.365    2.375    6.892    0.000   16.365    0.321
##    .simil             5.734    0.610    9.399    0.000    5.734    0.560
##    .inform            9.635    1.095    8.801    0.000    9.635    0.502
##    .compreh           9.026    0.791   11.413    0.000    9.026    0.700
##    .arith             2.380    1.037    2.294    0.022    2.380    0.266
##    .digspan          10.715    1.154    9.282    0.000   10.715    0.689
##    .lnseq            15.830    1.298   12.193    0.000   15.830    0.985
##    .piccomp           3.143    0.316    9.937    0.000    3.143    0.578
##    .block            27.457    3.220    8.527    0.000   27.457    0.461
##    .matrixreason      4.921    0.439   11.216    0.000    4.921    0.751
##    .digsym          132.218   10.920   12.108    0.000  132.218    0.957
##    .symbolsearch      8.996    0.958    9.393    0.000    8.996    0.527
##     verbalcomp       34.667    4.408    7.865    0.000    1.000    1.000
##     workingmemory     6.579    1.239    5.309    0.000    1.000    1.000
##     perceptorg        2.296    0.407    5.643    0.000    1.000    1.000
## 
## R-Square:
##                    Estimate
##     vocab             0.679
##     simil             0.440
##     inform            0.498
##     compreh           0.300
##     arith             0.734
##     digspan           0.311
##     lnseq             0.015
##     piccomp           0.422
##     block             0.539
##     matrixreason      0.249
##     digsym            0.043
##     symbolsearch      0.473
#Compare the models
anova(wais.fit, wais.fit2)
## Chi Square Difference Test
## 
##           Df   AIC   BIC  Chisq Chisq diff Df diff Pr(>Chisq)    
## wais.fit2 50 19915 20019 212.81                                  
## wais.fit  51 19953 20053 252.81     39.996       1  2.545e-10 ***
## ---
## Signif. codes:  0 '***' 0.001 '**' 0.01 '*' 0.05 '.' 0.1 ' ' 1
#View the fit indices for the original model
fitmeasures(wais.fit, c("aic", "ecvi"))
##       aic      ecvi 
## 19953.141     1.023
#View the fit indices for the updated model
fitmeasures(wais.fit2, c("aic", "ecvi"))
##       aic      ecvi 
## 19915.144     0.896
#Update the three-factor model to a hierarchical model
wais.model3 <- 'verbalcomp =~ vocab + simil + inform + compreh 
workingmemory =~ arith + digspan + lnseq
perceptorg =~ piccomp + block + matrixreason + digsym + symbolsearch
simil ~~ inform
general =~ verbalcomp + workingmemory + perceptorg'

#Analyze the hierarchical model where data is IQdata
wais.fit3 <- cfa(model = wais.model3, data = IQdata)

#Examine the fit indices for the old model
fitmeasures(wais.fit2, c("rmsea", "srmr"))
## rmsea  srmr 
## 0.104 0.071
#Examine the fit indices for the new model
fitmeasures(wais.fit3, c("rmsea", "srmr"))
## rmsea  srmr 
## 0.104 0.071
#Update the default picture
semPlot::semPaths(object = wais.fit3, layout = "tree", rotation = 1, whatLabels = "std", 
                  edge.label.cex = 1, what = "std", edge.color = "navy"
                  )


Working with Data in the Tidyverse

Chapter 1 - Explore Data

Import data:

  • Begging steps of the pipeline include importing, tidying, and transforming (wrangling)
  • Focus of this course will be recatngular data including both columns (variables) and rows (observations)
    • bakers # 10x6 tibble
    • tibbles are a special type of data frame - both store rectangular data in R
  • Can read the data using readr::read_csv()
    • ?read_csv
    • bakers <- read_csv(“bakers.csv”)
    • bakers # same 10x6 tibble

Know data:

  • The bakeoff data includes three types of challenges - Signature, Technical, Showstopper
  • Tibble printing by default will cut off columns and just show the variables - glimpse from dplyr can help with visualizing
    • glimpse(bakers_mini)
    • library(skimr)
    • skim(bakers_mini) # skim provides statistics for every column depending on the variable types

Count data - broken video that provides some code snippets:

  • bakers %>% distinct(series)
  • bakers %>% count(series)
  • bakers %>% group_by(series) %>% summarize(n = n())
  • bakers %>% count(aired_us, series)
  • bakers %>% count(aired_us, series) %>% mutate(prop_bakers = n/sum(n))
  • bakers %>% group_by(aired_us, series) %>% summarize(n = n()) %>% mutate(prop_bakers = n/sum(n))
  • bakers %>% count(aired_us, series) %>% count(aired_us)

Example code includes:

# Read in "bakeoff.csv" as bakeoff
bakeoff <- readr::read_csv("./RInputFiles/bakeoff.csv")
## Parsed with column specification:
## cols(
##   series = col_integer(),
##   episode = col_integer(),
##   baker = col_character(),
##   signature = col_character(),
##   technical = col_integer(),
##   showstopper = col_character(),
##   result = col_character(),
##   uk_airdate = col_date(format = ""),
##   us_season = col_integer(),
##   us_airdate = col_date(format = "")
## )
# Print bakeoff
bakeoff
## # A tibble: 549 x 10
##    series episode baker signature technical showstopper result uk_airdate
##     <int>   <int> <chr> <chr>         <int> <chr>       <chr>  <date>    
##  1      1       1 Anne~ "Light J~         2 Chocolate ~ IN     2010-08-17
##  2      1       1 David Chocolat~         3 "Black For~ IN     2010-08-17
##  3      1       1 Edd   Caramel ~         1 <NA>        IN     2010-08-17
##  4      1       1 Jasm~ Fresh Ma~        NA <NA>        IN     2010-08-17
##  5      1       1 Jona~ Carrot C~         9 Three-laye~ IN     2010-08-17
##  6      1       1 Loui~ Carrot a~        NA "Never Fai~ IN     2010-08-17
##  7      1       1 Mira~ "Triple ~         8 "Three Tie~ IN     2010-08-17
##  8      1       1 Ruth  "Lemon D~        NA "Classic C~ IN     2010-08-17
##  9      1       1 Lea   "Cranber~        10 "Chocolate~ OUT    2010-08-17
## 10      1       1 Mark  Sticky M~        NA Heart-shap~ OUT    2010-08-17
## # ... with 539 more rows, and 2 more variables: us_season <int>,
## #   us_airdate <date>
# Data set above is already OK - UNKNOWN are NA in CSV
# Filter rows where showstopper is UNKNOWN 
bakeoff %>% 
    filter(showstopper == "UNKNOWN")
## # A tibble: 0 x 10
## # ... with 10 variables: series <int>, episode <int>, baker <chr>,
## #   signature <chr>, technical <int>, showstopper <chr>, result <chr>,
## #   uk_airdate <date>, us_season <int>, us_airdate <date>
# Edit to add list of missing values
bakeoff <- read_csv("./RInputFiles/bakeoff.csv", na = c("", "NA", "UNKNOWN"))
## Parsed with column specification:
## cols(
##   series = col_integer(),
##   episode = col_integer(),
##   baker = col_character(),
##   signature = col_character(),
##   technical = col_integer(),
##   showstopper = col_character(),
##   result = col_character(),
##   uk_airdate = col_date(format = ""),
##   us_season = col_integer(),
##   us_airdate = col_date(format = "")
## )
# Filter rows where showstopper is NA 
bakeoff %>% 
    filter(is.na(showstopper))
## # A tibble: 21 x 10
##    series episode baker signature technical showstopper result uk_airdate
##     <int>   <int> <chr> <chr>         <int> <chr>       <chr>  <date>    
##  1      1       1 Edd   Caramel ~         1 <NA>        IN     2010-08-17
##  2      1       1 Jasm~ Fresh Ma~        NA <NA>        IN     2010-08-17
##  3      1       6 Mira~ Lemon Cu~        NA <NA>        RUNNE~ 2010-09-21
##  4      2       1 Ian   Apple an~        10 <NA>        IN     2011-08-16
##  5      2       1 Jason "Lemon M~         6 <NA>        IN     2011-08-16
##  6      2       1 Urva~ Cherry B~         7 <NA>        IN     2011-08-16
##  7      2       1 Yasm~ Cardamom~         5 <NA>        IN     2011-08-16
##  8      2       1 Holly "Cherry ~         1 <NA>        SB     2011-08-16
##  9      2       2 Ben   Chorizo,~         1 <NA>        IN     2011-08-23
## 10      2       2 Ian   "Stilton~         2 <NA>        IN     2011-08-23
## # ... with 11 more rows, and 2 more variables: us_season <int>,
## #   us_airdate <date>
# Edit to filter, group by, and skim
bakeoff %>% 
  filter(!is.na(us_season)) %>% 
  group_by(us_season) %>%
  skimr::skim()
## Skim summary statistics
##  n obs: 302 
##  n variables: 10 
##  group variables: us_season 
## 
## -- Variable type:character ---------------------------------------------------------------------------------------
##  us_season    variable missing complete  n min max empty n_unique
##          1       baker       0       78 78   3   9     0       13
##          1      result       0       78 78   2   9     0        5
##          1 showstopper       0       78 78   5 126     0       78
##          1   signature       0       78 78  10 125     0       78
##          2       baker       0       74 74   4   7     0       12
##          2      result       0       74 74   2   9     0        6
##          2 showstopper       1       73 74   8  82     0       73
##          2   signature       1       73 74  15 107     0       73
##          3       baker       0       75 75   3   6     0       12
##          3      result       0       75 75   2   9     0        5
##          3 showstopper       0       75 75  10  70     0       73
##          3   signature       0       75 75  12  64     0       74
##          4       baker       0       75 75   3   9     0       12
##          4      result       0       75 75   2   9     0        5
##          4 showstopper       0       75 75   5  86     0       74
##          4   signature       0       75 75  12  93     0       75
## 
## -- Variable type:Date --------------------------------------------------------------------------------------------
##  us_season   variable missing complete  n        min        max     median
##          1 uk_airdate       0       78 78 2013-08-20 2013-10-22 2013-09-10
##          1 us_airdate       0       78 78 2014-12-28 2015-03-01 2015-01-18
##          2 uk_airdate       0       74 74 2014-08-06 2014-10-08 2014-08-27
##          2 us_airdate       0       74 74 2015-09-06 2015-11-08 2015-09-27
##          3 uk_airdate       0       75 75 2015-08-05 2015-10-07 2015-08-26
##          3 us_airdate       0       75 75 2016-07-01 2016-08-12 2016-07-15
##          4 uk_airdate       0       75 75 2016-08-24 2016-10-26 2016-09-14
##          4 us_airdate       0       75 75 2017-06-16 2017-08-04 2017-06-30
##  n_unique
##        10
##        10
##        10
##        10
##        10
##         7
##        10
##         8
## 
## -- Variable type:integer -----------------------------------------------------------------------------------------
##  us_season  variable missing complete  n mean   sd p0  p25 p50 p75 p100
##          1   episode       0       78 78 4.31 2.66  1 2    4     6   10
##          1    series       0       78 78 4    0     4 4    4     4    4
##          1 technical       0       78 78 5.08 3.19  1 2.25 4.5   7   13
##          2   episode       0       74 74 4.38 2.68  1 2    4     6   10
##          2    series       0       74 74 5    0     5 5    5     5    5
##          2 technical       1       73 74 4.73 2.93  1 2    4     7   12
##          3   episode       0       75 75 4.4  2.67  1 2    4     6   10
##          3    series       0       75 75 6    0     6 6    6     6    6
##          3 technical       0       75 75 4.8  2.92  1 2    4     7   12
##          4   episode       0       75 75 4.4  2.67  1 2    4     6   10
##          4    series       0       75 75 7    0     7 7    7     7    7
##          4 technical       0       75 75 4.8  2.92  1 2    4     7   12
##      hist
##  <U+2587><U+2583><U+2583><U+2582><U+2582><U+2582><U+2582><U+2582>
##  <U+2581><U+2581><U+2581><U+2587><U+2581><U+2581><U+2581><U+2581>
##  <U+2587><U+2587><U+2583><U+2585><U+2582><U+2583><U+2581><U+2581>
##  <U+2587><U+2583><U+2583><U+2583><U+2582><U+2582><U+2582><U+2582>
##  <U+2581><U+2581><U+2581><U+2587><U+2581><U+2581><U+2581><U+2581>
##  <U+2587><U+2583><U+2587><U+2583><U+2582><U+2583><U+2581><U+2581>
##  <U+2587><U+2583><U+2583><U+2583><U+2582><U+2582><U+2582><U+2582>
##  <U+2581><U+2581><U+2581><U+2587><U+2581><U+2581><U+2581><U+2581>
##  <U+2587><U+2583><U+2587><U+2583><U+2582><U+2583><U+2581><U+2581>
##  <U+2587><U+2583><U+2583><U+2583><U+2582><U+2582><U+2582><U+2582>
##  <U+2581><U+2581><U+2581><U+2587><U+2581><U+2581><U+2581><U+2581>
##  <U+2587><U+2583><U+2587><U+2583><U+2582><U+2583><U+2581><U+2581>
bakeoff %>% 
  distinct(result)
## # A tibble: 6 x 1
##   result   
##   <chr>    
## 1 IN       
## 2 OUT      
## 3 RUNNER UP
## 4 WINNER   
## 5 SB       
## 6 LEFT
# Count rows by distinct results
bakeoff %>% 
  count(result)
## # A tibble: 6 x 2
##   result        n
##   <chr>     <int>
## 1 IN          393
## 2 LEFT          1
## 3 OUT          70
## 4 RUNNER UP    16
## 5 SB           61
## 6 WINNER        8
# Count whether or not star baker
bakeoff %>% 
  count(result=="SB")
## # A tibble: 2 x 2
##   `result == "SB"`     n
##   <lgl>            <int>
## 1 FALSE              488
## 2 TRUE                61
# Count the number of rows by series and episode
bakeoff %>%
  count(series, episode)
## # A tibble: 74 x 3
##    series episode     n
##     <int>   <int> <int>
##  1      1       1    10
##  2      1       2     8
##  3      1       3     6
##  4      1       4     5
##  5      1       5     4
##  6      1       6     3
##  7      2       1    12
##  8      2       2    11
##  9      2       3    10
## 10      2       4     8
## # ... with 64 more rows
# Add second count by series
bakeoff %>% 
  count(series, episode) %>%
  count(series)
## # A tibble: 8 x 2
##   series    nn
##    <int> <int>
## 1      1     6
## 2      2     8
## 3      3    10
## 4      4    10
## 5      5    10
## 6      6    10
## 7      7    10
## 8      8    10
# Count the number of rows by series and baker
bakers_by_series <- 
  bakeoff %>%
  count(series, baker)

# Print to view
bakers_by_series
## # A tibble: 95 x 3
##    series baker         n
##     <int> <chr>     <int>
##  1      1 Annetha       2
##  2      1 David         4
##  3      1 Edd           6
##  4      1 Jasminder     5
##  5      1 Jonathan      3
##  6      1 Lea           1
##  7      1 Louise        2
##  8      1 Mark          1
##  9      1 Miranda       6
## 10      1 Ruth          6
## # ... with 85 more rows
# Count again by series
bakers_by_series %>%
  count(series)
## # A tibble: 8 x 2
##   series    nn
##    <int> <int>
## 1      1    10
## 2      2    12
## 3      3    12
## 4      4    13
## 5      5    12
## 6      6    12
## 7      7    12
## 8      8    12
# Count again by baker
bakers_by_series %>%
  count(baker, sort=TRUE)
## # A tibble: 86 x 2
##    baker     nn
##    <chr>  <int>
##  1 Kate       3
##  2 Ian        2
##  3 James      2
##  4 Louise     2
##  5 Mark       2
##  6 Peter      2
##  7 Robert     2
##  8 Tom        2
##  9 Ali        1
## 10 Alvin      1
## # ... with 76 more rows
ggplot(bakeoff, aes(x=episode)) + 
    geom_bar() + 
    facet_wrap(~series)


Chapter 2 - Tame Data

Cast column types:

  • Type-casting can be an important step in taming data
  • The readr package has options for col_type within the read_csv() function
    • By default, all of the column types are guessed from the first 1,000 rows
    • bakers_raw %>% dplyr::slice(1:4) # look at the first 4 rows
  • Can convert a character to a number using parse_number()
    • parse_number(“36 years”) # will become 36
    • bakers_tame <- read_csv(file = “bakers.csv”, col_types = cols(age = col_number()) ) # col_number() will wrangle the age column to a numeric
  • Can also use the parse_date capability to manage datetime inputs
    • parse_date(“14 August 2012”, format = “%d %B %Y”)
    • bakers <- read_csv(“bakers.csv”, col_types = cols( last_date_uk = col_date(format = “%d %B %Y”) )) # col_date() will wrangle last_date_uk to a datetime
  • There is always both a parse_* and a col_* for any given data type; can practive with parse_* then use col_* in the read-in

Recode values:

  • The recode() function in dplyr can be used to recode values in the data
    • young_bakers %>% mutate(stu_label = recode(student, 0 = “other”, .default = “student”)) # 0 will become other, anything else will become student
    • young_bakers %>% mutate(stu_label = recode(student, 0 = NA_character_, .default = “student”)) # create NA for a specific string
    • young_bakers %>% mutate(student = na_if(student, 0)) # na_if will convert to NA if the condition(s) is met

Select variables:

  • Can select just a subset of the variables using select
  • The select() function is powerful when you only need to work with a subset of the data
    • young_bakers2 %>% select(baker, series_winner) # keep these variables
    • young_bakers2 %>% select(-technical_winner) # drop these variables (signalled by the minus sign)
  • Can use helper functions inside the select() call
    • young_bakers2 %>% select(baker, starts_with(“series”))
    • young_bakers2 %>% select(ends_with(“winner”), baker)
    • young_bakers2 %>% select(contains(“bake”))
  • The filter() function works on rows rather than columns
    • young_bakers2 %>% filter(series_winner == 1 | series_runner_up == 1)

Tame variable names:

  • Can rename variables while selecting
    • young_bakers3 %>% select(baker, tech_1 = tre1)
    • young_bakers3 %>% select(baker, tech_ = tre1:tre3)
    • young_bakers3 %>% select(baker, tech_ = starts_with(“tr”), result_ = starts_with(“rs”))
  • Within the rename call, it is not possible to use the helper functions
    • young_bakers3 %>% rename(tech_1 = t_first, result_1 = r_first) # new = old
    • young_bakers3 %>% select(everything(), tech_ = starts_with(“tr”), result_ = starts_with(“rs”)) # everything first keeps all the column orders the same
  • Can also use the janitor package to help with cleaning variables
    • young_bakers3 %>% janitor::clean_names()
    • Converts to snake case (lower case with underscores)

Example code includes:

# NOTE THAT THIS WILL THROW WARNINGS
# Try to cast technical as a number
desserts <- readr::read_csv("./RInputFiles/desserts.csv",
                      col_types = cols(
                        technical = col_number())
                     )
## Warning in rbind(names(probs), probs_f): number of columns of result is not
## a multiple of vector length (arg 1)
## Warning: 7 parsing failures.
## row # A tibble: 5 x 5 col     row col       expected actual file                         expected   <int> <chr>     <chr>    <chr>  <chr>                        actual 1     4 technical a number N/A    './RInputFiles/desserts.csv' file 2     6 technical a number N/A    './RInputFiles/desserts.csv' row 3     8 technical a number N/A    './RInputFiles/desserts.csv' col 4    10 technical a number N/A    './RInputFiles/desserts.csv' expected 5    34 technical a number N/A    './RInputFiles/desserts.csv'
## ... ................. ... .............................................................. ........ .............................................................. ...... .............................................................. .... .............................................................. ... .............................................................. ... .............................................................. ........ ..............................................................
## See problems(...) for more details.
# View parsing problems
readr::problems(desserts)
## # A tibble: 7 x 5
##     row col       expected actual file                        
##   <int> <chr>     <chr>    <chr>  <chr>                       
## 1     4 technical a number N/A    './RInputFiles/desserts.csv'
## 2     6 technical a number N/A    './RInputFiles/desserts.csv'
## 3     8 technical a number N/A    './RInputFiles/desserts.csv'
## 4    10 technical a number N/A    './RInputFiles/desserts.csv'
## 5    34 technical a number N/A    './RInputFiles/desserts.csv'
## 6    35 technical a number N/A    './RInputFiles/desserts.csv'
## 7    36 technical a number N/A    './RInputFiles/desserts.csv'
# NOTE THAT THIS WILL FIX THE ERRORS
# Edit code to fix the parsing error 
desserts <- readr::read_csv("./RInputFiles/desserts.csv",
                      col_types = cols(
                        technical = col_number()),
                      na = c("", "NA", "N/A") 
                     )

# View parsing problems
readr::problems(desserts)
## # tibble [0 x 4]
## # ... with 4 variables: row <int>, col <int>, expected <chr>, actual <chr>
# Find format to parse uk_airdate 
readr::parse_date("17 August 2010", format = "%d %B %Y")
## [1] "2010-08-17"
# Edit to cast uk_airdate
desserts <- readr::read_csv("./RInputFiles/desserts.csv", 
                     na = c("", "NA", "N/A"),
                     col_types = cols(
                       technical = col_number(),
                       uk_airdate = col_date("%d %B %Y")
                     ))

# Print by descending uk_airdate
desserts %>%
  arrange(desc(uk_airdate))
## # A tibble: 549 x 16
##    series episode baker technical result uk_airdate us_season us_airdate
##     <int>   <int> <chr>     <dbl> <chr>  <date>         <int> <date>    
##  1      8      10 Kate          3 RUNNE~ 2017-10-31        NA NA        
##  2      8      10 Stev~         1 RUNNE~ 2017-10-31        NA NA        
##  3      8      10 Soph~         2 WINNER 2017-10-31        NA NA        
##  4      8       9 Kate          4 IN     2017-10-24        NA NA        
##  5      8       9 Stev~         3 IN     2017-10-24        NA NA        
##  6      8       9 Stac~         2 OUT    2017-10-24        NA NA        
##  7      8       9 Soph~         1 SB     2017-10-24        NA NA        
##  8      8       8 Kate          2 IN     2017-10-17        NA NA        
##  9      8       8 Soph~         4 IN     2017-10-17        NA NA        
## 10      8       8 Stev~         1 IN     2017-10-17        NA NA        
## # ... with 539 more rows, and 8 more variables:
## #   showstopper_chocolate <chr>, showstopper_dessert <chr>,
## #   showstopper_fruit <chr>, showstopper_nut <chr>,
## #   signature_chocolate <chr>, signature_dessert <chr>,
## #   signature_fruit <chr>, signature_nut <chr>
# Cast result a factor
desserts <- readr::read_csv("./RInputFiles/desserts.csv", 
                     na = c("", "NA", "N/A"),
                     col_types = cols(
                       technical = col_number(),
                       uk_airdate = col_date(format = "%d %B %Y"),
                       result = col_factor(levels=NULL)
                     ))
                    
# Glimpse to view
glimpse(desserts)
## Observations: 549
## Variables: 16
## $ series                <int> 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1...
## $ episode               <int> 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 2, 2, 2, 2...
## $ baker                 <chr> "Annetha", "David", "Edd", "Jasminder", ...
## $ technical             <dbl> 2, 3, 1, NA, 9, NA, 8, NA, 10, NA, 8, 6,...
## $ result                <fct> IN, IN, IN, IN, IN, IN, IN, IN, OUT, OUT...
## $ uk_airdate            <date> 2010-08-17, 2010-08-17, 2010-08-17, 201...
## $ us_season             <int> NA, NA, NA, NA, NA, NA, NA, NA, NA, NA, ...
## $ us_airdate            <date> NA, NA, NA, NA, NA, NA, NA, NA, NA, NA,...
## $ showstopper_chocolate <chr> "chocolate", "chocolate", "no chocolate"...
## $ showstopper_dessert   <chr> "other", "other", "other", "other", "oth...
## $ showstopper_fruit     <chr> "no fruit", "no fruit", "no fruit", "no ...
## $ showstopper_nut       <chr> "no nut", "no nut", "no nut", "no nut", ...
## $ signature_chocolate   <chr> "no chocolate", "chocolate", "no chocola...
## $ signature_dessert     <chr> "cake", "cake", "cake", "cake", "cake", ...
## $ signature_fruit       <chr> "no fruit", "fruit", "fruit", "fruit", "...
## $ signature_nut         <chr> "no nut", "no nut", "no nut", "no nut", ...
oldDesserts <- desserts
tempDesserts <- desserts %>%
    gather(key="type_ing", value="status", starts_with(c("showstopper")), starts_with(c("signature"))) %>%
    separate(type_ing, into=c("challenge", "ingredient"), sep="_") %>%
    spread(ingredient, status)
glimpse(tempDesserts)
## Observations: 1,098
## Variables: 13
## $ series     <int> 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, ...
## $ episode    <int> 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 2, 2, 2, 2, 2, 2, 2, ...
## $ baker      <chr> "Annetha", "David", "Edd", "Jasminder", "Jonathan",...
## $ technical  <dbl> 2, 3, 1, NA, 9, NA, 8, NA, 10, NA, 8, 6, 2, 1, 3, 5...
## $ result     <fct> IN, IN, IN, IN, IN, IN, IN, IN, OUT, OUT, IN, IN, I...
## $ uk_airdate <date> 2010-08-17, 2010-08-17, 2010-08-17, 2010-08-17, 20...
## $ us_season  <int> NA, NA, NA, NA, NA, NA, NA, NA, NA, NA, NA, NA, NA,...
## $ us_airdate <date> NA, NA, NA, NA, NA, NA, NA, NA, NA, NA, NA, NA, NA...
## $ challenge  <chr> "showstopper", "showstopper", "showstopper", "shows...
## $ chocolate  <chr> "chocolate", "chocolate", "no chocolate", "no choco...
## $ dessert    <chr> "other", "other", "other", "other", "other", "cake"...
## $ fruit      <chr> "no fruit", "no fruit", "no fruit", "no fruit", "fr...
## $ nut        <chr> "no nut", "no nut", "no nut", "no nut", "almond", "...
desserts <- tempDesserts


# Count rows grouping by nut variable
desserts %>%
  count(nut, sort=TRUE)
## # A tibble: 8 x 2
##   nut           n
##   <chr>     <int>
## 1 no nut      944
## 2 almond       35
## 3 walnut       35
## 4 pistachio    29
## 5 filbert      23
## 6 pecan        14
## 7 multiple      9
## 8 peanut        9
# Recode filberts as hazelnuts
desserts <- desserts %>% 
  mutate(nut = recode(nut, "filbert" = "hazelnut"))

# Count rows again 
desserts %>% 
    count(nut, sort = TRUE)
## # A tibble: 8 x 2
##   nut           n
##   <chr>     <int>
## 1 no nut      944
## 2 almond       35
## 3 walnut       35
## 4 pistachio    29
## 5 hazelnut     23
## 6 pecan        14
## 7 multiple      9
## 8 peanut        9
# Edit code to recode "no nut" as missing
desserts <- desserts %>% 
  mutate(nut = recode(nut, "filbert" = "hazelnut", 
                           "no nut" = NA_character_))

# Count rows again 
desserts %>% 
    count(nut, sort = TRUE)
## # A tibble: 8 x 2
##   nut           n
##   <chr>     <int>
## 1 <NA>        944
## 2 almond       35
## 3 walnut       35
## 4 pistachio    29
## 5 hazelnut     23
## 6 pecan        14
## 7 multiple      9
## 8 peanut        9
# Edit to recode tech_win as factor
desserts <- desserts %>% 
  mutate(tech_win = recode_factor(technical, `1` = 1,
                           .default = 0))

# Count to compare values                      
desserts %>% 
  count(technical == 1, tech_win)
## # A tibble: 3 x 3
##   `technical == 1` tech_win     n
##   <lgl>            <fct>    <int>
## 1 FALSE            0          936
## 2 TRUE             1          146
## 3 NA               <NA>        16
ratings0 <- readr::read_csv("./RInputFiles/02.03_messy_ratings.csv")
## Parsed with column specification:
## cols(
##   .default = col_double(),
##   series = col_integer(),
##   episodes = col_integer(),
##   premiere = col_character(),
##   finale = col_character(),
##   winner = col_character(),
##   day_of_week = col_character(),
##   timeslot = col_time(format = ""),
##   channel = col_character(),
##   runner_up_1 = col_character(),
##   runner_up_2 = col_character(),
##   season = col_integer(),
##   season_premiere = col_character(),
##   season_finale = col_character(),
##   e1_uk_airdate = col_character(),
##   e2_uk_airdate = col_character(),
##   e3_uk_airdate = col_character(),
##   e4_uk_airdate = col_character(),
##   e5_uk_airdate = col_character(),
##   e6_uk_airdate = col_character(),
##   e7_uk_airdate = col_character()
##   # ... with 3 more columns
## )
## See spec(...) for full column specifications.
str(ratings0, give.attr=FALSE)
## Classes 'tbl_df', 'tbl' and 'data.frame':    8 obs. of  44 variables:
##  $ series           : int  1 2 3 4 5 6 7 8
##  $ episodes         : int  6 8 10 10 10 10 10 10
##  $ premiere         : chr  "17-Aug-10" "14-Aug-11" "14-Aug-12" "20-Aug-13" ...
##  $ finale           : chr  "21-Sep-10" "4-Oct-11" "16-Oct-12" "22-Oct-13" ...
##  $ winner           : chr  "Edd Kimber" "Joanne Wheatley" "John Whaite" "Frances Quinn" ...
##  $ avg_uk_viewers   : num  2.77 4 5 7.35 10.04 ...
##  $ day_of_week      : chr  "Tuesday" "Tuesday" "Tuesday" "Tuesday" ...
##  $ timeslot         : 'hms' num  20:00:00 20:00:00 20:00:00 20:00:00 ...
##  $ channel          : chr  "BBC Two" "BBC Two" "BBC Two" "BBC Two" ...
##  $ runner_up_1      : chr  "Miranda Gore Browne" "Holly Bell" "Brendan Lynch" "Kimberley Wilson" ...
##  $ runner_up_2      : chr  "Ruth Clemens" "Mary-Anne Boermans" "James Morton" "Ruby Tandoh" ...
##  $ season           : int  NA NA NA 1 2 3 4 NA
##  $ season_premiere  : chr  NA NA NA "12/28/14" ...
##  $ season_finale    : chr  NA NA NA "3/1/15" ...
##  $ e1_viewers_7day  : num  2.24 3.1 3.85 6.6 8.51 ...
##  $ e1_viewers_28day : num  NA NA NA NA NA ...
##  $ e2_viewers_7day  : num  3 3.53 4.6 6.65 8.79 ...
##  $ e2_viewers_28day : num  NA NA NA NA NA ...
##  $ e3_viewers_7day  : num  3 3.82 4.53 7.17 9.28 ...
##  $ e3_viewers_28day : num  NA NA NA NA NA ...
##  $ e4_viewers_7day  : num  2.6 3.6 4.71 6.82 10.25 ...
##  $ e4_viewers_28day : num  NA NA NA NA NA ...
##  $ e5_viewers_7day  : num  3.03 3.83 4.61 6.95 9.95 ...
##  $ e5_viewers_28day : num  NA NA NA NA NA ...
##  $ e6_viewers_7day  : num  2.75 4.25 4.82 7.32 10.13 ...
##  $ e6_viewers_28day : num  NA NA NA NA NA ...
##  $ e7_viewers_7day  : num  NA 4.42 5.1 7.76 10.28 ...
##  $ e7_viewers_28day : num  NA NA NA NA NA ...
##  $ e8_viewers_7day  : num  NA 5.06 5.35 7.41 9.02 ...
##  $ e8_viewers_28day : num  NA NA NA NA NA ...
##  $ e9_viewers_7day  : num  NA NA 5.7 7.41 10.67 ...
##  $ e9_viewers_28day : num  NA NA NA NA NA ...
##  $ e10_viewers_7day : num  NA NA 6.74 9.45 13.51 ...
##  $ e10_viewers_28day: num  NA NA NA NA NA ...
##  $ e1_uk_airdate    : chr  "8/17/10" "8/16/11" "8/14/12" "8/20/13" ...
##  $ e2_uk_airdate    : chr  "8/24/10" "8/23/11" "8/21/12" "8/27/13" ...
##  $ e3_uk_airdate    : chr  "8/31/10" "8/30/11" "8/28/12" "9/3/13" ...
##  $ e4_uk_airdate    : chr  "9/7/10" "9/6/11" "9/4/12" "9/10/13" ...
##  $ e5_uk_airdate    : chr  "9/14/10" "9/13/11" "9/11/12" "9/17/13" ...
##  $ e6_uk_airdate    : chr  "9/21/10" "9/20/11" "9/18/12" "9/24/13" ...
##  $ e7_uk_airdate    : chr  NA "9/27/11" "9/25/12" "10/1/13" ...
##  $ e8_uk_airdate    : chr  NA "10/4/11" "10/2/12" "10/8/13" ...
##  $ e9_uk_airdate    : chr  NA NA "10/9/12" "10/15/13" ...
##  $ e10_uk_airdate   : chr  NA NA "10/16/12" "10/22/13" ...
ratings <- ratings0 %>%
    filter(series >= 3) %>%
    rename(day=day_of_week) %>%
    mutate(series=factor(series), 
           season_premiere=lubridate::mdy(season_premiere), 
           season_finale=lubridate::mdy(season_finale), 
           viewer_growth = (e10_viewers_7day - e1_viewers_7day)
           ) %>%
    select(-contains("uk_airdate"))


# Recode channel as dummy: bbc (1) or not (0)
ratings <- ratings %>% 
  mutate(bbc = recode_factor(channel, "Channel 4"=0, .default=1))

# Look at the variables to plot next
ratings %>% select(series, channel, bbc, viewer_growth)
## # A tibble: 6 x 4
##   series channel   bbc   viewer_growth
##   <fct>  <chr>     <fct>         <dbl>
## 1 3      BBC Two   1             2.89 
## 2 4      BBC Two   1             2.85 
## 3 5      BBC One   1             5    
## 4 6      BBC One   1             3.43 
## 5 7      BBC One   1             2.32 
## 6 8      Channel 4 0             0.580
# Make a filled bar chart
ggplot(ratings, aes(x = series, y = viewer_growth, fill = bbc)) +
  geom_col()

# Move channel to first column
ratings %>% 
  select(channel, everything())
## # A tibble: 6 x 36
##   channel series episodes premiere finale winner avg_uk_viewers day  
##   <chr>   <fct>     <int> <chr>    <chr>  <chr>           <dbl> <chr>
## 1 BBC Two 3            10 14-Aug-~ 16-Oc~ John ~           5    Tues~
## 2 BBC Two 4            10 20-Aug-~ 22-Oc~ Franc~           7.35 Tues~
## 3 BBC One 5            10 6-Aug-14 8-Oct~ Nancy~          10.0  Wedn~
## 4 BBC One 6            10 5-Aug-15 7-Oct~ Nadiy~          12.5  Wedn~
## 5 BBC One 7            10 24-Aug-~ 26-Oc~ Candi~          13.8  Wedn~
## 6 Channe~ 8            10 29-Aug-~ 31-Oc~ Sophi~           9.29 Tues~
## # ... with 28 more variables: timeslot <time>, runner_up_1 <chr>,
## #   runner_up_2 <chr>, season <int>, season_premiere <date>,
## #   season_finale <date>, e1_viewers_7day <dbl>, e1_viewers_28day <dbl>,
## #   e2_viewers_7day <dbl>, e2_viewers_28day <dbl>, e3_viewers_7day <dbl>,
## #   e3_viewers_28day <dbl>, e4_viewers_7day <dbl>, e4_viewers_28day <dbl>,
## #   e5_viewers_7day <dbl>, e5_viewers_28day <dbl>, e6_viewers_7day <dbl>,
## #   e6_viewers_28day <dbl>, e7_viewers_7day <dbl>, e7_viewers_28day <dbl>,
## #   e8_viewers_7day <dbl>, e8_viewers_28day <dbl>, e9_viewers_7day <dbl>,
## #   e9_viewers_28day <dbl>, e10_viewers_7day <dbl>,
## #   e10_viewers_28day <dbl>, viewer_growth <dbl>, bbc <fct>
# Edit to drop 7- and 28-day episode viewer data
ratings %>% 
  select(-ends_with("day"))
## # A tibble: 6 x 15
##   series episodes premiere finale winner avg_uk_viewers timeslot channel
##   <fct>     <int> <chr>    <chr>  <chr>           <dbl> <time>   <chr>  
## 1 3            10 14-Aug-~ 16-Oc~ John ~           5    20:00    BBC Two
## 2 4            10 20-Aug-~ 22-Oc~ Franc~           7.35 20:00    BBC Two
## 3 5            10 6-Aug-14 8-Oct~ Nancy~          10.0  20:00    BBC One
## 4 6            10 5-Aug-15 7-Oct~ Nadiy~          12.5  20:00    BBC One
## 5 7            10 24-Aug-~ 26-Oc~ Candi~          13.8  20:00    BBC One
## 6 8            10 29-Aug-~ 31-Oc~ Sophi~           9.29 20:00    Channe~
## # ... with 7 more variables: runner_up_1 <chr>, runner_up_2 <chr>,
## #   season <int>, season_premiere <date>, season_finale <date>,
## #   viewer_growth <dbl>, bbc <fct>
# Edit to move channel to first and drop episode viewer data
ratings %>% 
  select(-ends_with("day")) %>%
  select(channel, everything())
## # A tibble: 6 x 15
##   channel series episodes premiere finale winner avg_uk_viewers timeslot
##   <chr>   <fct>     <int> <chr>    <chr>  <chr>           <dbl> <time>  
## 1 BBC Two 3            10 14-Aug-~ 16-Oc~ John ~           5    20:00   
## 2 BBC Two 4            10 20-Aug-~ 22-Oc~ Franc~           7.35 20:00   
## 3 BBC One 5            10 6-Aug-14 8-Oct~ Nancy~          10.0  20:00   
## 4 BBC One 6            10 5-Aug-15 7-Oct~ Nadiy~          12.5  20:00   
## 5 BBC One 7            10 24-Aug-~ 26-Oc~ Candi~          13.8  20:00   
## 6 Channe~ 8            10 29-Aug-~ 31-Oc~ Sophi~           9.29 20:00   
## # ... with 7 more variables: runner_up_1 <chr>, runner_up_2 <chr>,
## #   season <int>, season_premiere <date>, season_finale <date>,
## #   viewer_growth <dbl>, bbc <fct>
# Glimpse messy names
# glimpse(messy_ratings)

# Reformat to lower camelcase
# ratings <- messy_ratings %>%
#   clean_names(case="lower_camel")
    
# Glimpse cleaned names
# glimpse(ratings)

# Reformat to snake case
# ratings <- messy_ratings %>% 
#     clean_names("snake")

# Glimpse cleaned names
# glimpse(ratings)


# Select 7-day viewer data by series
viewers_7day <- ratings %>%
  select(series, contains("7day"))

# Glimpse
glimpse(viewers_7day)
## Observations: 6
## Variables: 11
## $ series           <fct> 3, 4, 5, 6, 7, 8
## $ e1_viewers_7day  <dbl> 3.85, 6.60, 8.51, 11.62, 13.58, 9.46
## $ e2_viewers_7day  <dbl> 4.60, 6.65, 8.79, 11.59, 13.45, 9.23
## $ e3_viewers_7day  <dbl> 4.53, 7.17, 9.28, 12.01, 13.01, 8.68
## $ e4_viewers_7day  <dbl> 4.71, 6.82, 10.25, 12.36, 13.29, 8.55
## $ e5_viewers_7day  <dbl> 4.61, 6.95, 9.95, 12.39, 13.12, 8.61
## $ e6_viewers_7day  <dbl> 4.82, 7.32, 10.13, 12.00, 13.13, 8.61
## $ e7_viewers_7day  <dbl> 5.10, 7.76, 10.28, 12.35, 13.45, 9.01
## $ e8_viewers_7day  <dbl> 5.350, 7.410, 9.023, 11.090, 13.260, 8.950
## $ e9_viewers_7day  <dbl> 5.70, 7.41, 10.67, 12.65, 13.44, 9.03
## $ e10_viewers_7day <dbl> 6.74, 9.45, 13.51, 15.05, 15.90, 10.04
# Adapt code to also rename 7-day viewer data
viewers_7day <- ratings %>% 
    select(series, viewers_7day_ = ends_with("7day"))

# Glimpse
glimpse(viewers_7day)
## Observations: 6
## Variables: 11
## $ series          <fct> 3, 4, 5, 6, 7, 8
## $ viewers_7day_1  <dbl> 3.85, 6.60, 8.51, 11.62, 13.58, 9.46
## $ viewers_7day_2  <dbl> 4.60, 6.65, 8.79, 11.59, 13.45, 9.23
## $ viewers_7day_3  <dbl> 4.53, 7.17, 9.28, 12.01, 13.01, 8.68
## $ viewers_7day_4  <dbl> 4.71, 6.82, 10.25, 12.36, 13.29, 8.55
## $ viewers_7day_5  <dbl> 4.61, 6.95, 9.95, 12.39, 13.12, 8.61
## $ viewers_7day_6  <dbl> 4.82, 7.32, 10.13, 12.00, 13.13, 8.61
## $ viewers_7day_7  <dbl> 5.10, 7.76, 10.28, 12.35, 13.45, 9.01
## $ viewers_7day_8  <dbl> 5.350, 7.410, 9.023, 11.090, 13.260, 8.950
## $ viewers_7day_9  <dbl> 5.70, 7.41, 10.67, 12.65, 13.44, 9.03
## $ viewers_7day_10 <dbl> 6.74, 9.45, 13.51, 15.05, 15.90, 10.04
# Adapt code to drop 28-day columns; move 7-day to front
viewers_7day <- ratings %>% 
    select(viewers_7day_ = ends_with("7day"), everything(), -contains("28day"))

# Glimpse
glimpse(viewers_7day)
## Observations: 6
## Variables: 26
## $ viewers_7day_1  <dbl> 3.85, 6.60, 8.51, 11.62, 13.58, 9.46
## $ viewers_7day_2  <dbl> 4.60, 6.65, 8.79, 11.59, 13.45, 9.23
## $ viewers_7day_3  <dbl> 4.53, 7.17, 9.28, 12.01, 13.01, 8.68
## $ viewers_7day_4  <dbl> 4.71, 6.82, 10.25, 12.36, 13.29, 8.55
## $ viewers_7day_5  <dbl> 4.61, 6.95, 9.95, 12.39, 13.12, 8.61
## $ viewers_7day_6  <dbl> 4.82, 7.32, 10.13, 12.00, 13.13, 8.61
## $ viewers_7day_7  <dbl> 5.10, 7.76, 10.28, 12.35, 13.45, 9.01
## $ viewers_7day_8  <dbl> 5.350, 7.410, 9.023, 11.090, 13.260, 8.950
## $ viewers_7day_9  <dbl> 5.70, 7.41, 10.67, 12.65, 13.44, 9.03
## $ viewers_7day_10 <dbl> 6.74, 9.45, 13.51, 15.05, 15.90, 10.04
## $ series          <fct> 3, 4, 5, 6, 7, 8
## $ episodes        <int> 10, 10, 10, 10, 10, 10
## $ premiere        <chr> "14-Aug-12", "20-Aug-13", "6-Aug-14", "5-Aug-1...
## $ finale          <chr> "16-Oct-12", "22-Oct-13", "8-Oct-14", "7-Oct-1...
## $ winner          <chr> "John Whaite", "Frances Quinn", "Nancy Birtwhi...
## $ avg_uk_viewers  <dbl> 5.00, 7.35, 10.04, 12.50, 13.85, 9.29
## $ day             <chr> "Tuesday", "Tuesday", "Wednesday", "Wednesday"...
## $ timeslot        <time> 20:00:00, 20:00:00, 20:00:00, 20:00:00, 20:00...
## $ channel         <chr> "BBC Two", "BBC Two", "BBC One", "BBC One", "B...
## $ runner_up_1     <chr> "Brendan Lynch", "Kimberley Wilson", "Luis Tro...
## $ runner_up_2     <chr> "James Morton", "Ruby Tandoh", "Richard Burr",...
## $ season          <int> NA, 1, 2, 3, 4, NA
## $ season_premiere <date> NA, 2014-12-28, 2015-09-06, 2016-07-01, 2017-...
## $ season_finale   <date> NA, 2015-03-01, 2015-11-08, 2016-08-12, 2017-...
## $ viewer_growth   <dbl> 2.89, 2.85, 5.00, 3.43, 2.32, 0.58
## $ bbc             <fct> 1, 1, 1, 1, 1, 0
# Adapt code to keep original order
viewers_7day <- ratings %>% 
    select(everything(), -ends_with("28day"), viewers_7day_ = ends_with("7day"))

# Glimpse
glimpse(viewers_7day)
## Observations: 6
## Variables: 26
## $ series          <fct> 3, 4, 5, 6, 7, 8
## $ episodes        <int> 10, 10, 10, 10, 10, 10
## $ premiere        <chr> "14-Aug-12", "20-Aug-13", "6-Aug-14", "5-Aug-1...
## $ finale          <chr> "16-Oct-12", "22-Oct-13", "8-Oct-14", "7-Oct-1...
## $ winner          <chr> "John Whaite", "Frances Quinn", "Nancy Birtwhi...
## $ avg_uk_viewers  <dbl> 5.00, 7.35, 10.04, 12.50, 13.85, 9.29
## $ day             <chr> "Tuesday", "Tuesday", "Wednesday", "Wednesday"...
## $ timeslot        <time> 20:00:00, 20:00:00, 20:00:00, 20:00:00, 20:00...
## $ channel         <chr> "BBC Two", "BBC Two", "BBC One", "BBC One", "B...
## $ runner_up_1     <chr> "Brendan Lynch", "Kimberley Wilson", "Luis Tro...
## $ runner_up_2     <chr> "James Morton", "Ruby Tandoh", "Richard Burr",...
## $ season          <int> NA, 1, 2, 3, 4, NA
## $ season_premiere <date> NA, 2014-12-28, 2015-09-06, 2016-07-01, 2017-...
## $ season_finale   <date> NA, 2015-03-01, 2015-11-08, 2016-08-12, 2017-...
## $ viewers_7day_1  <dbl> 3.85, 6.60, 8.51, 11.62, 13.58, 9.46
## $ viewers_7day_2  <dbl> 4.60, 6.65, 8.79, 11.59, 13.45, 9.23
## $ viewers_7day_3  <dbl> 4.53, 7.17, 9.28, 12.01, 13.01, 8.68
## $ viewers_7day_4  <dbl> 4.71, 6.82, 10.25, 12.36, 13.29, 8.55
## $ viewers_7day_5  <dbl> 4.61, 6.95, 9.95, 12.39, 13.12, 8.61
## $ viewers_7day_6  <dbl> 4.82, 7.32, 10.13, 12.00, 13.13, 8.61
## $ viewers_7day_7  <dbl> 5.10, 7.76, 10.28, 12.35, 13.45, 9.01
## $ viewers_7day_8  <dbl> 5.350, 7.410, 9.023, 11.090, 13.260, 8.950
## $ viewers_7day_9  <dbl> 5.70, 7.41, 10.67, 12.65, 13.44, 9.03
## $ viewers_7day_10 <dbl> 6.74, 9.45, 13.51, 15.05, 15.90, 10.04
## $ viewer_growth   <dbl> 2.89, 2.85, 5.00, 3.43, 2.32, 0.58
## $ bbc             <fct> 1, 1, 1, 1, 1, 0

Chapter 3 - Tidy Your Data

Introduction to Tidy Data:

  • Tidy data helps with producing good plots - allows for faceting and the like
  • Data can be tidy but not tame, and can be tame but not tidy
    • In general, tidy data is long rather than wide
    • As a result, tidy data tends to take up more space, but with the advantage of being easier to plot or analyze
  • Can automatically get counts summed to a specific level
    • juniors_tidy %>% count(baker, wt = correct) # variable wt will be the sum of correct
    • ggplot(juniors_tidy, aes(baker, correct)) + geom_col() # roughly the equivalent if plotting the data

Gather:

  • Gathering is the process of converting data from wide to long
    • gather(data, key, value, .)
    • key is the new column containing the variable
    • value is the new column contining the value
    • The . are the columns to be gathered, with column name going to the key column and associated values going to the value column
    • The key and value need to be quoted while the . can be passed bare (unquoted)

Separate:

  • Sometimes, a column really contains two variable, for example when there is spice_trail or the like
  • The separate function requires at least three arguments
    • data - the data frame
    • col - the column that you want to separate (can be a bare variable name since it already exists in the data frame)
    • into - quoted variables to be created, inside the c() function
    • By default, the existing column col is replaced
    • There is also an option for convert=TRUE where it will try to pick the best variable type (especially helpful when creating numbers)
    • There is also the option for sep, where the defaults for separators can be over-ridden to better match the data

Spread:

  • The spread function is designed to convert long data to wide data
    • Spread can be considered a tool to tidy messy rows, where gather is a tool to tidy messy columns
    • data - the data frame
    • key - the key is the column that currently contains what should become the new columns
    • value - value is the column that currently contains what should become the values in the new columns
    • convert=TRUE will help with re-casting variable types (particularly helpful when numbers are being pulled out of a mixed character-number column (likely what drove the need to spread)

Tidy multiple sets of data:

  • Sometimes, there are multiple data components to tidy, where the columns need to be fixed in several ways
    • For example, score_1, guess_1, score_2, guess_2
    • Ideal target would be to have trials (1, 2, 3) in one column, and with columns score and guess containing the variables
  • Example code for converting multiple columns simultaneously
    • juniors_multi %>% gather(key = “key”, value = “value”, score_1:guess_3) %>% separate(key, into = c(“var”, “order”), convert = TRUE)
    • juniors_multi %>% gather(key = “key”, value = “value”, score_1:guess_3) %>% separate(key, into = c(“var”, “order”), convert = TRUE) %>% spread(var, value)

Example code includes:

ratings1 <- readr::read_csv("./RInputFiles/messy_ratings.csv")
## Parsed with column specification:
## cols(
##   series = col_integer(),
##   e1 = col_double(),
##   e2 = col_double(),
##   e3 = col_double(),
##   e4 = col_double(),
##   e5 = col_double(),
##   e6 = col_double(),
##   e7 = col_double(),
##   e8 = col_double(),
##   e9 = col_double(),
##   e10 = col_double()
## )
oldRatings <- ratings
ratings <- ratings1
ratings1
## # A tibble: 8 x 11
##   series    e1    e2    e3    e4    e5    e6    e7    e8    e9   e10
##    <int> <dbl> <dbl> <dbl> <dbl> <dbl> <dbl> <dbl> <dbl> <dbl> <dbl>
## 1      1  2.24  3     3     2.6   3.03  2.75 NA    NA    NA    NA   
## 2      2  3.1   3.53  3.82  3.6   3.83  4.25  4.42  5.06 NA    NA   
## 3      3  3.85  4.6   4.53  4.71  4.61  4.82  5.1   5.35  5.7   6.74
## 4      4  6.6   6.65  7.17  6.82  6.95  7.32  7.76  7.41  7.41  9.45
## 5      5  8.51  8.79  9.28 10.2   9.95 10.1  10.3   9.02 10.7  13.5 
## 6      6 11.6  11.6  12.0  12.4  12.4  12    12.4  11.1  12.6  15.0 
## 7      7 13.6  13.4  13.0  13.3  13.1  13.1  13.4  13.3  13.4  15.9 
## 8      8  9.46  9.23  8.68  8.55  8.61  8.61  9.01  8.95  9.03 10.0
# Plot of episode 1 viewers by series
ratings %>%
  ggplot(aes(x=series, y=e1)) + 
  geom_bar(stat="identity")

# Adapt code to plot episode 2 viewers by series
ggplot(ratings, aes(x = series, y = e2)) +
    geom_col() 

# Gather and count episodes
tidy_ratings <- ratings %>%
    gather(key = "episode", value = "viewers_7day", -series, 
           factor_key = TRUE, na.rm = TRUE) %>% 
    arrange(series, episode) %>% 
    mutate(episode_count = row_number())

# Plot viewers by episode and series
ggplot(tidy_ratings, aes(x = episode_count, y = viewers_7day, fill = as.factor(series))) +
    geom_col()

ratings2 <- readr::read_csv("./RInputFiles/messy_ratings2.csv")
## Parsed with column specification:
## cols(
##   .default = col_double(),
##   series = col_integer()
## )
## See spec(...) for full column specifications.
ratings2$series <- as.factor(ratings2$series)
ratings2
## # A tibble: 8 x 21
##   series e1_7day e1_28day e2_7day e2_28day e3_7day e3_28day e4_7day
##   <fct>    <dbl>    <dbl>   <dbl>    <dbl>   <dbl>    <dbl>   <dbl>
## 1 1         2.24    NA       3       NA       3       NA       2.6 
## 2 2         3.1     NA       3.53    NA       3.82    NA       3.6 
## 3 3         3.85    NA       4.6     NA       4.53    NA       4.71
## 4 4         6.6     NA       6.65    NA       7.17    NA       6.82
## 5 5         8.51    NA       8.79    NA       9.28    NA      10.2 
## 6 6        11.6     11.7    11.6     11.8    12.0     NA      12.4 
## 7 7        13.6     13.9    13.4     13.7    13.0     13.4    13.3 
## 8 8         9.46     9.72    9.23     9.53    8.68     9.06    8.55
## # ... with 13 more variables: e4_28day <dbl>, e5_7day <dbl>,
## #   e5_28day <dbl>, e6_7day <dbl>, e6_28day <dbl>, e7_7day <dbl>,
## #   e7_28day <dbl>, e8_7day <dbl>, e8_28day <dbl>, e9_7day <dbl>,
## #   e9_28day <dbl>, e10_7day <dbl>, e10_28day <dbl>
# Gather 7-day viewers by episode (ratings2 already loaded)
week_ratings <- ratings2  %>% 
    select(series, ends_with("7day")) %>% 
    gather(episode, viewers_7day, ends_with("7day"), na.rm = TRUE, factor_key = TRUE)
    
# Plot 7-day viewers by episode and series
ggplot(week_ratings, aes(x = episode, y = viewers_7day, group = series)) +
    geom_line() +
    facet_wrap(~series)

# Edit to parse episode number
week_ratings <- ratings2 %>% 
    select(series, ends_with("7day")) %>% 
    gather(episode, viewers_7day, ends_with("7day"), na.rm = TRUE) %>% 
    separate(episode, into = "episode", extra = "drop") %>% 
    mutate(episode = parse_number(episode))
    
# Edit your code to color by series and add a theme
ggplot(week_ratings, aes(x = episode, y = viewers_7day, 
                         group = series, color = series)) +
    geom_line() +
    facet_wrap(~series) +
    guides(color = FALSE) +
    theme_minimal() 

week_ratings_dec <- week_ratings %>%
    mutate(viewers_7day=as.character(viewers_7day)) %>%
    separate(viewers_7day, into=c("viewers_millions", "viewers_decimal"), sep="\\.") %>%
    mutate(viewers_decimal=ifelse(is.na(viewers_decimal), ".", paste0(".", viewers_decimal))) %>%
    dplyr::arrange(series, episode)
## Warning: Expected 2 pieces. Missing pieces filled with `NA` in 3 rows [9,
## 17, 46].
# Unite series and episode
ratings3 <- week_ratings_dec %>% 
    unite("viewers_7day", viewers_millions, viewers_decimal)

# Print to view
ratings3
## # A tibble: 74 x 3
##    series episode viewers_7day
##    <fct>    <dbl> <chr>       
##  1 1            1 2_.24       
##  2 1            2 3_.         
##  3 1            3 3_.         
##  4 1            4 2_.6        
##  5 1            5 3_.03       
##  6 1            6 2_.75       
##  7 2            1 3_.1        
##  8 2            2 3_.53       
##  9 2            3 3_.82       
## 10 2            4 3_.6        
## # ... with 64 more rows
# Adapt to change the separator
ratings3 <- week_ratings_dec  %>% 
    unite(viewers_7day, viewers_millions, viewers_decimal, sep="")

# Print to view
ratings3
## # A tibble: 74 x 3
##    series episode viewers_7day
##    <fct>    <dbl> <chr>       
##  1 1            1 2.24        
##  2 1            2 3.          
##  3 1            3 3.          
##  4 1            4 2.6         
##  5 1            5 3.03        
##  6 1            6 2.75        
##  7 2            1 3.1         
##  8 2            2 3.53        
##  9 2            3 3.82        
## 10 2            4 3.6         
## # ... with 64 more rows
# Adapt to cast viewers as a number
ratings3 <- week_ratings_dec  %>% 
    unite(viewers_7day, viewers_millions, viewers_decimal, sep="") %>%
    mutate(viewers_7day = parse_number(viewers_7day))

# Print to view
ratings3
## # A tibble: 74 x 3
##    series episode viewers_7day
##    <fct>    <dbl>        <dbl>
##  1 1            1         2.24
##  2 1            2         3   
##  3 1            3         3   
##  4 1            4         2.6 
##  5 1            5         3.03
##  6 1            6         2.75
##  7 2            1         3.1 
##  8 2            2         3.53
##  9 2            3         3.82
## 10 2            4         3.6 
## # ... with 64 more rows
# Create tidy data with 7- and 28-day viewers
tidy_ratings_all <- ratings2 %>%
    gather(episode, viewers, ends_with("day"), na.rm = TRUE) %>% 
    separate(episode, into = c("episode", "days")) %>%  
    mutate(episode = parse_number(episode),
           days = parse_number(days)) 

# Adapt to spread counted values
tidy_ratings_all %>% 
    count(series, days, wt = viewers) %>%
    spread(key=days, value=n, sep="_")
## # A tibble: 8 x 3
##   series days_7 days_28
##   <fct>   <dbl>   <dbl>
## 1 1        16.6    NA  
## 2 2        31.6    NA  
## 3 3        50.0    NA  
## 4 4        73.5    NA  
## 5 5       100.     NA  
## 6 6       123.    113  
## 7 7       136.    138. 
## 8 8        90.2    92.9
# Fill in blanks to get premiere/finale data
tidy_ratings <- ratings %>%
    gather(episode, viewers, -series, na.rm = TRUE) %>%
    mutate(episode = parse_number(episode)) %>% 
    group_by(series) %>% 
    filter(episode == 1 | episode == max(episode)) %>% 
    ungroup()


# Recode first/last episodes
first_last <- tidy_ratings %>% 
  mutate(episode = recode(episode, `1` = "first", .default = "last")) 

# Fill in to make slope chart
ggplot(first_last, aes(x = episode, y = viewers, color = as.factor(series))) +
  geom_point() +
  geom_line(aes(group = series))

# Switch the variables mapping x-axis and color
ggplot(first_last, aes(x = series, y = viewers, color = episode)) +
  geom_point() + # keep
  geom_line(aes(group = series)) + # keep
  coord_flip() # keep

# Calculate relative increase in viewers
bump_by_series <- first_last %>% 
  spread(episode, viewers) %>%   
  mutate(bump = (last - first) / first)
  
# Fill in to make bar chart of bumps by series
ggplot(bump_by_series, aes(x = series, y = bump)) +
  geom_col() +
  scale_y_continuous(labels = scales::percent) # converts to %


Chapter 4 - Transform Your Data

Complex recoding with case_when:

  • The case_when function allow for vectoizing multiple if-else-then statements
    • The LHS must give (or be) a boolean
    • The default value for else is NA
  • Example using ages of the baker data
    • bakers %>% mutate(gen = if_else(between(birth_year, 1981, 1996), “millenial”, “not millenial”)) # simple if statement (boundaries of between are inclusive)
    • bakers %>% mutate(gen = case_when( between(birth_year, 1965, 1980) ~ “gen_x”, between(birth_year, 1981, 1996) ~ “millenial” )) # logical ~ result
    • bakers %>% mutate(gen = case_when( between(birth_year, 1928, 1945) ~ “silent”, between(birth_year, 1946, 1964) ~ “boomer”, between(birth_year, 1965, 1980) ~ “gen_x”, between(birth_year, 1981, 1996) ~ “millenial”, TRUE ~ “gen_z” ))
    • bakers %>% count(gen, sort = TRUE) %>% mutate(prop = n / sum(n))

Factors:

  • The forcats package is made specifically for working with factors - all functions start with fct_
  • Converting to factors helps ensure the proper ordering of the data
    • ggplot(bakers, aes(x = fct_rev(fct_infreq(gen)))) + geom_bar() # reverse by infrequency (build from small to large) # on-the-fly conversions inside ggplot
    • bakers <- bakers %>% mutate(gen = fct_relevel(gen, “silent”, “boomer”, “gen_x”, “millenial”, “gen_z”)) # conversions of the raw dataset
    • bakers %>% dplyr::pull(gen) %>% levels() # check that this worked
    • ggplot(bakers, aes(x = gen)) + geom_bar() # will now be plotted in the desired order
  • Need to be careful of the proper treatment of factors
    • ggplot(bakers, aes(x = gen, fill = series_winner)) + geom_bar() # FAIL
    • bakers <- bakers %>% mutate(series_winner = as.factor(series_winner))
    • ggplot(bakers, aes(x = gen, fill = series_winner)) + geom_bar() # WORKS
    • ggplot(bakers, aes(x = gen, fill = as.factor(series_winner))) + geom_bar() # ALSO WORKS

Dates:

  • Can use lubridate for convenience functions such as ymd() or dmy(), with the output being ISO (YYYY-MM-DD)
    • Can also include a vector of suspected dates
    • dmy(“17 August 2010”) # will work
    • hosts <- tibble::tribble( ~host, ~bday, ~premiere, “Mary”, “24 March 1935”, “August 17th, 2010”, “Paul”, “1 March 1966”, “August 17th, 2010”)
    • hosts <- hosts %>% mutate(bday = dmy(bday), premiere = mdy(premiere))
  • There are three aspects of timespans
    • interval - time span bound by two real dates
    • duration - exact number of seconds in an interval
    • period - change in clock time of an interval
    • hosts <- hosts %>% mutate(age_int = interval(bday, premiere)) # new variable age_int will be of type interval
    • hosts %>% mutate(years_decimal = age_int / years(1), years_whole = age_int %/% years(1)) # years(1) is one year, so this is fractional and whole (floored) years

Strings:

  • The separate function splits one column in to 2+ columns (for example “age, job” could become “age” and “job”)
    • series5 <- series5 %>% separate(about, into = c(“age”, “occupation”), sep = “,”)
    • series5 <- series5 %>% separate(about, into = c(“age”, “occupation”), sep = “,”) %>% mutate(age = parse_number(age)) # numeric age. Dropping years
  • The stringr package makes working with strings in R easier (typically used within a mutate) - all functions start with str_
    • series5 <- series5 %>% mutate(baker = str_to_upper(baker), showstopper = str_to_lower(showstopper))
    • series5 %>% mutate(pie = str_detect(showstopper, “pie”)) # returns a boolean
    • series5 %>% mutate(showstopper = str_replace(showstopper, “pie”, “tart”)) # find and replace for strings
    • series5 %>% mutate(showstopper = str_remove(showstopper, “pie”)) # remove “pie”, though there may be trailing whitespace
    • series5 %>% mutate(showstopper = str_remove(showstopper, “pie”), showstopper = str_trim(showstopper)) # trim whitespace at the beginning or end

Final thoughts:

  • R using the tidyverse for analysis and presentation
  • Reading data using readr and analyzing using dplyr and ggplot2
  • Taming variable types, names, and values
  • Transforming data using stringr and lubridate
  • The “here” package can make working with file paths much easier

Example code includes:

baker_results <- readr::read_csv("./RInputFiles/baker_results.csv")
## Parsed with column specification:
## cols(
##   .default = col_integer(),
##   baker_full = col_character(),
##   baker = col_character(),
##   occupation = col_character(),
##   hometown = col_character(),
##   baker_last = col_character(),
##   baker_first = col_character(),
##   technical_median = col_double(),
##   first_date_appeared = col_date(format = ""),
##   last_date_appeared = col_date(format = ""),
##   first_date_us = col_date(format = ""),
##   last_date_us = col_date(format = ""),
##   percent_episodes_appeared = col_double(),
##   percent_technical_top3 = col_double()
## )
## See spec(...) for full column specifications.
messy_baker_results <- readr::read_csv("./RInputFiles/messy_baker_results.csv")
## Parsed with column specification:
## cols(
##   .default = col_character(),
##   series = col_integer(),
##   star_baker = col_integer(),
##   technical_winner = col_integer(),
##   technical_top3 = col_integer(),
##   technical_bottom = col_integer(),
##   technical_highest = col_integer(),
##   technical_lowest = col_integer(),
##   technical_median = col_double(),
##   series_winner = col_integer(),
##   series_runner_up = col_integer(),
##   total_episodes_appeared = col_integer(),
##   percent_episodes_appeared = col_double(),
##   percent_technical_top3 = col_double(),
##   first_date_appeared_uk = col_date(format = ""),
##   last_date_appeared_uk = col_date(format = ""),
##   first_date_us = col_date(format = ""),
##   last_date_us = col_date(format = ""),
##   e_1_technical = col_integer(),
##   e_10_technical = col_integer(),
##   e_2_technical = col_integer()
##   # ... with 7 more columns
## )
## See spec(...) for full column specifications.
bakers <- baker_results
glimpse(bakers)
## Observations: 95
## Variables: 24
## $ series                    <int> 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 2, 2, ...
## $ baker_full                <chr> "Annetha Mills", "David Chambers", "...
## $ baker                     <chr> "Annetha", "David", "Edd", "Jasminde...
## $ age                       <int> 30, 31, 24, 45, 25, 51, 44, 48, 37, ...
## $ occupation                <chr> "Single mother", "Entrepreneur", "De...
## $ hometown                  <chr> "Essex", "Milton Keynes", "Bradford"...
## $ baker_last                <chr> "Mills", "Chambers", "Kimber", "Rand...
## $ baker_first               <chr> "Annetha", "David", "Edward", "Jasmi...
## $ star_baker                <int> 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 2, ...
## $ technical_winner          <int> 0, 0, 2, 0, 1, 0, 0, 0, 2, 0, 1, 2, ...
## $ technical_top3            <int> 1, 1, 4, 2, 1, 0, 0, 0, 4, 2, 3, 5, ...
## $ technical_bottom          <int> 1, 3, 1, 2, 2, 1, 1, 0, 1, 2, 1, 3, ...
## $ technical_highest         <int> 2, 3, 1, 2, 1, 10, 4, NA, 1, 2, 1, 1...
## $ technical_lowest          <int> 7, 8, 6, 5, 9, 10, 4, NA, 8, 5, 5, 6...
## $ technical_median          <dbl> 4.5, 4.5, 2.0, 3.0, 6.0, 10.0, 4.0, ...
## $ series_winner             <int> 0, 0, 1, 0, 0, 0, 0, 0, 0, 0, 0, 0, ...
## $ series_runner_up          <int> 0, 0, 0, 0, 0, 0, 0, 0, 1, 1, 0, 1, ...
## $ total_episodes_appeared   <int> 2, 4, 6, 5, 3, 1, 2, 1, 6, 6, 4, 8, ...
## $ first_date_appeared       <date> 2010-08-17, 2010-08-17, 2010-08-17,...
## $ last_date_appeared        <date> 2010-08-24, 2010-09-07, 2010-09-21,...
## $ first_date_us             <date> NA, NA, NA, NA, NA, NA, NA, NA, NA,...
## $ last_date_us              <date> NA, NA, NA, NA, NA, NA, NA, NA, NA,...
## $ percent_episodes_appeared <dbl> 33.33333, 66.66667, 100.00000, 83.33...
## $ percent_technical_top3    <dbl> 50.00000, 25.00000, 66.66667, 40.000...
# Create skill variable with 3 levels
bakers <- bakers %>% 
  mutate(skill = case_when(
    star_baker > technical_winner ~ "super_star",
    star_baker < technical_winner ~ "high_tech",
    TRUE ~ "well_rounded"
  ))
  
# Filter zeroes to examine skill variable
bakers %>% 
  filter(star_baker==0 & technical_winner==0) %>% 
  count(skill)
## # A tibble: 1 x 2
##   skill            n
##   <chr>        <int>
## 1 well_rounded    41
# Add pipe to drop skill = NA
bakers_skill <- bakers %>% 
  mutate(skill = case_when(
    star_baker > technical_winner ~ "super_star",
    star_baker < technical_winner ~ "high_tech",
    star_baker == 0 & technical_winner == 0 ~ NA_character_,
    star_baker == technical_winner  ~ "well_rounded"
  )) %>% 
  drop_na(skill)
  
# Count bakers by skill
bakers_skill %>%
  count(skill)
## # A tibble: 3 x 2
##   skill            n
##   <chr>        <int>
## 1 high_tech       24
## 2 super_star      15
## 3 well_rounded    15
# Cast skill as a factor
bakers <- bakers %>% 
  mutate(skill = as.factor(skill))

# Examine levels
bakers %>%
  pull(skill) %>%
  levels()
## [1] "high_tech"    "super_star"   "well_rounded"
baker_dates <- bakers %>%
    select(series, baker, contains("date")) %>%
    mutate(last_date_appeared_us=as.character(last_date_us), 
           first_date_appeared_us=as.character(first_date_us)
           ) %>%
    rename(first_date_appeared_uk=first_date_appeared, last_date_appeared_uk=last_date_appeared) %>%
    select(-last_date_us, -first_date_us)
glimpse(baker_dates)
## Observations: 95
## Variables: 6
## $ series                 <int> 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 2, 2, 2, ...
## $ baker                  <chr> "Annetha", "David", "Edd", "Jasminder",...
## $ first_date_appeared_uk <date> 2010-08-17, 2010-08-17, 2010-08-17, 20...
## $ last_date_appeared_uk  <date> 2010-08-24, 2010-09-07, 2010-09-21, 20...
## $ last_date_appeared_us  <chr> NA, NA, NA, NA, NA, NA, NA, NA, NA, NA,...
## $ first_date_appeared_us <chr> NA, NA, NA, NA, NA, NA, NA, NA, NA, NA,...
# Add a line to extract labeled month
baker_dates <- baker_dates %>% 
  mutate(last_date_appeared_us=lubridate::ymd(last_date_appeared_us), 
         last_month_us=lubridate::month(last_date_appeared_us, label=TRUE)
         )
         
ggplot(baker_dates, aes(x=last_month_us)) + geom_bar()

baker_time <- baker_dates %>%
    mutate(first_date_appeared_us=lubridate::ymd(first_date_appeared_us)) %>%
    select(-last_month_us)
glimpse(baker_time)
## Observations: 95
## Variables: 6
## $ series                 <int> 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 2, 2, 2, ...
## $ baker                  <chr> "Annetha", "David", "Edd", "Jasminder",...
## $ first_date_appeared_uk <date> 2010-08-17, 2010-08-17, 2010-08-17, 20...
## $ last_date_appeared_uk  <date> 2010-08-24, 2010-09-07, 2010-09-21, 20...
## $ last_date_appeared_us  <date> NA, NA, NA, NA, NA, NA, NA, NA, NA, NA...
## $ first_date_appeared_us <date> NA, NA, NA, NA, NA, NA, NA, NA, NA, NA...
# Add a line to create whole months on air variable
baker_time <- baker_time  %>% 
  mutate(time_on_air = lubridate::interval(first_date_appeared_uk, last_date_appeared_uk),
         weeks_on_air = time_on_air / lubridate::weeks(1), 
         months_on_air = time_on_air %/% months(1)
         )

# Count rows
messy_baker_results %>% 
  count(position_reached)
## # A tibble: 8 x 2
##   position_reached     n
##   <chr>            <int>
## 1 Runner-Up            1
## 2 Runner up            2
## 3 Runner Up           12
## 4 Third Place          1
## 5 winner               2
## 6 Winner               1
## 7 WINNER               5
## 8 <NA>                71
# Add another mutate to replace "THIRD PLACE" with "RUNNER UP"and count
messy_baker_results <- messy_baker_results %>% 
  mutate(position_reached = str_to_upper(position_reached),
         position_reached = str_replace(position_reached, "-", " "), 
         position_reached = str_replace(position_reached, "THIRD PLACE", "RUNNER UP"))

# Count rows
messy_baker_results %>% 
  count(position_reached)
## # A tibble: 3 x 2
##   position_reached     n
##   <chr>            <int>
## 1 RUNNER UP           16
## 2 WINNER               8
## 3 <NA>                71
# Add a line to create new variable called student
bakers <- bakers %>% 
    mutate(occupation = str_to_lower(occupation), 
           student=str_detect(occupation, "student")
           )

# Find all students and examine occupations
bakers %>% 
  filter(student) %>%
  select(baker, occupation, student)
## # A tibble: 8 x 3
##   baker   occupation                            student
##   <chr>   <chr>                                 <lgl>  
## 1 Jason   civil engineering student             TRUE   
## 2 James   medical student                       TRUE   
## 3 John    law student                           TRUE   
## 4 Ruby    history of art and philosophy student TRUE   
## 5 Martha  student                               TRUE   
## 6 Michael student                               TRUE   
## 7 Rav     student support                       TRUE   
## 8 Liam    student                               TRUE

Modeling Data in the Tidyverse

Chapter 1 - Introduction to Modeling

Background on modeling for explanation:

  • Generally, the model has y as a function of x plus epsilon, where y is the outcome of interest and x is a set of explanatory variables and epsilon is irreducible error
    • The x can be either explanatory or predictive - depends on the purpose of the analysis
  • Example of explanation - can differences in teacher evaluation scores be explained by teacher attributes
    • library(dplyr)
    • library(moderndive)
    • glimpse(evals) # evals data is available in the moderndivw package (From the moderndive package for ModernDive.com:)
    • ggplot(evals, aes(x = score)) + geom_histogram(binwidth = 0.25) + labs(x = “teaching score”, y = “count”) # EDA on scores using histogram
    • evals %>% summarize(mean_score = mean(score), median_score = median(score), sd_score = sd(score)) # summary statistics using dplyr::summarize

Background on modeling for prediction:

  • House sales in King County USA in 2014-2015 (from Kaggle) based on features such as size, bedrooms, etc.
    • glimpse(house_prices)
    • ggplot(house_prices, aes(x = price)) + geom_histogram() + labs(x = “house price”, y = “count”)
    • house_prices <- house_prices %>% mutate(log10_price = log10(price))
    • house_prices %>% select(price, log10_price)
    • ggplot(house_prices, aes(x = log10_price)) + geom_histogram() + labs(x = “log10 house price”, y = “count”) # after transformation

Modeling problem for explanation:

  • Typically, both the function that relates x and y and the function that generates the errors is unknwon
    • Goal is to create a model that can generate y-hat by separating signal from noise
  • Can start by considering linear models, assessed as a starting point by examining a scatter plot
    • ggplot(evals, aes(x = age, y = score)) + geom_point() + labs(x = “age”, y = “score”, title = “Teaching score over age”)
    • ggplot(evals, aes(x = age, y = score)) + geom_jitter() + labs(x = “age”, y = “score”, title = “Teaching score over age (jittered)”)
  • Can further explore the data by looking at correlations among some or all of the potential explanatory variables
    • evals %>% summarize(correlation = cor(score, age))

Modeling problem for prediction:

  • For explanation, we care about the form of the function
  • For prediction, we care mainly that the function makes good predictions (even if it may not be easy to explain)
    • house_prices %>% select(log10_price, condition) %>% glimpse() # condition is a categorical variable saved as a factor
    • ggplot(house_prices, aes(x = condition, y = log10_price)) + geom_boxplot() + labs(x = “house condition”, y = “log10 price”, title = “log10 house price over condition”)
  • Means tend to be at the center of the linear modeling process
    • house_prices %>% group_by(condition) %>% summarize(mean = mean(log10_price), sd = sd(log10_price), n = n())

Example code includes:

data(evals, package="moderndive")
glimpse(evals)
## Observations: 463
## Variables: 13
## $ ID           <int> 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15...
## $ score        <dbl> 4.7, 4.1, 3.9, 4.8, 4.6, 4.3, 2.8, 4.1, 3.4, 4.5,...
## $ age          <int> 36, 36, 36, 36, 59, 59, 59, 51, 51, 40, 40, 40, 4...
## $ bty_avg      <dbl> 5.000, 5.000, 5.000, 5.000, 3.000, 3.000, 3.000, ...
## $ gender       <fct> female, female, female, female, male, male, male,...
## $ ethnicity    <fct> minority, minority, minority, minority, not minor...
## $ language     <fct> english, english, english, english, english, engl...
## $ rank         <fct> tenure track, tenure track, tenure track, tenure ...
## $ pic_outfit   <fct> not formal, not formal, not formal, not formal, n...
## $ pic_color    <fct> color, color, color, color, color, color, color, ...
## $ cls_did_eval <int> 24, 86, 76, 77, 17, 35, 39, 55, 111, 40, 24, 24, ...
## $ cls_students <int> 43, 125, 125, 123, 20, 40, 44, 55, 195, 46, 27, 2...
## $ cls_level    <fct> upper, upper, upper, upper, upper, upper, upper, ...
# Plot the histogram
ggplot(evals, aes(x = age)) +
  geom_histogram(binwidth = 5) +
  labs(x = "age", y = "count")

# Compute summary stats
evals %>%
  summarize(mean_age = mean(age),
            median_age = median(age),
            sd_age = sd(age))
## # A tibble: 1 x 3
##   mean_age median_age sd_age
##      <dbl>      <int>  <dbl>
## 1     48.4         48   9.80
data(house_prices, package="moderndive")
glimpse(house_prices)
## Observations: 21,613
## Variables: 21
## $ id            <chr> "7129300520", "6414100192", "5631500400", "24872...
## $ date          <dttm> 2014-10-13, 2014-12-09, 2015-02-25, 2014-12-09,...
## $ price         <dbl> 221900, 538000, 180000, 604000, 510000, 1225000,...
## $ bedrooms      <int> 3, 3, 2, 4, 3, 4, 3, 3, 3, 3, 3, 2, 3, 3, 5, 4, ...
## $ bathrooms     <dbl> 1.00, 2.25, 1.00, 3.00, 2.00, 4.50, 2.25, 1.50, ...
## $ sqft_living   <int> 1180, 2570, 770, 1960, 1680, 5420, 1715, 1060, 1...
## $ sqft_lot      <int> 5650, 7242, 10000, 5000, 8080, 101930, 6819, 971...
## $ floors        <dbl> 1.0, 2.0, 1.0, 1.0, 1.0, 1.0, 2.0, 1.0, 1.0, 2.0...
## $ waterfront    <lgl> FALSE, FALSE, FALSE, FALSE, FALSE, FALSE, FALSE,...
## $ view          <int> 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 3, ...
## $ condition     <fct> 3, 3, 3, 5, 3, 3, 3, 3, 3, 3, 3, 4, 4, 4, 3, 3, ...
## $ grade         <fct> 7, 7, 6, 7, 8, 11, 7, 7, 7, 7, 8, 7, 7, 7, 7, 9,...
## $ sqft_above    <int> 1180, 2170, 770, 1050, 1680, 3890, 1715, 1060, 1...
## $ sqft_basement <int> 0, 400, 0, 910, 0, 1530, 0, 0, 730, 0, 1700, 300...
## $ yr_built      <int> 1955, 1951, 1933, 1965, 1987, 2001, 1995, 1963, ...
## $ yr_renovated  <int> 0, 1991, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, ...
## $ zipcode       <fct> 98178, 98125, 98028, 98136, 98074, 98053, 98003,...
## $ lat           <dbl> 47.5112, 47.7210, 47.7379, 47.5208, 47.6168, 47....
## $ long          <dbl> -122.257, -122.319, -122.233, -122.393, -122.045...
## $ sqft_living15 <int> 1340, 1690, 2720, 1360, 1800, 4760, 2238, 1650, ...
## $ sqft_lot15    <int> 5650, 7639, 8062, 5000, 7503, 101930, 6819, 9711...
# Plot the histogram
ggplot(house_prices, aes(x = sqft_living)) +
  geom_histogram() +
  labs(x="Size (sq.feet)", y="count")
## `stat_bin()` using `bins = 30`. Pick better value with `binwidth`.

# Add log10_sqft_living
house_prices_2 <- house_prices %>%
  mutate(log10_sqft_living = log10(sqft_living))

# Plot the histogram  
ggplot(house_prices_2, aes(x = log10_sqft_living)) +
  geom_histogram() +
  labs(x = "log10 size", y = "count")
## `stat_bin()` using `bins = 30`. Pick better value with `binwidth`.

# Plot the histogram
ggplot(evals, aes(x=bty_avg)) +
  geom_histogram(binwidth=0.5) +
  labs(x = "Beauty score", y = "count")

# Scatterplot
ggplot(evals, aes(x = bty_avg, y = score)) +
  geom_point() +
  labs(x = "beauty score", y = "teaching score")

# Jitter plot
ggplot(evals, aes(x = bty_avg, y = score)) +
  geom_jitter() +
  labs(x = "beauty score", y = "teaching score")

# Compute correlation
evals %>%
  summarize(correlation = cor(score, bty_avg))
## # A tibble: 1 x 1
##   correlation
##         <dbl>
## 1       0.187
house_prices <- house_prices %>%
    mutate(log10_price=log10(price))

# View the structure of log10_price and waterfront
house_prices %>%
  select(log10_price, waterfront) %>%
  glimpse()
## Observations: 21,613
## Variables: 2
## $ log10_price <dbl> 5.346157, 5.730782, 5.255273, 5.781037, 5.707570, ...
## $ waterfront  <lgl> FALSE, FALSE, FALSE, FALSE, FALSE, FALSE, FALSE, F...
# Plot 
ggplot(house_prices, aes(x = waterfront, y = log10_price)) +
  geom_boxplot() +
  labs(x = "waterfront", y = "log10 price")

# Calculate stats
house_prices %>%
  group_by(waterfront) %>%
  summarize(mean_log10_price = mean(log10_price), n = n())
## # A tibble: 2 x 3
##   waterfront mean_log10_price     n
##   <lgl>                 <dbl> <int>
## 1 FALSE                  5.66 21450
## 2 TRUE                   6.12   163
# Prediction of price for houses with view
10^(6.12)
## [1] 1318257
# Prediction of price for houses without view
10^(5.66)
## [1] 457088.2

Chapter 2 - Modeling with Regression

Explaining teaching score with age:

  • Can overlay a regression line to the scatter plot for a bivariate relationship
    • ggplot(evals, aes(x = age, y = score)) + geom_point() + labs(x = “age”, y = “score”, title = “Teaching score over age”) + geom_smooth(method = “lm”, se = FALSE)
  • In simple linear regression, the assumption is that f(x) is B0 + B1*x
    • The fitted model f-hat does not have an error term, since it is just the model prediction for a given value of x
    • model_score_1 <- lm(score ~ age, data = evals)
    • moderndive::get_regression_table(model_score_1)

Predicting teaching score using age:

  • Can make predictions based on the existing regression line - f-hat can be used for both explanatory and predictive purposes
  • The residuals are the errors (predictive vs. actual values), and correspond to the epsilon of the general modeling framework
    • On average, for linear regression, the residuals should average out to zero
    • get_regression_points(model_score_1) # gives y, x, y-hat, and residuals

Explaining teaching score with gender:

  • Can extend the models to include categorical data, such as gender
    • ggplot(evals, aes(x = score)) + geom_histogram(binwidth = 0.25) + facet_wrap(~gender) + labs(x = “score”, y = “count”)
    • model_score_3 <- lm(score ~ gender, data = evals) # will just give an overall mean and a change in mean vs. the first-level factor
  • Can also look at multi-level factors, such as rank (teacher type)
    • evals %>% group_by(rank) %>% summarize(n = n())

Predicting teaching score with gender:

  • Can use group means as part of the predictive approach - if only factor are used in the regression, there will be the same prediction for everyone who is in the same class(es)
    • model_score_3_points <- get_regression_points(model_score_3)

Example code includes:

# Plot 
ggplot(evals, aes(x = bty_avg, y = score)) +
  geom_point() +
  labs(x = "beauty score", y = "score") +
  geom_smooth(method = "lm", se = FALSE)

# Fit model
model_score_2 <- lm(score ~ bty_avg, data = evals)

# Output content
model_score_2
## 
## Call:
## lm(formula = score ~ bty_avg, data = evals)
## 
## Coefficients:
## (Intercept)      bty_avg  
##     3.88034      0.06664
# Output regression table
moderndive::get_regression_table(model_score_2)
## # A tibble: 2 x 7
##   term      estimate std_error statistic p_value lower_ci upper_ci
##   <chr>        <dbl>     <dbl>     <dbl>   <dbl>    <dbl>    <dbl>
## 1 intercept    3.88      0.076     51.0        0    3.73     4.03 
## 2 bty_avg      0.067     0.016      4.09       0    0.035    0.099
# Use fitted intercept and slope to get a prediction
y_hat <- 3.88 + 0.067 * 5
y_hat
## [1] 4.215
# Compute residual y - y_hat
4.7 - y_hat
## [1] 0.485
# Get regression table
moderndive::get_regression_table(model_score_2, digits = 5)
## # A tibble: 2 x 7
##   term      estimate std_error statistic p_value lower_ci upper_ci
##   <chr>        <dbl>     <dbl>     <dbl>   <dbl>    <dbl>    <dbl>
## 1 intercept   3.88      0.0761     51.0  0         3.73     4.03  
## 2 bty_avg     0.0666    0.0163      4.09 0.00005   0.0346   0.0986
# Get all fitted/predicted values and residuals
moderndive::get_regression_points(model_score_2)
## # A tibble: 463 x 5
##       ID score bty_avg score_hat residual
##    <int> <dbl>   <dbl>     <dbl>    <dbl>
##  1     1   4.7    5         4.21    0.486
##  2     2   4.1    5         4.21   -0.114
##  3     3   3.9    5         4.21   -0.314
##  4     4   4.8    5         4.21    0.586
##  5     5   4.6    3         4.08    0.52 
##  6     6   4.3    3         4.08    0.22 
##  7     7   2.8    3         4.08   -1.28 
##  8     8   4.1    3.33      4.10   -0.002
##  9     9   3.4    3.33      4.10   -0.702
## 10    10   4.5    3.17      4.09    0.409
## # ... with 453 more rows
# Get all fitted/predicted values and residuals
moderndive::get_regression_points(model_score_2) %>% 
  mutate(score_hat_2 = 3.88 + 0.0666 * bty_avg)
## # A tibble: 463 x 6
##       ID score bty_avg score_hat residual score_hat_2
##    <int> <dbl>   <dbl>     <dbl>    <dbl>       <dbl>
##  1     1   4.7    5         4.21    0.486        4.21
##  2     2   4.1    5         4.21   -0.114        4.21
##  3     3   3.9    5         4.21   -0.314        4.21
##  4     4   4.8    5         4.21    0.586        4.21
##  5     5   4.6    3         4.08    0.52         4.08
##  6     6   4.3    3         4.08    0.22         4.08
##  7     7   2.8    3         4.08   -1.28         4.08
##  8     8   4.1    3.33      4.10   -0.002        4.10
##  9     9   3.4    3.33      4.10   -0.702        4.10
## 10    10   4.5    3.17      4.09    0.409        4.09
## # ... with 453 more rows
# Get all fitted/predicted values and residuals
moderndive::get_regression_points(model_score_2) %>% 
  mutate(residual_2 = score - score_hat)
## # A tibble: 463 x 6
##       ID score bty_avg score_hat residual residual_2
##    <int> <dbl>   <dbl>     <dbl>    <dbl>      <dbl>
##  1     1   4.7    5         4.21    0.486      0.486
##  2     2   4.1    5         4.21   -0.114     -0.114
##  3     3   3.9    5         4.21   -0.314     -0.314
##  4     4   4.8    5         4.21    0.586      0.586
##  5     5   4.6    3         4.08    0.52       0.520
##  6     6   4.3    3         4.08    0.22       0.220
##  7     7   2.8    3         4.08   -1.28      -1.28 
##  8     8   4.1    3.33      4.10   -0.002     -0.002
##  9     9   3.4    3.33      4.10   -0.702     -0.702
## 10    10   4.5    3.17      4.09    0.409      0.409
## # ... with 453 more rows
ggplot(evals, aes(x=rank, y=score)) +
  geom_boxplot() +
  labs(x = "rank", y = "score")

evals %>%
  group_by(rank) %>%
  summarize(n = n(), mean_score = mean(score), sd_score = sd(score))
## # A tibble: 3 x 4
##   rank             n mean_score sd_score
##   <fct>        <int>      <dbl>    <dbl>
## 1 teaching       102       4.28    0.498
## 2 tenure track   108       4.15    0.561
## 3 tenured        253       4.14    0.550
# Fit regression model
model_score_4 <- lm(score ~ rank, data = evals)

# Get regression table
moderndive::get_regression_table(model_score_4, digits = 5)
## # A tibble: 3 x 7
##   term             estimate std_error statistic p_value lower_ci upper_ci
##   <chr>               <dbl>     <dbl>     <dbl>   <dbl>    <dbl>    <dbl>
## 1 intercept           4.28     0.0536     79.9   0         4.18    4.39  
## 2 ranktenure track   -0.130    0.0748     -1.73  0.0837   -0.277   0.0173
## 3 ranktenured        -0.145    0.0636     -2.28  0.0228   -0.270  -0.0203
# teaching mean
teaching_mean <- 4.28

# tenure track mean
tenure_track_mean <- 4.28-0.13 

# tenure mean
tenure_mean <- 4.28-0.145


# Calculate predictions and residuals
model_score_4_points <- moderndive::get_regression_points(model_score_4)
model_score_4_points
## # A tibble: 463 x 5
##       ID score rank         score_hat residual
##    <int> <dbl> <fct>            <dbl>    <dbl>
##  1     1   4.7 tenure track      4.16    0.545
##  2     2   4.1 tenure track      4.16   -0.055
##  3     3   3.9 tenure track      4.16   -0.255
##  4     4   4.8 tenure track      4.16    0.645
##  5     5   4.6 tenured           4.14    0.461
##  6     6   4.3 tenured           4.14    0.161
##  7     7   2.8 tenured           4.14   -1.34 
##  8     8   4.1 tenured           4.14   -0.039
##  9     9   3.4 tenured           4.14   -0.739
## 10    10   4.5 tenured           4.14    0.361
## # ... with 453 more rows
# Plot residuals
ggplot(model_score_4_points, aes(x=residual)) +
  geom_histogram() +
  labs(x = "residuals", title = "Residuals from score ~ rank model")
## `stat_bin()` using `bins = 30`. Pick better value with `binwidth`.


Chapter 3 - Modeling with Multiple Regression

Explaining house price with year and size:

  • Can incorporate 2+ explanatory / predictive variable using multiple regression
    • house_prices %>% select(price, sqft_living, condition, waterfront) %>% glimpse()
    • The log-10 transformation is helpful for this specific dataset (assume the code below for future examples in this course)
    • house_prices <- house_prices %>% mutate( log10_price = log10(price), log10_sqft_living = log10(sqft_living) )
  • Exploring the relationship between mutliple variables - EDA and regression
    • Can create a 3D plot with associated regression plane using plotly
    • model_price_1 <- lm(log10_price ~ log10_sqft_living + yr_built, data = house_prices)
    • get_regression_table(model_price_1, digits = 5))

Predicting house price using year and size:

  • Can get the fitted values and exponentiate as needed, assessing the overall fit or lack thereof (sum-squared residuals) of the model
    • get_regression_points(model_price_1, digits = 5)
    • get_regression_points(model_price_1) %>% mutate(sq_residuals = residual^2) %>% summarize(sum_sq_residuals = sum(squared_residuals)) # SSR

Explaining house price with size and condition:

  • The EDA from previous chapters is repeated
    • house_prices <- house_prices %>% mutate( log10_price = log10(price), log10_sqft_living = log10(sqft_living) )
    • house_prices %>% group_by(condition) %>% summarize(mean = mean(log10_price), sd = sd(log10_price), n = n())
  • The parallel slopes model is lines where the slopes are the same but they have a different intercept (likely, coefficients of a categorical variable)
    • model_price_3 <- lm(log10_price ~ log10_sqft_living + condition, data = house_prices)
    • get_regression_table(model_price_3, digits = 5)

Predicting house price using size and condition:

  • Objective is to predict on new data (as opposed to checking our predictions on data where we already had the answer)
    • model_price_3 <- lm(log10_price ~ log10_sqft_living + condition, data = house_prices)
    • get_regression_table(model_price_3)
  • Automating the housing price prediction process
    • new_houses <- read_csv(“new_houses.csv”)
    • new_houses
    • get_regression_points(model_price_3, newdata = new_houses) # moderndata form of predict() function
    • get_regression_points(model_price_3, newdata = new_houses) %>% mutate(price_hat = 10^log10_price_hat)

Example code includes:

# Create scatterplot with regression line
ggplot(house_prices, aes(x=bedrooms, y = log10_price)) +
  geom_point() +
  labs(x = "Number of bedrooms", y = "log10 price") +
  geom_smooth(method = "lm", se = FALSE)

# Remove outlier
house_prices_transform <- house_prices %>%
    filter(bedrooms < 33) %>%
    mutate(log10_sqft_living=log10(sqft_living))

# Create scatterplot with regression line
ggplot(house_prices_transform, aes(x = bedrooms, y = log10_price)) +
  geom_point() +
  labs(x = "Number of bedrooms", y = "log10 price") +
  geom_smooth(method = "lm", se = FALSE)

# Fit model
model_price_2 <- lm(log10_price ~ log10_sqft_living + bedrooms, data = house_prices_transform)

# Get regression table
moderndive::get_regression_table(model_price_2)
## # A tibble: 3 x 7
##   term              estimate std_error statistic p_value lower_ci upper_ci
##   <chr>                <dbl>     <dbl>     <dbl>   <dbl>    <dbl>    <dbl>
## 1 intercept            2.69      0.023     116.        0    2.65     2.74 
## 2 log10_sqft_living    0.941     0.008     118.        0    0.925    0.957
## 3 bedrooms            -0.033     0.002     -20.5       0   -0.036   -0.03
# Make prediction in log10 dollars
2.69 + 0.941 * log10(1000) - 0.033 * 3
## [1] 5.414
# Make prediction dollars
10**(2.69 + 0.941 * log10(1000) - 0.033 * 3)
## [1] 259417.9
# Automate prediction and residual computation
moderndive::get_regression_points(model_price_2) %>%
    mutate(squared_residuals = residual**2) %>%
    summarize(sum_squared_residuals = sum(squared_residuals))
## # A tibble: 1 x 1
##   sum_squared_residuals
##                   <dbl>
## 1                  604.
# Fit model
model_price_4 <- lm(log10_price ~ log10_sqft_living + waterfront, data = house_prices_transform)

# Get regression table
moderndive::get_regression_table(model_price_4)
## # A tibble: 3 x 7
##   term              estimate std_error statistic p_value lower_ci upper_ci
##   <chr>                <dbl>     <dbl>     <dbl>   <dbl>    <dbl>    <dbl>
## 1 intercept            2.96      0.02      146.        0    2.92     3.00 
## 2 log10_sqft_living    0.825     0.006     134.        0    0.813    0.837
## 3 waterfrontTRUE       0.322     0.013      24.5       0    0.296    0.348
# Prediction for House A
10**(2.96 + 0.825*2.9 + 0.322)
## [1] 472606.8
# Prediction for House B
10**(2.96 + 0.825*3.1 + 0)
## [1] 329230.5
# View the "new" houses
new_houses_2 <- tibble(log10_sqft_living=c(2.9, 3.1), waterfront=c(TRUE, FALSE))
new_houses_2
## # A tibble: 2 x 2
##   log10_sqft_living waterfront
##               <dbl> <lgl>     
## 1               2.9 TRUE      
## 2               3.1 FALSE
# Get predictions price_hat in dollars on "new" houses
moderndive::get_regression_points(model_price_4, newdata = new_houses_2) %>% 
  mutate(price_hat = 10**log10_price_hat)
## # A tibble: 2 x 5
##      ID log10_sqft_living waterfront log10_price_hat price_hat
##   <int>             <dbl> <lgl>                <dbl>     <dbl>
## 1     1               2.9 TRUE                  5.67   472063.
## 2     2               3.1 FALSE                 5.52   328095.

Chapter 4 - Model Selection and Assessment

Model selection and assessment:

  • Can use multiple models for the same data and compare
    • model_price_1 <- lm(log10_price ~ log10_sqft_living + yr_built, data = house_prices)
    • model_price_3 <- lm(log10_price ~ log10_sqft_living + condition, data = house_prices)
    • get_regression_points(model_price_1) %>% mutate(sq_residuals = residual^2) %>% summarize(sum_sq_residuals = sum(sq_residuals))
    • get_regression_points(model_price_3) %>% mutate(sq_residuals = residual^2) %>% summarize(sum_sq_residuals = sum(sq_residuals))

Assessing model fit with R-squared:

  • The R-squared is a reasonable measure of model fit - R-squared = 1 - Var(Residuals) / Var(Y)
    • Larger R-squared is suggestive of better fit, with values (typically) constrained between 0 and 1
    • R-squared is the proportion of variation in the outcome model that can be explained using the model
    • model_price_1 <- lm(log10_price ~ log10_sqft_living + yr_built, data = house_prices)
    • get_regression_points(model_price_1) %>% summarize(r_squared = 1 - var(residual) / var(log10_price))
    • model_price_3 <- lm(log10_price ~ log10_sqft_living + condition, data = house_prices)
    • get_regression_points(model_price_3) %>% summarize(r_squared = 1 - var(residual) / var(log10_price))

Assessing predictions with RMSE:

  • RMSE (Root Mean Squared Error) is a slight variation on RSS
    • Where RSS is the sum-squared of the residuals, RMSE is the square root of the average of the residuals-squared
    • model_price_1 <- lm(log10_price ~ log10_sqft_living + yr_built, data = house_prices)
    • get_regression_points(model_price_1) %>% mutate(sq_residuals = residual^2) %>% summarize(sum_sq_residuals = sum(sq_residuals))
    • get_regression_points(model_price_1) %>% mutate(sq_residuals = residual^2) %>% summarize(mse = mean(sq_residuals))
    • get_regression_points(model_price_1) %>% mutate(sq_residuals = residual^2) %>% summarize(mse = mean(sq_residuals)) %>% mutate(rmse = sqrt(mse))
  • Cannot calculate RMSE on new data - predictions means that we do not know the actual values
    • get_regression_points(model_price_3, newdata = new_houses) %>% mutate(sq_residuals = residual^2) %>% summarize(mse = mean(sq_residuals)) %>% mutate(rmse = sqrt(mse))
    • The above code will crash out, since the residuals do not exist

Validation set prediction framework:

  • Use two different datasets for modeling; a training set used for modeling, and a test set used for assessing likely out-of-sample errors
    • house_prices_shuffled <- house_prices %>% sample_frac(size = 1, replace = FALSE) # Randomly shuffle order of rows
    • train <- house_prices_shuffled %>% slice(1:10000)
    • test <- house_prices_shuffled %>% slice(10001:21613)
    • train_model_price_1 <- lm(log10_price ~ log10_sqft_living + yr_built, data = train)
  • After having trained the model on the train data, can assess the fit using the test data
    • get_regression_points(train_model_price_1, newdata = test)
    • get_regression_points(train_model_price_1, newdata = test) %>% mutate(sq_residuals = residual^2) %>% summarize(rmse = sqrt(mean(sq_residuals)))

Next steps:

  • Tidyverse ties together many of the packages that help with data wrangling and analysis
  • Can extend regressions to areas like polynomials and trees
  • “ModernDive” is a textbook on the tidyverse tools

Example code includes:

# Model 2
model_price_2 <- lm(log10_price ~ log10_sqft_living + bedrooms, data = house_prices_transform)

# Calculate squared residuals
moderndive::get_regression_points(model_price_2) %>% 
    mutate(sq_residuals=residual**2) %>% 
    summarize(sum_sq_residuals=sum(sq_residuals))
## # A tibble: 1 x 1
##   sum_sq_residuals
##              <dbl>
## 1             604.
# Model 4
model_price_4 <- lm(log10_price ~ log10_sqft_living + waterfront, data = house_prices_transform)

# Calculate squared residuals
moderndive::get_regression_points(model_price_4) %>% 
    mutate(sq_residuals = residual**2) %>% 
    summarize(sum_sq_residuals=sum(sq_residuals))
## # A tibble: 1 x 1
##   sum_sq_residuals
##              <dbl>
## 1             599.
# Get fitted/values & residuals, compute R^2 using residuals
moderndive::get_regression_points(model_price_2) %>% 
    summarize(r_squared = 1 - var(residual) / var(log10_price))
## # A tibble: 1 x 1
##   r_squared
##       <dbl>
## 1     0.466
# Get fitted/values & residuals, compute R^2 using residuals
moderndive::get_regression_points(model_price_4) %>% 
    summarize(r_squared = 1 - var(residual) / var(log10_price))
## # A tibble: 1 x 1
##   r_squared
##       <dbl>
## 1     0.470
# Get all residuals, square them, take the mean and square root
moderndive::get_regression_points(model_price_2) %>% 
    mutate(sq_residuals = residual^2) %>% 
    summarize(mse = mean(sq_residuals)) %>% 
    mutate(rmse = sqrt(mse))
## # A tibble: 1 x 2
##      mse  rmse
##    <dbl> <dbl>
## 1 0.0279 0.167
# MSE and RMSE for model_price_2
moderndive::get_regression_points(model_price_2) %>% 
    mutate(sq_residuals = residual^2) %>% 
    summarize(mse = mean(sq_residuals), rmse = sqrt(mean(sq_residuals)))
## # A tibble: 1 x 2
##      mse  rmse
##    <dbl> <dbl>
## 1 0.0279 0.167
# MSE and RMSE for model_price_4
moderndive::get_regression_points(model_price_4) %>% 
    mutate(sq_residuals = residual^2) %>% 
    summarize(mse = mean(sq_residuals), rmse = sqrt(mean(sq_residuals)))
## # A tibble: 1 x 2
##      mse  rmse
##    <dbl> <dbl>
## 1 0.0277 0.166
# Set random number generator seed value for reproducibility
set.seed(76)

# Randomly reorder the rows
house_prices_shuffled <- house_prices_transform %>% 
    sample_frac(size = 1, replace = FALSE)

# Train/test split
train <- house_prices_shuffled %>% 
    slice(1:10000)
test <- house_prices_shuffled %>% 
    slice(10001:nrow(.))

# Fit model to training set
train_model_2 <- lm(log10_price ~ log10_sqft_living + bedrooms, data=train)


# Compute RMSE (train)
moderndive::get_regression_points(train_model_2) %>% 
    mutate(sq_residuals = residual**2) %>% 
    summarize(rmse = sqrt(mean(sq_residuals)))
## # A tibble: 1 x 1
##    rmse
##   <dbl>
## 1 0.167
# Compute RMSE (test)
moderndive::get_regression_points(train_model_2, newdata = test) %>% 
    mutate(sq_residuals = residual**2) %>% 
    summarize(rmse = sqrt(mean(sq_residuals)))
## # A tibble: 1 x 1
##    rmse
##   <dbl>
## 1 0.167

Analyzing Survey Data in R

Chapter 1 - Introduction to Survey Data

What are survey weights?

  • Survey weights sometimes appear inside a dataset, to reflect potential over/under sampling
    • Survey weights result from a complex survey design - number of points in the population represented by each entry in the sampling frame
    • For example, average income would be the sum-product of weights and incomes divided by the sum of weights

Specifying elements of the design in R:

  • Simple random sampling is when every member of the population is known and had an equal chance of being selected
    • library(survey)
    • srs_design <- svydesign(data = paSample, weights = ~wts, fpc=~N, id=~1) # the ~ means that these are column names
  • Stratified sampling is when a simple random sample is taken from each of the strata (sub-units)
    • For example, taking 100 people from every county in a state, so that county-level averages can be gathered
    • stratified_design <- svydesign(data = paSample, id = ~1, weights = ~wts, strata = ~county, fpc = ~N)
  • Cluster sampling is when the population are grouped in to clusters, with a simple random sample of clusters selected, and with simple random samples taken within each selected cluster
    • cluster_design <- svydesign(data = paSample, id = ~county + personid, fpc = ~N1 + N2, weights = ~wts)

Visualizing impact of survey weights:

  • NHANES data - assessment of health of persons in the US, derived by a health check in a mobile doctor’s office
    • Stage 0 - stratified by geography and proportion minority
    • Stage 1 - within strata, counties randomly selected (selection likelihood proportional to population)
    • Stage 2 - within counties, city blocks randomly selected (selection likelihood proportional to population)
    • Stage 3 - within city blocks, households randomly selected (based on demographics)
    • Stage 4 - within households, people randomly selected
  • NHANES data are availabl through a package in R
    • library(NHANES)
    • dim(NHANESraw)
    • summarize(NHANESraw, N_hat = sum(WTMEC2YR)) # sums to double the US population, due to having 4 years of data when desiring only 2 years of data
    • NHANESraw <- mutate(NHANESraw, WTMEC4YR = WTMEC2YR/2) # fix the double population issue
    • NHANES_design <- svydesign(data = NHANESraw, strata = ~SDMVSTRA, id = ~SDMVPSU, nest = TRUE, weights = ~WTMEC4YR) # id is the cluster (first-level), nest=TRUE is due to id being nested within strata (???)
    • distinct(NHANESraw, SDMVPSU) # only takes 3 values, since only 1-3 counties are selected

Example code includes:

colTypes <- "FINLWT21 numeric _ FINCBTAX integer _ BLS_URBN integer _ POPSIZE integer _ EDUC_REF character _ EDUCA2 character _ AGE_REF integer _ AGE2 character _ SEX_REF integer _ SEX2 integer _ REF_RACE integer _ RACE2 integer _ HISP_REF integer _ HISP2 integer _ FAM_TYPE integer _ MARITAL1 integer _ REGION integer _ SMSASTAT integer _ HIGH_EDU character _ EHOUSNGC numeric _ TOTEXPCQ numeric _ FOODCQ numeric _ TRANSCQ numeric _ HEALTHCQ numeric _ ENTERTCQ numeric _ EDUCACQ integer _ TOBACCCQ numeric _ STUDFINX character _ IRAX character _ CUTENURE integer _ FAM_SIZE integer _ VEHQ integer _ ROOMSQ character _ INC_HRS1 character _ INC_HRS2 character _ EARNCOMP integer _ NO_EARNR integer _ OCCUCOD1 character _ OCCUCOD2 character _ STATE character _ DIVISION integer _ TOTXEST integer _ CREDFINX character _ CREDITB integer _ CREDITX character _ BUILDING character _ ST_HOUS integer _ INT_PHON character _ INT_HOME character _ "

ce <- readr::read_csv("./RInputFiles/ce.csv")
## Parsed with column specification:
## cols(
##   .default = col_integer(),
##   FINLWT21 = col_double(),
##   EDUC_REF = col_character(),
##   EDUCA2 = col_character(),
##   AGE2 = col_character(),
##   HIGH_EDU = col_character(),
##   EHOUSNGC = col_double(),
##   TOTEXPCQ = col_double(),
##   FOODCQ = col_double(),
##   TRANSCQ = col_double(),
##   HEALTHCQ = col_double(),
##   ENTERTCQ = col_double(),
##   TOBACCCQ = col_double(),
##   STUDFINX = col_character(),
##   IRAX = col_character(),
##   ROOMSQ = col_character(),
##   INC_HRS1 = col_character(),
##   INC_HRS2 = col_character(),
##   OCCUCOD1 = col_character(),
##   OCCUCOD2 = col_character(),
##   STATE = col_character()
##   # ... with 5 more columns
## )
## See spec(...) for full column specifications.
glimpse(ce)
## Observations: 6,301
## Variables: 49
## $ FINLWT21 <dbl> 25984.767, 6581.018, 20208.499, 18078.372, 20111.619,...
## $ FINCBTAX <int> 116920, 200, 117000, 0, 2000, 942, 0, 91000, 95000, 4...
## $ BLS_URBN <int> 1, 1, 1, 1, 1, 1, 1, 1, 2, 1, 1, 1, 1, 1, 1, 1, 1, 1,...
## $ POPSIZE  <int> 2, 3, 4, 2, 2, 2, 1, 2, 5, 2, 3, 2, 2, 3, 4, 3, 3, 1,...
## $ EDUC_REF <chr> "16", "15", "16", "15", "14", "11", "10", "13", "12",...
## $ EDUCA2   <chr> "15", "15", "13", NA, NA, NA, NA, "15", "15", "14", "...
## $ AGE_REF  <int> 63, 50, 47, 37, 51, 63, 77, 37, 51, 64, 26, 59, 81, 5...
## $ AGE2     <chr> "50", "47", "46", ".", ".", ".", ".", "36", "53", "67...
## $ SEX_REF  <int> 1, 1, 2, 1, 2, 1, 2, 1, 1, 2, 2, 2, 2, 2, 2, 2, 2, 2,...
## $ SEX2     <int> 2, 2, 1, NA, NA, NA, NA, 2, 2, 1, 1, 1, NA, NA, NA, 1...
## $ REF_RACE <int> 1, 4, 2, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 2, 1, 1,...
## $ RACE2    <int> 1, 4, 1, NA, NA, NA, NA, 1, 1, 1, 1, 1, NA, NA, NA, 2...
## $ HISP_REF <int> 2, 2, 2, 2, 2, 1, 1, 2, 2, 2, 2, 2, 2, 2, 2, 2, 2, 2,...
## $ HISP2    <int> 2, 2, 1, NA, NA, NA, NA, 2, 2, 2, 2, 2, NA, NA, NA, 2...
## $ FAM_TYPE <int> 3, 4, 1, 8, 9, 9, 8, 3, 1, 1, 3, 1, 8, 9, 8, 5, 9, 4,...
## $ MARITAL1 <int> 1, 1, 1, 5, 3, 3, 2, 1, 1, 1, 1, 1, 2, 3, 5, 1, 3, 1,...
## $ REGION   <int> 4, 4, 3, 4, 4, 3, 4, 1, 3, 2, 1, 4, 1, 3, 3, 3, 2, 1,...
## $ SMSASTAT <int> 1, 1, 1, 1, 1, 1, 1, 1, 2, 1, 1, 1, 1, 1, 1, 1, 1, 1,...
## $ HIGH_EDU <chr> "16", "15", "16", "15", "14", "11", "10", "15", "15",...
## $ EHOUSNGC <dbl> 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0,...
## $ TOTEXPCQ <dbl> 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0,...
## $ FOODCQ   <dbl> 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0,...
## $ TRANSCQ  <dbl> 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0,...
## $ HEALTHCQ <dbl> 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0,...
## $ ENTERTCQ <dbl> 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0,...
## $ EDUCACQ  <int> 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0,...
## $ TOBACCCQ <dbl> 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0,...
## $ STUDFINX <chr> ".", ".", ".", ".", ".", ".", ".", ".", ".", ".", "."...
## $ IRAX     <chr> "1000000", "10000", "0", ".", ".", "0", "0", "15000",...
## $ CUTENURE <int> 1, 1, 1, 1, 1, 2, 4, 1, 1, 2, 1, 2, 2, 2, 2, 4, 1, 1,...
## $ FAM_SIZE <int> 4, 6, 2, 1, 2, 2, 1, 5, 2, 2, 4, 2, 1, 2, 1, 4, 2, 4,...
## $ VEHQ     <int> 3, 5, 0, 4, 2, 0, 0, 2, 4, 2, 3, 2, 1, 3, 1, 2, 4, 4,...
## $ ROOMSQ   <chr> "8", "5", "6", "4", "4", "4", "7", "5", "4", "9", "6"...
## $ INC_HRS1 <chr> "40", "40", "40", "44", "40", ".", ".", "40", "40", "...
## $ INC_HRS2 <chr> "30", "40", "52", ".", ".", ".", ".", "40", "40", "."...
## $ EARNCOMP <int> 3, 2, 2, 1, 4, 7, 8, 2, 2, 8, 2, 8, 8, 7, 8, 2, 7, 3,...
## $ NO_EARNR <int> 4, 2, 2, 1, 2, 1, 0, 2, 2, 0, 2, 0, 0, 1, 0, 2, 1, 3,...
## $ OCCUCOD1 <chr> "03", "03", "05", "03", "04", NA, NA, "12", "04", NA,...
## $ OCCUCOD2 <chr> "04", "02", "01", NA, NA, NA, NA, "02", "03", NA, "11...
## $ STATE    <chr> "41", "15", "48", "06", "06", "48", "06", "42", NA, "...
## $ DIVISION <int> 9, 9, 7, 9, 9, 7, 9, 2, NA, 4, 1, 8, 2, 5, 6, 7, 3, 2...
## $ TOTXEST  <int> 15452, 11459, 15738, 25978, 588, 0, 0, 7261, 9406, -1...
## $ CREDFINX <chr> "0", ".", "0", ".", "5", ".", ".", ".", ".", "0", "."...
## $ CREDITB  <int> NA, NA, NA, NA, NA, NA, NA, NA, NA, NA, NA, NA, NA, N...
## $ CREDITX  <chr> "4000", "5000", "2000", ".", "7000", "1800", ".", "60...
## $ BUILDING <chr> "01", "01", "01", "02", "08", "01", "01", "01", "01",...
## $ ST_HOUS  <int> 2, 2, 2, 2, 2, 2, 2, 2, 2, 2, 2, 2, 2, 2, 2, 2, 2, 2,...
## $ INT_PHON <chr> NA, NA, NA, NA, NA, NA, NA, NA, NA, NA, NA, NA, NA, N...
## $ INT_HOME <chr> NA, NA, NA, NA, NA, NA, NA, NA, NA, NA, NA, NA, NA, N...
ceColTypes <- ""
for (x in names(ce)) { ceColTypes <- paste0(ceColTypes, x, " ", class(ce[, x, drop=TRUE]), " _ ") }
all.equal(colTypes, ceColTypes)
## [1] TRUE
# Construct a histogram of the weights
ggplot(data = ce, mapping = aes(x = FINLWT21)) +
    geom_histogram()
## `stat_bin()` using `bins = 30`. Pick better value with `binwidth`.

# In the next few exercises we will practice specifying sampling designs using different samples from the api dataset, located in the survey package
# The api dataset contains the Academic Performance Index and demographic information for schools in California
# The apisrs dataset is a simple random sample of schools from the api dataset
# Notice that pw contains the survey weights and fpc contains the total number of schools in the population

data(api, package="survey")
library(survey)
## Loading required package: grid
## Loading required package: survival
## 
## Attaching package: 'survey'
## The following object is masked from 'package:graphics':
## 
##     dotchart
# Look at the apisrs dataset
glimpse(apisrs)
## Observations: 200
## Variables: 39
## $ cds      <chr> "15739081534155", "19642126066716", "30664493030640",...
## $ stype    <fct> H, E, H, E, E, E, M, E, E, E, E, H, M, E, E, E, M, M,...
## $ name     <chr> "McFarland High", "Stowers (Cecil ", "Brea-Olinda Hig...
## $ sname    <chr> "McFarland High", "Stowers (Cecil B.) Elementary", "B...
## $ snum     <dbl> 1039, 1124, 2868, 1273, 4926, 2463, 2031, 1736, 2142,...
## $ dname    <chr> "McFarland Unified", "ABC Unified", "Brea-Olinda Unif...
## $ dnum     <int> 432, 1, 79, 187, 640, 284, 401, 401, 470, 632, 401, 7...
## $ cname    <chr> "Kern", "Los Angeles", "Orange", "Los Angeles", "San ...
## $ cnum     <int> 14, 18, 29, 18, 39, 18, 18, 18, 18, 37, 18, 24, 14, 1...
## $ flag     <int> NA, NA, NA, NA, NA, NA, NA, NA, NA, NA, NA, NA, NA, N...
## $ pcttest  <int> 98, 100, 98, 99, 99, 93, 98, 99, 100, 90, 95, 100, 97...
## $ api00    <int> 462, 878, 734, 772, 739, 835, 456, 506, 543, 649, 556...
## $ api99    <int> 448, 831, 742, 657, 719, 822, 472, 474, 458, 604, 575...
## $ target   <int> 18, NA, 3, 7, 4, NA, 16, 16, 17, 10, 11, 9, 14, 5, 15...
## $ growth   <int> 14, 47, -8, 115, 20, 13, -16, 32, 85, 45, -19, 51, 4,...
## $ sch.wide <fct> No, Yes, No, Yes, Yes, Yes, No, Yes, Yes, Yes, No, Ye...
## $ comp.imp <fct> Yes, Yes, No, Yes, Yes, Yes, No, Yes, Yes, No, No, Ye...
## $ both     <fct> No, Yes, No, Yes, Yes, Yes, No, Yes, Yes, No, No, Yes...
## $ awards   <fct> No, Yes, No, Yes, Yes, No, No, Yes, Yes, No, No, Yes,...
## $ meals    <int> 44, 8, 10, 70, 43, 16, 81, 98, 94, 85, 81, 67, 77, 20...
## $ ell      <int> 31, 25, 10, 25, 12, 19, 40, 65, 65, 57, 4, 25, 32, 16...
## $ yr.rnd   <fct> NA, NA, NA, NA, NA, NA, NA, No, NA, NA, NA, NA, NA, N...
## $ mobility <int> 6, 15, 7, 23, 12, 13, 22, 43, 15, 10, 20, 12, 4, 32, ...
## $ acs.k3   <int> NA, 19, NA, 23, 20, 19, NA, 18, 19, 16, 16, NA, NA, 1...
## $ acs.46   <int> NA, 30, NA, NA, 29, 29, 30, 29, 32, 25, 27, NA, NA, 2...
## $ acs.core <int> 24, NA, 28, NA, NA, NA, 27, NA, NA, 30, NA, 17, 27, N...
## $ pct.resp <int> 82, 97, 95, 100, 91, 71, 49, 75, 99, 49, 62, 96, 77, ...
## $ not.hsg  <int> 44, 4, 5, 37, 8, 1, 30, 49, 48, 23, 5, 44, 40, 4, 14,...
## $ hsg      <int> 34, 10, 9, 40, 21, 8, 27, 31, 34, 36, 38, 19, 34, 14,...
## $ some.col <int> 12, 23, 21, 14, 27, 20, 18, 15, 14, 14, 29, 17, 16, 2...
## $ col.grad <int> 7, 43, 41, 8, 34, 38, 22, 2, 4, 21, 24, 19, 8, 37, 10...
## $ grad.sch <int> 3, 21, 24, 1, 10, 34, 2, 3, 1, 6, 5, 2, 2, 19, 1, 3, ...
## $ avg.ed   <dbl> 1.91, 3.66, 3.71, 1.96, 3.17, 3.96, 2.39, 1.79, 1.77,...
## $ full     <int> 71, 90, 83, 85, 100, 75, 72, 69, 68, 81, 84, 100, 89,...
## $ emer     <int> 35, 10, 18, 18, 0, 20, 25, 22, 29, 7, 16, 0, 11, 5, 6...
## $ enroll   <int> 477, 478, 1410, 342, 217, 258, 1274, 566, 645, 311, 3...
## $ api.stu  <int> 429, 420, 1287, 291, 189, 211, 1090, 353, 563, 258, 2...
## $ pw       <dbl> 30.97, 30.97, 30.97, 30.97, 30.97, 30.97, 30.97, 30.9...
## $ fpc      <dbl> 6194, 6194, 6194, 6194, 6194, 6194, 6194, 6194, 6194,...
# Specify a simple random sampling for apisrs
apisrs_design <- svydesign(data = apisrs, weights = ~pw, fpc = ~fpc, id = ~1)

# Print a summary of the design
summary(apisrs_design)
## Independent Sampling design
## svydesign(data = apisrs, weights = ~pw, fpc = ~fpc, id = ~1)
## Probabilities:
##    Min. 1st Qu.  Median    Mean 3rd Qu.    Max. 
## 0.03229 0.03229 0.03229 0.03229 0.03229 0.03229 
## Population size (PSUs): 6194 
## Data variables:
##  [1] "cds"      "stype"    "name"     "sname"    "snum"     "dname"   
##  [7] "dnum"     "cname"    "cnum"     "flag"     "pcttest"  "api00"   
## [13] "api99"    "target"   "growth"   "sch.wide" "comp.imp" "both"    
## [19] "awards"   "meals"    "ell"      "yr.rnd"   "mobility" "acs.k3"  
## [25] "acs.46"   "acs.core" "pct.resp" "not.hsg"  "hsg"      "some.col"
## [31] "col.grad" "grad.sch" "avg.ed"   "full"     "emer"     "enroll"  
## [37] "api.stu"  "pw"       "fpc"
# Now let's practice specifying a stratified sampling design, using the dataset apistrat
# The schools are stratified based on the school type stype where E = Elementary, M = Middle, and H = High School
# For each school type, a simple random sample of schools was taken

# Glimpse the data
glimpse(apistrat)
## Observations: 200
## Variables: 39
## $ cds      <chr> "19647336097927", "19647336016018", "19648816021505",...
## $ stype    <fct> E, E, E, E, E, E, E, E, E, E, M, M, H, M, H, E, E, M,...
## $ name     <chr> "Open Magnet: Ce", "Belvedere Eleme", "Altadena Eleme...
## $ sname    <chr> "Open Magnet: Center for Individual (Char", "Belveder...
## $ snum     <dbl> 2077, 1622, 2236, 1921, 6140, 6077, 6071, 904, 4637, ...
## $ dname    <chr> "Los Angeles Unified", "Los Angeles Unified", "Pasade...
## $ dnum     <int> 401, 401, 541, 401, 460, 689, 689, 41, 702, 135, 590,...
## $ cname    <chr> "Los Angeles", "Los Angeles", "Los Angeles", "Los Ang...
## $ cnum     <int> 18, 18, 18, 18, 55, 55, 55, 14, 36, 36, 35, 32, 9, 1,...
## $ flag     <int> NA, NA, NA, NA, NA, NA, NA, NA, NA, NA, NA, NA, NA, N...
## $ pcttest  <int> 99, 100, 99, 100, 100, 100, 99, 98, 100, 100, 99, 99,...
## $ api00    <int> 840, 516, 531, 501, 720, 805, 778, 731, 592, 669, 496...
## $ api99    <int> 816, 476, 544, 457, 659, 780, 787, 731, 508, 658, 479...
## $ target   <int> NA, 16, 13, 17, 7, 1, 1, 3, 15, 7, 16, 15, 17, 20, 13...
## $ growth   <int> 24, 40, -13, 44, 61, 25, -9, 0, 84, 11, 17, 6, 7, 3, ...
## $ sch.wide <fct> Yes, Yes, No, Yes, Yes, Yes, No, No, Yes, Yes, Yes, N...
## $ comp.imp <fct> No, Yes, No, Yes, Yes, Yes, No, No, Yes, No, No, No, ...
## $ both     <fct> No, Yes, No, Yes, Yes, Yes, No, No, Yes, No, No, No, ...
## $ awards   <fct> No, Yes, No, Yes, Yes, Yes, No, No, Yes, No, No, No, ...
## $ meals    <int> 33, 98, 64, 83, 26, 7, 9, 45, 75, 47, 69, 60, 66, 54,...
## $ ell      <int> 25, 77, 23, 63, 17, 0, 2, 2, 58, 23, 25, 10, 43, 26, ...
## $ yr.rnd   <fct> No, Yes, No, No, No, No, No, No, Yes, No, No, No, No,...
## $ mobility <int> 11, 26, 17, 13, 31, 12, 10, 15, 23, 19, 26, 22, 16, 4...
## $ acs.k3   <int> 20, 19, 20, 17, 20, 19, 19, 19, 20, 18, NA, NA, NA, N...
## $ acs.46   <int> 29, 28, 30, 30, 30, 29, 31, 31, 32, 29, 32, 32, NA, 3...
## $ acs.core <int> NA, NA, NA, NA, NA, NA, NA, NA, NA, NA, 30, 32, 27, 2...
## $ pct.resp <int> 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 87, 67, 50, 70, 71, ...
## $ not.hsg  <int> 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 31, 49, 12, 20, 45, ...
## $ hsg      <int> 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 34, 20, 33, 20, 36, ...
## $ some.col <int> 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 22, 15, 23, 31, 11, ...
## $ col.grad <int> 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 10, 12, 29, 23, 8, 9...
## $ grad.sch <int> 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 4, 4, 3, 6, 0, 0, 11...
## $ avg.ed   <dbl> 3.32, 1.67, 2.34, 1.86, 3.17, 3.64, 3.55, 3.10, 2.17,...
## $ full     <int> 100, 57, 81, 64, 90, 95, 96, 93, 91, 96, 84, 65, 93, ...
## $ emer     <int> 0, 40, 26, 24, 7, 0, 0, 8, 14, 0, 18, 37, 17, 26, 19,...
## $ enroll   <int> 276, 841, 441, 298, 354, 330, 385, 583, 763, 381, 129...
## $ api.stu  <int> 241, 631, 415, 288, 319, 315, 363, 510, 652, 322, 103...
## $ pw       <dbl> 44.21, 44.21, 44.21, 44.21, 44.21, 44.21, 44.21, 44.2...
## $ fpc      <dbl> 4421, 4421, 4421, 4421, 4421, 4421, 4421, 4421, 4421,...
# Summarize strata sample sizes
apistrat %>%
  count(stype)
## # A tibble: 3 x 2
##   stype     n
##   <fct> <int>
## 1 E       100
## 2 H        50
## 3 M        50
# Specify the design
strat_design <- svydesign(data = apistrat, weights = ~pw, fpc = ~fpc, id = ~1, strata = ~stype)

# Look at the summary information for the stratified design
summary(strat_design)
## Stratified Independent Sampling design
## svydesign(data = apistrat, weights = ~pw, fpc = ~fpc, id = ~1, 
##     strata = ~stype)
## Probabilities:
##    Min. 1st Qu.  Median    Mean 3rd Qu.    Max. 
## 0.02262 0.02262 0.03587 0.04014 0.05339 0.06623 
## Stratum Sizes: 
##              E  H  M
## obs        100 50 50
## design.PSU 100 50 50
## actual.PSU 100 50 50
## Population stratum sizes (PSUs): 
##    E    H    M 
## 4421  755 1018 
## Data variables:
##  [1] "cds"      "stype"    "name"     "sname"    "snum"     "dname"   
##  [7] "dnum"     "cname"    "cnum"     "flag"     "pcttest"  "api00"   
## [13] "api99"    "target"   "growth"   "sch.wide" "comp.imp" "both"    
## [19] "awards"   "meals"    "ell"      "yr.rnd"   "mobility" "acs.k3"  
## [25] "acs.46"   "acs.core" "pct.resp" "not.hsg"  "hsg"      "some.col"
## [31] "col.grad" "grad.sch" "avg.ed"   "full"     "emer"     "enroll"  
## [37] "api.stu"  "pw"       "fpc"
# Now let's practice specifying a cluster sampling design, using the dataset apiclus2
# The schools were clustered based on school districts, dnum
# Within a sampled school district, 5 schools were randomly selected for the sample
# The schools are denoted by snum
# The number of districts is given by fpc1 and the number of schools in the sampled districts is given by fpc2

# Glimpse the data
glimpse(apiclus2)
## Observations: 126
## Variables: 40
## $ cds      <chr> "31667796031017", "55751846054837", "41688746043517",...
## $ stype    <fct> E, E, E, M, E, E, E, E, M, H, E, M, E, E, E, E, H, E,...
## $ name     <chr> "Alta-Dutch Flat", "Tenaya Elementa", "Panorama Eleme...
## $ sname    <chr> "Alta-Dutch Flat Elementary", "Tenaya Elementary", "P...
## $ snum     <dbl> 3269, 5979, 4958, 4957, 4956, 4915, 2548, 2550, 2549,...
## $ dname    <chr> "Alta-Dutch Flat Elem", "Big Oak Flat-Grvlnd Unif", "...
## $ dnum     <int> 15, 63, 83, 83, 83, 117, 132, 132, 132, 152, 152, 152...
## $ cname    <chr> "Placer", "Tuolumne", "San Mateo", "San Mateo", "San ...
## $ cnum     <int> 30, 54, 40, 40, 40, 39, 19, 19, 19, 5, 5, 5, 36, 36, ...
## $ flag     <int> NA, NA, NA, NA, NA, NA, NA, NA, NA, NA, NA, NA, NA, N...
## $ pcttest  <int> 100, 100, 98, 100, 98, 100, 100, 100, 100, 96, 98, 10...
## $ api00    <int> 821, 773, 600, 740, 716, 811, 472, 520, 568, 591, 544...
## $ api99    <int> 785, 718, 632, 740, 711, 779, 432, 494, 589, 585, 554...
## $ target   <int> 1, 4, 8, 3, 4, 1, 18, 15, 11, 11, 12, 11, NA, NA, NA,...
## $ growth   <int> 36, 55, -32, 0, 5, 32, 40, 26, -21, 6, -10, 29, 14, 2...
## $ sch.wide <fct> Yes, Yes, No, No, Yes, Yes, Yes, Yes, No, No, No, Yes...
## $ comp.imp <fct> Yes, Yes, No, No, Yes, Yes, Yes, Yes, No, No, No, Yes...
## $ both     <fct> Yes, Yes, No, No, Yes, Yes, Yes, Yes, No, No, No, Yes...
## $ awards   <fct> Yes, Yes, No, No, Yes, Yes, Yes, Yes, No, No, No, Yes...
## $ meals    <int> 27, 43, 33, 11, 5, 25, 78, 76, 68, 42, 63, 54, 0, 4, ...
## $ ell      <int> 0, 0, 5, 4, 2, 5, 38, 34, 34, 23, 42, 24, 3, 6, 2, 1,...
## $ yr.rnd   <fct> No, No, No, No, No, No, No, No, No, No, No, No, No, N...
## $ mobility <int> 14, 12, 9, 8, 6, 19, 13, 13, 15, 4, 15, 15, 24, 19, 1...
## $ acs.k3   <int> 17, 18, 19, NA, 18, 20, 19, 25, NA, NA, 20, NA, 19, 1...
## $ acs.46   <int> 20, 34, 29, 30, 28, 22, NA, 23, 24, NA, NA, 27, 27, 2...
## $ acs.core <int> NA, NA, NA, 24, NA, 31, NA, NA, 25, 21, NA, 18, NA, N...
## $ pct.resp <int> 89, 98, 79, 96, 98, 93, 100, 46, 91, 94, 93, 88, 90, ...
## $ not.hsg  <int> 4, 8, 8, 5, 3, 5, 48, 30, 63, 20, 29, 27, 0, 1, 0, 1,...
## $ hsg      <int> 16, 33, 28, 27, 14, 9, 32, 27, 16, 18, 32, 25, 0, 7, ...
## $ some.col <int> 53, 37, 30, 35, 22, 30, 15, 21, 13, 27, 26, 24, 4, 8,...
## $ col.grad <int> 21, 15, 32, 27, 58, 37, 4, 13, 6, 28, 7, 18, 51, 42, ...
## $ grad.sch <int> 6, 7, 1, 6, 3, 19, 1, 9, 2, 7, 6, 7, 44, 41, 100, 45,...
## $ avg.ed   <dbl> 3.07, 2.79, 2.90, 3.03, 3.44, 3.56, 1.77, 2.42, 1.68,...
## $ full     <int> 100, 100, 100, 82, 100, 94, 96, 86, 75, 100, 100, 97,...
## $ emer     <int> 0, 0, 0, 18, 8, 6, 8, 24, 21, 4, 4, 3, 0, 4, 0, 4, 28...
## $ enroll   <int> 152, 312, 173, 201, 147, 234, 184, 512, 543, 332, 217...
## $ api.stu  <int> 120, 270, 151, 179, 136, 189, 158, 419, 423, 303, 182...
## $ pw       <dbl> 18.925, 18.925, 18.925, 18.925, 18.925, 18.925, 18.92...
## $ fpc1     <dbl> 757, 757, 757, 757, 757, 757, 757, 757, 757, 757, 757...
## $ fpc2     <int> 1, 1, 3, 3, 3, 1, 3, 3, 3, 3, 3, 3, 4, 4, 4, 4, 1, 4,...
# Specify the design
apiclus_design <- svydesign(id = ~dnum + snum, data = apiclus2, weights = ~pw, fpc = ~fpc1 + fpc2)

#Look at the summary information stored for both designs
summary(apiclus_design)
## 2 - level Cluster Sampling design
## With (40, 126) clusters.
## svydesign(id = ~dnum + snum, data = apiclus2, weights = ~pw, 
##     fpc = ~fpc1 + fpc2)
## Probabilities:
##     Min.  1st Qu.   Median     Mean  3rd Qu.     Max. 
## 0.003669 0.037743 0.052840 0.042390 0.052840 0.052840 
## Population size (PSUs): 757 
## Data variables:
##  [1] "cds"      "stype"    "name"     "sname"    "snum"     "dname"   
##  [7] "dnum"     "cname"    "cnum"     "flag"     "pcttest"  "api00"   
## [13] "api99"    "target"   "growth"   "sch.wide" "comp.imp" "both"    
## [19] "awards"   "meals"    "ell"      "yr.rnd"   "mobility" "acs.k3"  
## [25] "acs.46"   "acs.core" "pct.resp" "not.hsg"  "hsg"      "some.col"
## [31] "col.grad" "grad.sch" "avg.ed"   "full"     "emer"     "enroll"  
## [37] "api.stu"  "pw"       "fpc1"     "fpc2"
# Construct histogram of pw
ggplot(data = apisrs, mapping = aes(x = pw)) + 
    geom_histogram()
## `stat_bin()` using `bins = 30`. Pick better value with `binwidth`.
## Warning: Computation failed in `stat_bin()`:
## `binwidth` must be positive

# Construct histogram of pw
ggplot(data = apistrat, mapping = aes(x = pw)) + 
    geom_histogram()
## `stat_bin()` using `bins = 30`. Pick better value with `binwidth`.

# Construct histogram of pw
ggplot(data = apiclus2, mapping = aes(x = pw)) + 
    geom_histogram()
## `stat_bin()` using `bins = 30`. Pick better value with `binwidth`.

NHANESraw <- read.csv("./RInputFiles/NHANESraw.txt")
NHANESraw <- NHANESraw %>%
    mutate(WTMEC4YR=WTMEC2YR / 2)
names(NHANESraw)[1] <- "SurveyYr"
glimpse(NHANESraw)
## Observations: 20,293
## Variables: 78
## $ SurveyYr            <fct> 2009_10, 2009_10, 2009_10, 2009_10, 2009_1...
## $ ID                  <int> 51624, 51625, 51626, 51627, 51628, 51629, ...
## $ Gender              <fct> male, male, male, male, female, male, fema...
## $ Age                 <int> 34, 4, 16, 10, 60, 26, 49, 1, 10, 80, 10, ...
## $ AgeMonths           <int> 409, 49, 202, 131, 722, 313, 596, 12, 124,...
## $ Race1               <fct> White, Other, Black, Black, Black, Mexican...
## $ Race3               <fct> NA, NA, NA, NA, NA, NA, NA, NA, NA, NA, NA...
## $ Education           <fct> c_HighSchool, NA, NA, NA, c_HighSchool, b_...
## $ MaritalStatus       <fct> Married, NA, NA, NA, Widowed, Married, Liv...
## $ HHIncome            <fct> 25000-34999, 20000-24999, 45000-54999, 200...
## $ HHIncomeMid         <int> 30000, 22500, 50000, 22500, 12500, 30000, ...
## $ Poverty             <dbl> 1.36, 1.07, 2.27, 0.81, 0.69, 1.01, 1.91, ...
## $ HomeRooms           <int> 6, 9, 5, 6, 6, 4, 5, 5, 7, 4, 5, 5, 7, NA,...
## $ HomeOwn             <fct> Own, Own, Own, Rent, Rent, Rent, Rent, Ren...
## $ Work                <fct> NotWorking, NA, NotWorking, NA, NotWorking...
## $ Weight              <dbl> 87.4, 17.0, 72.3, 39.8, 116.8, 97.6, 86.7,...
## $ Length              <dbl> NA, NA, NA, NA, NA, NA, NA, 75.7, NA, NA, ...
## $ HeadCirc            <dbl> NA, NA, NA, NA, NA, NA, NA, NA, NA, NA, NA...
## $ Height              <dbl> 164.7, 105.4, 181.3, 147.8, 166.0, 173.0, ...
## $ BMI                 <dbl> 32.22, 15.30, 22.00, 18.22, 42.39, 32.61, ...
## $ BMICatUnder20yrs    <fct> NA, NA, NA, NA, NA, NA, NA, NA, NA, NA, NA...
## $ BMI_WHO             <fct> 30.0_plus, 12.0_18.5, 18.5_to_24.9, 12.0_1...
## $ Pulse               <int> 70, NA, 68, 68, 72, 72, 86, NA, 70, 88, 84...
## $ BPSysAve            <int> 113, NA, 109, 93, 150, 104, 112, NA, 108, ...
## $ BPDiaAve            <int> 85, NA, 59, 41, 68, 49, 75, NA, 53, 43, 45...
## $ BPSys1              <int> 114, NA, 112, 92, 154, 102, 118, NA, 106, ...
## $ BPDia1              <int> 88, NA, 62, 36, 70, 50, 82, NA, 60, 62, 38...
## $ BPSys2              <int> 114, NA, 114, 94, 150, 104, 108, NA, 106, ...
## $ BPDia2              <int> 88, NA, 60, 44, 68, 48, 74, NA, 50, 46, 40...
## $ BPSys3              <int> 112, NA, 104, 92, 150, 104, 116, NA, 110, ...
## $ BPDia3              <int> 82, NA, 58, 38, 68, 50, 76, NA, 56, 40, 50...
## $ Testosterone        <dbl> NA, NA, NA, NA, NA, NA, NA, NA, NA, NA, NA...
## $ DirectChol          <dbl> 1.29, NA, 1.55, 1.89, 1.16, 1.16, 1.16, NA...
## $ TotChol             <dbl> 3.49, NA, 4.97, 4.16, 5.22, 4.14, 6.70, NA...
## $ UrineVol1           <int> 352, NA, 281, 139, 30, 202, 77, NA, 39, 12...
## $ UrineFlow1          <dbl> NA, NA, 0.415, 1.078, 0.476, 0.563, 0.094,...
## $ UrineVol2           <int> NA, NA, NA, NA, 246, NA, NA, NA, NA, NA, N...
## $ UrineFlow2          <dbl> NA, NA, NA, NA, 2.51, NA, NA, NA, NA, NA, ...
## $ Diabetes            <fct> No, No, No, No, Yes, No, No, No, No, No, N...
## $ DiabetesAge         <int> NA, NA, NA, NA, 56, NA, NA, NA, NA, NA, NA...
## $ HealthGen           <fct> Good, NA, Vgood, NA, Fair, Good, Good, NA,...
## $ DaysPhysHlthBad     <int> 0, NA, 2, NA, 20, 2, 0, NA, NA, 0, NA, 0, ...
## $ DaysMentHlthBad     <int> 15, NA, 0, NA, 25, 14, 10, NA, NA, 0, NA, ...
## $ LittleInterest      <fct> Most, NA, NA, NA, Most, None, Several, NA,...
## $ Depressed           <fct> Several, NA, NA, NA, Most, Most, Several, ...
## $ nPregnancies        <int> NA, NA, NA, NA, 1, NA, 2, NA, NA, NA, NA, ...
## $ nBabies             <int> NA, NA, NA, NA, 1, NA, 2, NA, NA, NA, NA, ...
## $ Age1stBaby          <int> NA, NA, NA, NA, NA, NA, 27, NA, NA, NA, NA...
## $ SleepHrsNight       <int> 4, NA, 8, NA, 4, 4, 8, NA, NA, 6, NA, 9, N...
## $ SleepTrouble        <fct> Yes, NA, No, NA, No, No, Yes, NA, NA, No, ...
## $ PhysActive          <fct> No, NA, Yes, NA, No, Yes, No, NA, NA, Yes,...
## $ PhyActiveDays       <int> NA, NA, 5, NA, NA, 2, NA, NA, NA, 4, NA, N...
## $ TVHrsDay            <fct> NA, NA, NA, NA, NA, NA, NA, NA, NA, NA, NA...
## $ TVHrsDay.1          <fct> NA, NA, NA, NA, NA, NA, NA, NA, NA, NA, NA...
## $ TVHrsDayChild       <int> NA, 4, NA, 1, NA, NA, NA, NA, 1, NA, 3, NA...
## $ ComputerHrsDayChild <int> NA, 1, NA, 1, NA, NA, NA, NA, 0, NA, 0, NA...
## $ Alcohol12PlusYr     <fct> Yes, NA, NA, NA, No, Yes, Yes, NA, NA, Yes...
## $ AlcoholDay          <int> NA, NA, NA, NA, NA, 19, 2, NA, NA, 1, NA, ...
## $ AlcoholYear         <int> 0, NA, NA, NA, 0, 48, 20, NA, NA, 52, NA, ...
## $ SmokeNow            <fct> No, NA, NA, NA, Yes, No, Yes, NA, NA, No, ...
## $ Smoke100            <fct> Yes, NA, NA, NA, Yes, Yes, Yes, NA, NA, Ye...
## $ SmokeAge            <int> 18, NA, NA, NA, 16, 15, 38, NA, NA, 16, NA...
## $ Marijuana           <fct> Yes, NA, NA, NA, NA, Yes, Yes, NA, NA, NA,...
## $ AgeFirstMarij       <int> 17, NA, NA, NA, NA, 10, 18, NA, NA, NA, NA...
## $ RegularMarij        <fct> No, NA, NA, NA, NA, Yes, No, NA, NA, NA, N...
## $ AgeRegMarij         <int> NA, NA, NA, NA, NA, 12, NA, NA, NA, NA, NA...
## $ HardDrugs           <fct> Yes, NA, NA, NA, No, Yes, Yes, NA, NA, NA,...
## $ SexEver             <fct> Yes, NA, NA, NA, Yes, Yes, Yes, NA, NA, NA...
## $ SexAge              <int> 16, NA, NA, NA, 15, 9, 12, NA, NA, NA, NA,...
## $ SexNumPartnLife     <int> 8, NA, NA, NA, 4, 10, 10, NA, NA, NA, NA, ...
## $ SexNumPartYear      <int> 1, NA, NA, NA, NA, 1, 1, NA, NA, NA, NA, N...
## $ SameSex             <fct> No, NA, NA, NA, No, No, Yes, NA, NA, NA, N...
## $ SexOrientation      <fct> Heterosexual, NA, NA, NA, NA, Heterosexual...
## $ WTINT2YR            <dbl> 80100.544, 53901.104, 13953.078, 11664.899...
## $ WTMEC2YR            <dbl> 81528.772, 56995.035, 14509.279, 12041.635...
## $ SDMVPSU             <int> 1, 2, 1, 2, 2, 1, 2, 2, 2, 1, 1, 1, 2, 2, ...
## $ SDMVSTRA            <int> 83, 79, 84, 86, 75, 88, 85, 86, 88, 77, 86...
## $ WTMEC4YR            <dbl> 40764.386, 28497.518, 7254.639, 6020.818, ...
#Create table of average survey weights by race
tab_weights <- NHANESraw %>%
  group_by(Race1) %>%
  summarize(avg_wt = mean(WTMEC4YR))

#Print the table
tab_weights
## # A tibble: 5 x 2
##   Race1    avg_wt
##   <fct>     <dbl>
## 1 Black     8026.
## 2 Hispanic  8579.
## 3 Mexican   8216.
## 4 Other    10116.
## 5 White    26236.
# The two important design variables in NHANESraw are SDMVSTRA, which contains the strata assignment for each unit, and SDMVPSU, which contains the cluster id within a given stratum
# Specify the NHANES design
NHANES_design <- svydesign(data = NHANESraw, strata = ~SDMVSTRA, id = ~SDMVPSU, 
                           nest = TRUE, weights = ~WTMEC4YR
                           )

# Print summary of design
summary(NHANES_design)
## Stratified 1 - level Cluster Sampling design (with replacement)
## With (62) clusters.
## svydesign(data = NHANESraw, strata = ~SDMVSTRA, id = ~SDMVPSU, 
##     nest = TRUE, weights = ~WTMEC4YR)
## Probabilities:
##      Min.   1st Qu.    Median      Mean   3rd Qu.      Max. 
## 8.986e-06 5.664e-05 1.054e-04       Inf 1.721e-04       Inf 
## Stratum Sizes: 
##             75  76  77  78  79  80  81  82  83  84  85  86  87  88  89  90
## obs        803 785 823 829 696 751 696 724 713 683 592 946 598 647 251 862
## design.PSU   2   2   2   2   2   2   2   2   2   2   2   3   2   2   2   3
## actual.PSU   2   2   2   2   2   2   2   2   2   2   2   3   2   2   2   3
##             91  92  93  94  95  96  97  98  99 100 101 102 103
## obs        998 875 602 688 722 676 608 708 682 700 715 624 296
## design.PSU   3   3   2   2   2   2   2   2   2   2   2   2   2
## actual.PSU   3   3   2   2   2   2   2   2   2   2   2   2   2
## Data variables:
##  [1] "SurveyYr"            "ID"                  "Gender"             
##  [4] "Age"                 "AgeMonths"           "Race1"              
##  [7] "Race3"               "Education"           "MaritalStatus"      
## [10] "HHIncome"            "HHIncomeMid"         "Poverty"            
## [13] "HomeRooms"           "HomeOwn"             "Work"               
## [16] "Weight"              "Length"              "HeadCirc"           
## [19] "Height"              "BMI"                 "BMICatUnder20yrs"   
## [22] "BMI_WHO"             "Pulse"               "BPSysAve"           
## [25] "BPDiaAve"            "BPSys1"              "BPDia1"             
## [28] "BPSys2"              "BPDia2"              "BPSys3"             
## [31] "BPDia3"              "Testosterone"        "DirectChol"         
## [34] "TotChol"             "UrineVol1"           "UrineFlow1"         
## [37] "UrineVol2"           "UrineFlow2"          "Diabetes"           
## [40] "DiabetesAge"         "HealthGen"           "DaysPhysHlthBad"    
## [43] "DaysMentHlthBad"     "LittleInterest"      "Depressed"          
## [46] "nPregnancies"        "nBabies"             "Age1stBaby"         
## [49] "SleepHrsNight"       "SleepTrouble"        "PhysActive"         
## [52] "PhyActiveDays"       "TVHrsDay"            "TVHrsDay.1"         
## [55] "TVHrsDayChild"       "ComputerHrsDayChild" "Alcohol12PlusYr"    
## [58] "AlcoholDay"          "AlcoholYear"         "SmokeNow"           
## [61] "Smoke100"            "SmokeAge"            "Marijuana"          
## [64] "AgeFirstMarij"       "RegularMarij"        "AgeRegMarij"        
## [67] "HardDrugs"           "SexEver"             "SexAge"             
## [70] "SexNumPartnLife"     "SexNumPartYear"      "SameSex"            
## [73] "SexOrientation"      "WTINT2YR"            "WTMEC2YR"           
## [76] "SDMVPSU"             "SDMVSTRA"            "WTMEC4YR"
# Number of clusters
NHANESraw %>%
  summarize(n_clusters = n_distinct(SDMVSTRA, SDMVPSU))
##   n_clusters
## 1         62
# Sample sizes in clusters
NHANESraw %>%
  count(SDMVSTRA, SDMVPSU) 
## # A tibble: 62 x 3
##    SDMVSTRA SDMVPSU     n
##       <int>   <int> <int>
##  1       75       1   379
##  2       75       2   424
##  3       76       1   419
##  4       76       2   366
##  5       77       1   441
##  6       77       2   382
##  7       78       1   378
##  8       78       2   451
##  9       79       1   349
## 10       79       2   347
## # ... with 52 more rows

Chapter 2 - Exploring categorical data

Visualizing categorical variables:

  • Can estimate distributions of race, including both the weighted and unweighted distributions
    • tab_unw <- NHANESraw %>% group_by(Race1) %>% summarize(Freq = n()) %>% mutate(Prop = Freq/sum(Freq)) %>% arrange(desc(Prop))
    • ggplot(data = tab_unw, mapping = aes(x = Race1, y = Prop)) + geom_col() + coord_flip() + scale_x_discrete(limits = tab_unw$Race1) # Labels layer omitted
  • Can convert back to the weighted frequencies
    • tab_w <- svytable(~Race1, design = NHANES_design) %>% as.data.frame() %>% mutate(Prop = Freq/sum(Freq)) %>% arrange(desc(Prop))
    • ggplot(data = tab_w, mapping = aes(x = Race1, y = Prop)) + geom_col() + coord_flip() + scale_x_discrete(limits = tab_w$Race1) # Labels layer omitted

Exploring two categorical variables:

  • Can look at diabetes withing the NHANES data, using the syvtable() function
    • svytable(~Diabetes, design = NHANES_design)
    • tab_w <- svytable(~Race1 + Diabetes, design = NHANES_design) # Race and Diabetes
    • tab_w <- as.data.frame(tab_w) # converts contingency table to frame
    • ggplot(data = tab_w, mapping = aes(x = Race1, fill = Diabetes, y = Freq)) + geom_col() + coord_flip()
    • ggplot(data = tab_w, mapping = aes(x = Race1, y = Freq, fill = Diabetes)) + geom_col(position = “fill”) + coord_flip() # stacked bars to 100%

Inference for categorical variables:

  • Formal statistical tests for associations among categorical variables using chi-squared tests for association
    • svychisq(~Race1 + Diabetes, design = NHANES_design, statistic = “Chisq”)

Example code includes:

# Specify the survey design
NHANESraw <- mutate(NHANESraw, WTMEC4YR = .5 * WTMEC2YR)
NHANES_design <- svydesign(data = NHANESraw, strata = ~SDMVSTRA, id = ~SDMVPSU, nest = TRUE, weights = ~WTMEC4YR)

# Determine the levels of Depressed
levels(NHANESraw$Depressed)
## [1] "Most"    "None"    "Several"
# Construct a frequency table of Depressed
tab_w <- svytable(~Depressed, design = NHANES_design)

# Determine class of tab_w
class(tab_w)
## [1] "svytable" "xtabs"    "table"
# Display tab_w
tab_w
## Depressed
##      Most      None   Several 
##  12704441 158758609  32732508
# Add proportions to table
tab_w <- tab_w %>%
  as.data.frame() %>%
  mutate(Prop = Freq/sum(Freq))

# Create a barplot
ggplot(data = tab_w, mapping = aes(x = Depressed, y = Prop)) + 
  geom_col()

# Construct and print a frequency table
tab_D <- svytable(~Depressed, design = NHANES_design)
tab_D
## Depressed
##      Most      None   Several 
##  12704441 158758609  32732508
# Construct and print a frequency table
tab_H <- svytable(~HealthGen, design = NHANES_design)
tab_H
## HealthGen
## Excellent      Fair      Good      Poor     Vgood 
##  27659954  31544030  87497585   5668484  77482169
# Construct and print a frequency table
tab_DH <- svytable(~Depressed + HealthGen, design = NHANES_design)
tab_DH
##          HealthGen
## Depressed  Excellent       Fair       Good       Poor      Vgood
##   Most      563613.3  3935505.6  4698948.1  1650509.5  1855864.8
##   None    21327181.6 17690782.8 59920031.9  2324945.0 57487318.5
##   Several  1870620.9  7355104.8 13950468.6  1253819.6  8302494.5
# Add conditional proportions to tab_DH
tab_DH_cond <- tab_DH %>%
    as.data.frame() %>%
    group_by(HealthGen) %>%
    mutate(n_HealthGen = sum(Freq), Prop_Depressed = Freq/n_HealthGen) %>%
    ungroup()

# Print tab_DH_cond
tab_DH_cond
## # A tibble: 15 x 5
##    Depressed HealthGen      Freq n_HealthGen Prop_Depressed
##    <fct>     <fct>         <dbl>       <dbl>          <dbl>
##  1 Most      Excellent   563613.   23761416.         0.0237
##  2 None      Excellent 21327182.   23761416.         0.898 
##  3 Several   Excellent  1870621.   23761416.         0.0787
##  4 Most      Fair       3935506.   28981393.         0.136 
##  5 None      Fair      17690783.   28981393.         0.610 
##  6 Several   Fair       7355105.   28981393.         0.254 
##  7 Most      Good       4698948.   78569449.         0.0598
##  8 None      Good      59920032.   78569449.         0.763 
##  9 Several   Good      13950469.   78569449.         0.178 
## 10 Most      Poor       1650510.    5229274.         0.316 
## 11 None      Poor       2324945.    5229274.         0.445 
## 12 Several   Poor       1253820.    5229274.         0.240 
## 13 Most      Vgood      1855865.   67645678.         0.0274
## 14 None      Vgood     57487318.   67645678.         0.850 
## 15 Several   Vgood      8302494.   67645678.         0.123
# Create a segmented bar graph of the conditional proportions in tab_DH_cond
ggplot(data = tab_DH_cond, mapping = aes(x = HealthGen, y = Prop_Depressed, fill = Depressed)) + 
  geom_col() + 
  coord_flip() 

# We can also estimate counts with svytotal(). The syntax is given by:
# svytotal(x = ~interaction(Var1, Var2), design = design, na.rm = TRUE)
# For each combination of the two variables, we get an estimate of the total and the standard error


# Estimate the totals for combos of Depressed and HealthGen
tab_totals <- svytotal(x = ~interaction(Depressed, HealthGen), design = NHANES_design, na.rm = TRUE)

# Print table of totals
tab_totals
##                                                       total      SE
## interaction(Depressed, HealthGen)Most.Excellent      563613  139689
## interaction(Depressed, HealthGen)None.Excellent    21327182 1556268
## interaction(Depressed, HealthGen)Several.Excellent  1870621  277198
## interaction(Depressed, HealthGen)Most.Fair          3935506  370256
## interaction(Depressed, HealthGen)None.Fair         17690783 1206307
## interaction(Depressed, HealthGen)Several.Fair       7355105  455364
## interaction(Depressed, HealthGen)Most.Good          4698948  501105
## interaction(Depressed, HealthGen)None.Good         59920032 3375068
## interaction(Depressed, HealthGen)Several.Good      13950469  931077
## interaction(Depressed, HealthGen)Most.Poor          1650510  195136
## interaction(Depressed, HealthGen)None.Poor          2324945  251934
## interaction(Depressed, HealthGen)Several.Poor       1253820  168440
## interaction(Depressed, HealthGen)Most.Vgood         1855865  269970
## interaction(Depressed, HealthGen)None.Vgood        57487319 2975806
## interaction(Depressed, HealthGen)Several.Vgood      8302495  687020
# Estimate the means for combos of Depressed and HealthGen
tab_means <- svymean(x = ~interaction(Depressed, HealthGen), design = NHANES_design, na.rm = TRUE)

# Print table of means
tab_means
##                                                         mean     SE
## interaction(Depressed, HealthGen)Most.Excellent    0.0027603 0.0007
## interaction(Depressed, HealthGen)None.Excellent    0.1044492 0.0053
## interaction(Depressed, HealthGen)Several.Excellent 0.0091613 0.0014
## interaction(Depressed, HealthGen)Most.Fair         0.0192740 0.0019
## interaction(Depressed, HealthGen)None.Fair         0.0866400 0.0047
## interaction(Depressed, HealthGen)Several.Fair      0.0360214 0.0026
## interaction(Depressed, HealthGen)Most.Good         0.0230129 0.0023
## interaction(Depressed, HealthGen)None.Good         0.2934563 0.0092
## interaction(Depressed, HealthGen)Several.Good      0.0683220 0.0033
## interaction(Depressed, HealthGen)Most.Poor         0.0080833 0.0010
## interaction(Depressed, HealthGen)None.Poor         0.0113863 0.0013
## interaction(Depressed, HealthGen)Several.Poor      0.0061405 0.0009
## interaction(Depressed, HealthGen)Most.Vgood        0.0090890 0.0013
## interaction(Depressed, HealthGen)None.Vgood        0.2815422 0.0078
## interaction(Depressed, HealthGen)Several.Vgood     0.0406612 0.0028
# Run a chi square test between Depressed and HealthGen
svychisq(~Depressed + HealthGen, design = NHANES_design, statistic = "Chisq")
## 
##  Pearson's X^2: Rao & Scott adjustment
## 
## data:  svychisq(~Depressed + HealthGen, design = NHANES_design, statistic = "Chisq")
## X-squared = 1592.7, df = 8, p-value < 2.2e-16
# Construct a contingency table
tab <- svytable(~Education + HomeOwn, design=NHANES_design)

# Add conditional proportion of levels of HomeOwn for each educational level
tab_df <- as.data.frame(tab) %>%
  group_by(Education) %>%
  mutate(n_Education = sum(Freq), Prop_HomeOwn = Freq/n_Education) %>%
  ungroup()

# Create a segmented bar graph
ggplot(data = tab_df, mapping = aes(x=Education, y=Prop_HomeOwn, fill=HomeOwn)) + 
  geom_col() + 
  coord_flip()

# Run a chi square test
svychisq(~Education + HomeOwn, 
    design = NHANES_design, 
    statistic = "Chisq")
## 
##  Pearson's X^2: Rao & Scott adjustment
## 
## data:  svychisq(~Education + HomeOwn, design = NHANES_design, statistic = "Chisq")
## X-squared = 531.78, df = 8, p-value = 2.669e-16

Chapter 3 - Exploring quantitative data

Summarizing quantitative data:

  • Can look at the physician health bad variable and summarize
    • NHANESraw %>% filter(Age >= 12) %>% select(DaysPhysHlthBad) # just the data
    • svymean(x = ~DaysPhysHlthBad, design = NHANES_design, na.rm = TRUE) # means of number of days feeling in bad heatlh
    • svyquantile(x = ~DaysPhysHlthBad, design = NHANES_design, na.rm = TRUE, quantiles = 0.5) # get the median (quantile 0.5) of the data
  • Can grab summaries by group using svyby with a function FUN provided
    • svyby(formula = ~DaysPhysHlthBad, by = ~SmokeNow, design = NHANES_design, FUN = svymean, na.rm = TRUE, row.names = FALSE)
    • svyby(formula = ~Age, by = ~SmokeNow, design = NHANES_design, FUN = svymean, na.rm = TRUE, keep.names = FALSE)

Visualizing quantitative data:

  • Can create bar graphs of the means
    • out <- svyby(formula = ~DaysPhysHlthBad, by = ~SmokeNow, design = NHANES_design, FUN = svymean, na.rm = TRUE, keep.names = FALSE)
    • ggplot(data = out, mapping = aes(x = SmokeNow, y = DaysPhysHlthBad)) + geom_col() + labs(y = “Monthly Average Numberof Bad Health Days”, x = “Smoker?”)
    • out <- mutate(out, lower = DaysPhysHlthBad - se, upper = DaysPhysHlthBad + se)
  • Create histograms of the data
    • ggplot(data = out, mapping = aes(x = SmokeNow, y = DaysPhysHlthBad, ymin = lower, ymax = upper)) + geom_col(fill = “lightblue”) + geom_errorbar(width = .5) + labs(y = “Monthly Average Numberof Bad Health Days”, x = “Smoker?”)
    • ggplot(data = NHANESraw, mapping = aes(x = DaysPhysHlthBad, weight = WTMEC4YR)) + geom_histogram(binwidth = 1, color = “white”) + labs(x = “Number of Bad Health Days in a Month”)
  • Create density plots of the data
    • NHANESraw %>% filter(!is.na(DaysPhysHlthBad)) %>% mutate(WTMEC4YR_std = WTMEC4YR/sum(WTMEC4YR)) %>%
    • ggplot(mapping = aes(x = DaysPhysHlthBad, weight = WTMEC4YR_std)) + geom_density(bw = .6, fill = “lightblue”) + labs(x = “Number of Bad Health Days in a Month”)

Inference for quantitative data:

  • May want to compare means across two groups in the data using a weighted 2-sample t-test
    • The test statistic is the difference in means divided by the SE (standard error)
    • svyttest(formula = DaysPhysHlthBad ~ SmokeNow, design = NHANES_design)

Example code includes:

# Compute the survey-weighted mean
svymean(x = ~SleepHrsNight, design = NHANES_design, na.rm = TRUE)
##                 mean     SE
## SleepHrsNight 6.9292 0.0166
# Compute the survey-weighted mean by Gender
svyby(formula = ~SleepHrsNight, by = ~Gender, design = NHANES_design, 
      FUN = svymean, na.rm = TRUE, keep.names = FALSE
      )
##   Gender SleepHrsNight         se
## 1 female      6.976103 0.02374684
## 2   male      6.879050 0.01953263
# Compute the survey-weighted quantiles
svyquantile(x = ~SleepHrsNight, design = NHANES_design, na.rm = TRUE, 
            quantiles = c(0.01, 0.25, 0.5, 0.75, .99)
            )
##               0.01 0.25 0.5 0.75 0.99
## SleepHrsNight    4    6   7    8   10
# Compute the survey-weighted quantiles by Gender
svyby(formula = ~SleepHrsNight, by = ~Gender, design = NHANES_design, FUN = svyquantile, 
      na.rm = TRUE, quantiles = c(0.5), keep.rows = FALSE, keep.var = FALSE
      )
##        Gender statistic
## female female         7
## male     male         7
# Compute the survey-weighted mean by Gender
out <- svyby(formula = ~SleepHrsNight, by = ~Gender, design = NHANES_design, 
             FUN = svymean, na.rm = TRUE, keep.names = FALSE
             )
             
# Construct a bar plot of average sleep by gender
ggplot(data = out, mapping = aes(x=as.factor(Gender), y=SleepHrsNight)) + 
    geom_col() + 
    labs(y="Average Nightly Sleep")

# Add lower and upper columns to out
out_col <- mutate(out, lower = SleepHrsNight - 2*se, upper = SleepHrsNight + 2*se)

# Construct a bar plot of average sleep by gender with error bars
ggplot(data = out_col, mapping = aes(x = Gender, y = SleepHrsNight, ymin = lower, ymax = upper)) + 
    geom_col(fill = "gold") + 
    labs(y = "Average Nightly Sleep") + 
    geom_errorbar(width = 0.7)  

# Create a histogram with a set binwidth
ggplot(data = NHANESraw, mapping = aes(x=SleepHrsNight, weight=WTMEC4YR)) + 
    geom_histogram(binwidth = 1, color = "white") + 
    labs(x = "Hours of Sleep")
## Warning: Removed 7261 rows containing non-finite values (stat_bin).

# Create a histogram with a set binwidth
ggplot(data = NHANESraw, mapping = aes(x=SleepHrsNight, weight=WTMEC4YR)) + 
    geom_histogram(binwidth = 0.5, color = "white") + 
    labs(x = "Hours of Sleep")
## Warning: Removed 7261 rows containing non-finite values (stat_bin).

# Create a histogram with a set binwidth
ggplot(data = NHANESraw, mapping = aes(x=SleepHrsNight, weight=WTMEC4YR)) + 
    geom_histogram(binwidth = 2, color = "white") + 
    labs(x = "Hours of Sleep")
## Warning: Removed 7261 rows containing non-finite values (stat_bin).

# Density plot of sleep faceted by gender
NHANESraw %>% 
    filter(!is.na(SleepHrsNight), !is.na(Gender)) %>%
    group_by(Gender) %>%
    mutate(WTMEC4YR_std = WTMEC4YR/sum(WTMEC4YR)) %>%
    ggplot(mapping = aes(x = SleepHrsNight, weight = WTMEC4YR_std)) + 
        geom_density(bw = 0.6,  fill = "gold") +
        labs(x = "Hours of Sleep") + 
        facet_wrap(~Gender, labeller = "label_both")

# Run a survey-weighted t-test
svyttest(formula = SleepHrsNight ~ Gender, design = NHANES_design)
## Warning in summary.glm(g): observations with zero weight not used for
## calculating dispersion
## Warning in summary.glm(glm.object): observations with zero weight not used
## for calculating dispersion
## 
##  Design-based t-test
## 
## data:  SleepHrsNight ~ Gender
## t = -3.4077, df = 32, p-value = 0.001785
## alternative hypothesis: true difference in mean is not equal to 0
## 95 percent confidence interval:
##  -0.15287218 -0.04123256
## sample estimates:
## difference in mean 
##        -0.09705237
# Find means of total cholesterol by whether or not active 
out <- svyby(formula = ~TotChol, by = ~PhysActive, design = NHANES_design, 
             FUN = svymean, na.rm = TRUE, keep.names = FALSE
             )

# Construct a bar plot of means of total cholesterol by whether or not active 
ggplot(data = out, mapping = aes(x=PhysActive, y=TotChol)) + 
    geom_col()

# Run t test for difference in means of total cholesterol by whether or not active
svyttest(formula = TotChol ~ PhysActive, design = NHANES_design)
## 
##  Design-based t-test
## 
## data:  TotChol ~ PhysActive
## t = -3.7936, df = 32, p-value = 0.0006232
## alternative hypothesis: true difference in mean is not equal to 0
## 95 percent confidence interval:
##  -0.20053677 -0.06390939
## sample estimates:
## difference in mean 
##         -0.1322231

Chapter 4 - Modeling quantitative data

Visualization with scatter plots:

  • Can look at head circumference compared to age (only captured for babies) using a scatterplot
    • babies <- filter(NHANESraw, AgeMonths <= 6) %>% select(AgeMonths, HeadCirc)
    • ggplot(data = babies, mapping = aes(x = AgeMonths, y = HeadCirc)) + geom_point()
    • ggplot(data = babies, mapping = aes(x = AgeMonths, y = HeadCirc)) + geom_jitter(width = 0.3, height = 0) # width jitter but no height jitter
  • Can use weighting to extrapolate the scatter plot to the entire population
    • ggplot(data = babies, mapping = aes(x = AgeMonths, y = HeadCirc, size = WTMEC4YR)) + geom_jitter(width = 0.3, height = 0) + guides(size = FALSE)
    • ggplot(data = babies, mapping = aes(x = AgeMonths, y = HeadCirc, size = WTMEC4YR)) + geom_jitter(width = 0.3, height = 0, alpha = 0.3) + guides(size = FALSE)
    • ggplot(data = babies, mapping = aes(x = AgeMonths, y = HeadCirc, color = WTMEC4YR)) + geom_jitter(width = 0.3, height = 0) + guides(color = FALSE)
    • ggplot(data = babies, mapping = aes(x = AgeMonths, y = HeadCirc, alpha = WTMEC4YR)) + geom_jitter(width = 0.3, height = 0) + guides(alpha = FALSE)

Visualizing trends:

  • Survey-weighted lines of best fit can be added using the geom_smooth() in ggplot2, with the weight= provided as an aestehtic to the geom_smooth()
    • ggplot(data = babies, mapping = aes(x = AgeMonths, y = HeadCirc, alpha = WTMEC4YR)) + geom_jitter(width = 0.3, height = 0) + guides(alpha = FALSE) + geom_smooth(method = “lm”, se = FALSE, mapping = aes(weight = WTMEC4YR))
  • Can also graph the best fit trendlines split by a categorical variable
    • babies <- filter(NHANESraw, AgeMonths <= 6) %>% select(AgeMonths, HeadCirc, WTMEC4YR, Gender)
    • ggplot(data = babies, mapping = aes(x = AgeMonths, y = HeadCirc, alpha = WTMEC4YR, color = Gender)) + geom_jitter(width = 0.3, height = 0) + guides(alpha = FALSE) + geom_smooth(method = “lm”, se = FALSE, mapping = aes(weight = WTMEC4YR))

Modeling survey data:

  • Can use the regression equations directly to predict values for a new data point
    • mod <- svyglm(HeadCirc ~ AgeMonths, design = NHANES_design)
    • summary(mod)
  • The standard errors are an assessment of the likely errors between the estimated regression line and the true regression line

More complex modeling:

  • Can extend the simple regression to a multiple regression in a parallel slopes model
    • mod <- svyglm(HeadCirc ~ AgeMonths + Gender, design = NHANES_design)
  • Can also extend the simple regression to a multiple regression with different slopes

Wrap up:

  • Packages survey, dplyr, and ggplot2
  • Survey fundamentals - clusters, strata, weights, svydesign(), etc.
  • Categorical data, svytable(), svychisq()
  • Quantiative data, svymean(), svytotal(), svyby(), svyquantile(), svyttest()
  • Modeling trends, svyglm()

Example code includes:

# Create dataset with only 20 year olds
NHANES20 <- filter(NHANESraw, Age == 20)

# Construct scatter plot
ggplot(data = NHANES20, mapping = aes(x=Height, y=Weight)) + 
    geom_point(alpha = 0.3) + 
    guides(size = FALSE)
## Warning: Removed 4 rows containing missing values (geom_point).

# Construct bubble plot
ggplot(data = NHANES20, mapping = aes(x=Height, y=Weight, size=WTMEC4YR)) + 
    geom_point(alpha = 0.3) + 
    guides(size = FALSE)
## Warning: Removed 4 rows containing missing values (geom_point).

# Construct a scatter plot
ggplot(data = NHANES20, mapping = aes(x=Height, y=Weight, color=WTMEC4YR)) + 
    geom_point() + 
    guides(color = FALSE)
## Warning: Removed 4 rows containing missing values (geom_point).

# Construct a scatter plot
ggplot(data = NHANES20, mapping = aes(x=Height, y=Weight, alpha=WTMEC4YR)) + 
    geom_point() + 
    guides(alpha = FALSE)
## Warning: Removed 4 rows containing missing values (geom_point).

# Add gender to plot
ggplot(data = NHANES20, mapping = aes(x=Height, y=Weight, size=WTMEC4YR, color=Gender)) + 
    geom_point(alpha=0.3) + 
    guides(size = FALSE)
## Warning: Removed 4 rows containing missing values (geom_point).

# Add gender to plot
ggplot(data = NHANES20, mapping = aes(x=Height, y=Weight, alpha=WTMEC4YR, color=Gender)) + 
    geom_point() + 
    guides(alpha = FALSE)
## Warning: Removed 4 rows containing missing values (geom_point).

# Bubble plot with linear of best fit
ggplot(data = NHANESraw, mapping = aes(x = Height, y = Weight, size=WTMEC4YR)) + 
  geom_point(alpha = 0.1) + 
  guides(size = FALSE) + 
  geom_smooth(method = "lm", se = FALSE, mapping = aes(weight=WTMEC4YR))
## Warning: Removed 2279 rows containing non-finite values (stat_smooth).
## Warning: Removed 2279 rows containing missing values (geom_point).

# Add quadratic curve and cubic curve
ggplot(data = NHANESraw, mapping = aes(x = Height, y = Weight, size = WTMEC4YR)) + 
  geom_point(alpha = 0.1) + 
  guides(size = FALSE) + 
  geom_smooth(method = "lm", se = FALSE, mapping = aes(weight = WTMEC4YR)) +
  geom_smooth(method = "lm", se = FALSE, mapping = aes(weight = WTMEC4YR), formula = y ~ poly(x, 2), color = "orange") +
  geom_smooth(method = "lm", se = FALSE, mapping = aes(weight = WTMEC4YR), formula = y ~ poly(x, 3), color = "red")
## Warning: Removed 2279 rows containing non-finite values (stat_smooth).
## Warning: Removed 2279 rows containing non-finite values (stat_smooth).

## Warning: Removed 2279 rows containing non-finite values (stat_smooth).
## Warning: Removed 2279 rows containing missing values (geom_point).

# Add survey-weighted trend lines to bubble plot
ggplot(data = NHANES20, mapping = aes(x = Height, y = Weight, size = WTMEC4YR, color = Gender)) + 
  geom_point(alpha = 0.1) + 
  guides(size = FALSE) + 
  geom_smooth(method = "lm", se = FALSE, linetype = 2)
## Warning: Removed 4 rows containing non-finite values (stat_smooth).
## Warning: Removed 4 rows containing missing values (geom_point).

# Add non-survey-weighted trend lines
ggplot(data = NHANES20, mapping = aes(x = Height, y = Weight, size = WTMEC4YR, color = Gender)) + 
  geom_point(alpha = 0.1) + 
  guides(size = FALSE) + 
  geom_smooth(method = "lm", se = FALSE, linetype = 2) + 
  geom_smooth(method = "lm", se = FALSE, mapping = aes(weight=WTMEC4YR))
## Warning: Removed 4 rows containing non-finite values (stat_smooth).
## Warning: Removed 4 rows containing non-finite values (stat_smooth).
## Warning: Removed 4 rows containing missing values (geom_point).

# Subset survey design object to only include 20 year olds
NHANES20_design <- subset(NHANES_design, Age == 20)

# Build a linear regression model
mod <- svyglm(Weight ~ Height, design = NHANES20_design)

# Print summary of the model
summary(mod)
## 
## Call:
## svyglm(formula = Weight ~ Height, design = NHANES20_design)
## 
## Survey design:
## subset(NHANES_design, Age == 20)
## 
## Coefficients:
##             Estimate Std. Error t value Pr(>|t|)    
## (Intercept) -67.2571    22.9836  -2.926  0.00674 ** 
## Height        0.8305     0.1368   6.072 1.51e-06 ***
## ---
## Signif. codes:  0 '***' 0.001 '**' 0.01 '*' 0.05 '.' 0.1 ' ' 1
## 
## (Dispersion parameter for gaussian family taken to be 326.6108)
## 
## Number of Fisher Scoring iterations: 2
# Build a linear regression model same slope
mod1 <- svyglm(Weight ~ Height + Gender, design = NHANES20_design)

# Print summary of the same slope model
summary(mod1)
## 
## Call:
## svyglm(formula = Weight ~ Height + Gender, design = NHANES20_design)
## 
## Survey design:
## subset(NHANES_design, Age == 20)
## 
## Coefficients:
##             Estimate Std. Error t value Pr(>|t|)    
## (Intercept) -53.8665    22.7622  -2.366   0.0254 *  
## Height        0.7434     0.1391   5.346  1.2e-05 ***
## Gendermale    2.7207     3.2471   0.838   0.4095    
## ---
## Signif. codes:  0 '***' 0.001 '**' 0.01 '*' 0.05 '.' 0.1 ' ' 1
## 
## (Dispersion parameter for gaussian family taken to be 325.3881)
## 
## Number of Fisher Scoring iterations: 2
# Build a linear regression model different slopes
mod2 <- svyglm(Weight ~ Height*Gender, design = NHANES20_design)

# Print summary of the different slopes model
summary(mod2)
## 
## Call:
## svyglm(formula = Weight ~ Height * Gender, design = NHANES20_design)
## 
## Survey design:
## subset(NHANES_design, Age == 20)
## 
## Coefficients:
##                    Estimate Std. Error t value Pr(>|t|)   
## (Intercept)          9.5061    21.5357   0.441  0.66257   
## Height               0.3565     0.1269   2.809  0.00932 **
## Gendermale        -131.0884    41.9989  -3.121  0.00438 **
## Height:Gendermale    0.7897     0.2385   3.311  0.00273 **
## ---
## Signif. codes:  0 '***' 0.001 '**' 0.01 '*' 0.05 '.' 0.1 ' ' 1
## 
## (Dispersion parameter for gaussian family taken to be 316.5007)
## 
## Number of Fisher Scoring iterations: 2
# Plot BPDiaAve and BPSysAve by Diabetes and include trend lines
drop_na(NHANESraw, Diabetes) %>% 
    ggplot(mapping = aes(x=BPDiaAve, y=BPSysAve, size=WTMEC4YR, color=Diabetes)) + 
    geom_point(alpha = 0.2) +  
    guides(size = FALSE) + 
    geom_smooth(method="lm", se = FALSE, mapping = aes(weight=WTMEC4YR))
## Warning: Removed 4600 rows containing non-finite values (stat_smooth).
## Warning: Removed 4600 rows containing missing values (geom_point).

# Build simple linear regression model
mod1 <- svyglm(BPSysAve ~ BPDiaAve, design = NHANES_design)

# Build model with different slopes
mod2 <- svyglm(BPSysAve ~ BPDiaAve*Diabetes, design = NHANES_design)

# Summarize models
summary(mod1)
## 
## Call:
## svyglm(formula = BPSysAve ~ BPDiaAve, design = NHANES_design)
## 
## Survey design:
## svydesign(data = NHANESraw, strata = ~SDMVSTRA, id = ~SDMVPSU, 
##     nest = TRUE, weights = ~WTMEC4YR)
## 
## Coefficients:
##             Estimate Std. Error t value Pr(>|t|)    
## (Intercept) 85.74311    1.86920   45.87   <2e-16 ***
## BPDiaAve     0.48150    0.02354   20.45   <2e-16 ***
## ---
## Signif. codes:  0 '***' 0.001 '**' 0.01 '*' 0.05 '.' 0.1 ' ' 1
## 
## (Dispersion parameter for gaussian family taken to be 290.3472)
## 
## Number of Fisher Scoring iterations: 2
summary(mod2)
## 
## Call:
## svyglm(formula = BPSysAve ~ BPDiaAve * Diabetes, design = NHANES_design)
## 
## Survey design:
## svydesign(data = NHANESraw, strata = ~SDMVSTRA, id = ~SDMVPSU, 
##     nest = TRUE, weights = ~WTMEC4YR)
## 
## Coefficients:
##                      Estimate Std. Error t value Pr(>|t|)    
## (Intercept)          83.58652    2.05537  40.667  < 2e-16 ***
## BPDiaAve              0.49964    0.02623  19.047  < 2e-16 ***
## DiabetesYes          25.36616    3.56587   7.114 6.53e-08 ***
## BPDiaAve:DiabetesYes -0.22132    0.05120  -4.323 0.000156 ***
## ---
## Signif. codes:  0 '***' 0.001 '**' 0.01 '*' 0.05 '.' 0.1 ' ' 1
## 
## (Dispersion parameter for gaussian family taken to be 279.1637)
## 
## Number of Fisher Scoring iterations: 2

Inference for Catgeorical Data

Chapter 1 - Inference for a Single Parameter

General Social Survey:

  • Categorical data are where the data are categories rather than numbers, which is prevalent in the General Social Survey (GSS)
    • Several thousand people are surveyed, with a goal of drawing inferences about the population from the sample
    • Can grab the “gss” dataframe from the tidyverse package
  • Can generate an approximate error by using mean +/- 2*SE
  • The bootstrap can be a valuable way to assess the standard errors - calculate the sample statistic within each replicate, and calculate its distribution
    • library(infer)
    • boot <- gss2016 %>% specify(response=happy, success=“HAPPY”) %>% generate(reps=500, type=“bootstrap”) %>% calculate(stat=“prop”)

CI interpretations:

  • In classicial statistical inference, there is assumed to be a fix but unknown population parameter that is being estimated by way of sampling
  • A 95% CI means that 95% of the intervals formed from random samples would include the true population parameter

Approximation shortcut:

  • Standard errors tend to increase when the sample size is small or the probability is close to 50%
  • The normal distribution (bell curve) can be a useful approximation for a large sample size - the normal becomes the sampling distribution
    • SE = sqrt( p * (1-p) / n )
    • n * p and n * (1-p) should both be greater than or equal to 10

Example code includes:

load("./RInputFiles/gss.RData")
glimpse(gss)
## Observations: 50,346
## Variables: 28
## $ id       <dbl> 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16...
## $ year     <dbl> 1982, 1982, 1982, 1982, 1982, 1982, 1982, 1982, 1982,...
## $ age      <fct> 41, 49, 27, 24, 57, 29, 21, 68, 54, 80, 74, 30, 53, 3...
## $ class    <fct> WORKING CLASS, WORKING CLASS, MIDDLE CLASS, MIDDLE CL...
## $ degree   <fct> LT HIGH SCHOOL, HIGH SCHOOL, HIGH SCHOOL, HIGH SCHOOL...
## $ sex      <fct> MALE, FEMALE, FEMALE, FEMALE, MALE, MALE, FEMALE, MAL...
## $ marital  <fct> MARRIED, MARRIED, NEVER MARRIED, NEVER MARRIED, NEVER...
## $ race     <fct> WHITE, WHITE, WHITE, WHITE, WHITE, WHITE, WHITE, WHIT...
## $ region   <fct> NEW ENGLAND, NEW ENGLAND, NEW ENGLAND, NEW ENGLAND, N...
## $ partyid  <fct> STRONG DEMOCRAT, STRONG DEMOCRAT, IND,NEAR DEM, IND,N...
## $ happy    <fct> PRETTY HAPPY, NOT TOO HAPPY, VERY HAPPY, PRETTY HAPPY...
## $ grass    <fct> NA, NA, NA, NA, NA, NA, NA, NA, NA, NA, NA, NA, NA, N...
## $ relig    <fct> CATHOLIC, CATHOLIC, CATHOLIC, CATHOLIC, CATHOLIC, CAT...
## $ cappun2  <fct> NA, NA, NA, NA, NA, NA, NA, NA, NA, NA, NA, NA, NA, N...
## $ cappun   <fct> FAVOR, FAVOR, FAVOR, OPPOSE, OPPOSE, FAVOR, OPPOSE, F...
## $ finalter <fct> STAYED SAME, WORSE, BETTER, BETTER, STAYED SAME, BETT...
## $ protest3 <fct> NA, NA, NA, NA, NA, NA, NA, NA, NA, NA, NA, NA, NA, N...
## $ natspac  <fct> ABOUT RIGHT, TOO MUCH, TOO LITTLE, TOO LITTLE, ABOUT ...
## $ natarms  <fct> TOO LITTLE, TOO LITTLE, ABOUT RIGHT, TOO MUCH, TOO LI...
## $ conclerg <fct> ONLY SOME, ONLY SOME, A GREAT DEAL, ONLY SOME, A GREA...
## $ confed   <fct> ONLY SOME, ONLY SOME, ONLY SOME, ONLY SOME, A GREAT D...
## $ conpress <fct> ONLY SOME, ONLY SOME, A GREAT DEAL, ONLY SOME, A GREA...
## $ conjudge <fct> HARDLY ANY, ONLY SOME, A GREAT DEAL, A GREAT DEAL, A ...
## $ consci   <fct> ONLY SOME, ONLY SOME, A GREAT DEAL, A GREAT DEAL, A G...
## $ conlegis <fct> ONLY SOME, ONLY SOME, ONLY SOME, ONLY SOME, A GREAT D...
## $ zodiac   <fct> TAURUS, CAPRICORN, VIRGO, PISCES, CAPRICORN, LEO, LIB...
## $ oversamp <dbl> 1.235, 1.235, 1.235, 1.235, 1.235, 1.235, 1.235, 1.23...
## $ postlife <fct> NA, NA, NA, NA, NA, NA, NA, NA, NA, NA, NA, NA, NA, N...
# Subset data from 2016
gss2016 <- gss %>%
  filter(year == 2016)

gss2016 %>% count(consci)
## # A tibble: 4 x 2
##   consci           n
##   <fct>        <int>
## 1 A GREAT DEAL   791
## 2 ONLY SOME      976
## 3 HARDLY ANY     117
## 4 <NA>           983
gss2016 <- gss2016 %>%
    mutate(old_consci=consci, 
           consci=fct_other(fct_recode(old_consci, "High"="A GREAT DEAL"), keep="High", other_level="Low")
           )
gss2016 %>% count(consci)
## # A tibble: 3 x 2
##   consci     n
##   <fct>  <int>
## 1 High     791
## 2 Low     1093
## 3 <NA>     983
# Plot distribution of consci
ggplot(gss2016, aes(x = consci)) +
  geom_bar()

# Compute proportion of high conf
p_hat <- gss2016 %>%
  summarize(p = mean(consci == "High", na.rm = TRUE)) %>%
  pull()


# Load the infer package
library(infer)

# Create single bootstrap data set
b1 <- gss2016 %>%
    specify(response = consci, success = "High") %>%
    generate(reps = 1, type = "bootstrap")
## Warning: Removed 983 rows containing missing values.
# Plot distribution of consci
ggplot(b1, aes(x = consci)) +
  geom_bar()

# Compute proportion with high conf
b1 %>%
  summarize(p = mean(consci == "High")) %>%
  pull()
## [1] 0.4187898
# Create bootstrap distribution for proportion that favor
boot_dist <- gss2016 %>%
  specify(response = consci, success = "High") %>%
  generate(reps = 500) %>%
  calculate(stat = "prop", success = "High", na.rm = TRUE)
## Warning: Removed 983 rows containing missing values.
# Plot distribution
ggplot(boot_dist, aes(x=stat)) +
  geom_density()

# Compute estimate of SE
SE <- boot_dist %>%
  summarize(se = sd(stat)) %>%
  pull()

# Create CI
c(p_hat - 2*SE, p_hat + 2*SE)
## [1] 0.3964511 0.4432517
# Two new smaller data sets have been created for you from gss2016: gss2016_small, which contains 50 observations, and gss2016_smaller which contains just 10 observations

id50 <- c(6, 98, 2673, 1435, 1535, 525, 2784, 1765, 163, 1859, 2497, 1780, 184, 575, 2781, 2310, 1677, 2478, 1226, 2350, 1139, 1635, 1350, 1809, 1842, 1501, 1502, 2610, 2456, 49, 56, 2167, 2401, 2002, 2343, 2012, 860, 2557, 1147, 1119, 2449, 695, 1511, 666, 1595, 1094, 2643, 769, 1263, 2426)
id10 <- c(1609, 1342, 2066, 2710, 1809, 503, 1889, 486, 1469, 6)

gss2016_small <- gss2016 %>%
    filter(id %in% id50)
gss2016_smaller <- gss2016 %>%
    filter(id %in% id10)

# Create bootstrap distribution for proportion
boot_dist_small <- gss2016_small %>%
  specify(response = consci, success = "High") %>%
  generate(reps = 500, type = "bootstrap") %>%
  calculate(stat = "prop")

# Compute estimate of SE
SE_small_n <- boot_dist_small %>%
  summarize(se = sd(stat)) %>%
  pull()

# Create bootstrap distribution for proportion
boot_dist_smaller <- gss2016_smaller %>%
  specify(response = consci, success = "High") %>%
  generate(reps = 500, type = "bootstrap") %>%
  calculate(stat = "prop")

# Compute estimate of SE
SE_smaller_n <- boot_dist_smaller %>%
  summarize(se = sd(stat)) %>%
  pull()

c(SE_small_n, SE_smaller_n)
## [1] 0.07206823 0.14608464
# Create bootstrap distribution for proportion that have hardy any
boot_dist <- gss2016 %>%
  specify(response=consci,  success = "Low") %>%
  generate(reps=500, type="bootstrap") %>%
  calculate(stat = "prop", na.rm = TRUE)
## Warning: Removed 983 rows containing missing values.
# Compute estimate of SE
SE_low_p <- boot_dist %>%
    summarize(se = sd(stat)) %>%
    pull()


# Compute p-hat and n
p_hat <- gss2016_small %>% 
    summarize(p = mean(consci == "High", na.rm=TRUE)) %>%
    pull()
n <- nrow(gss2016_small)

# Check conditions
p_hat * n >= 10
## [1] TRUE
(1 - p_hat) * n >= 10
## [1] TRUE
# Calculate SE
SE_approx <- sqrt(p_hat * (1 - p_hat) / n)

# Form 95% CI
c(p_hat - 2 * SE_approx, p_hat + 2 * SE_approx)
## [1] 0.242712 0.517288

Chapter 2 - Proportions (Testing and Power)

Hypothesis test for a proportion:

  • The hypothesis test for a proportion looks at what sort of p-hat would be observed if p held a specific value
    • The hypothesize() function prior to generate() sets out the hypothesis in question
  • Suppose that analysis is being run on whether people favor capital punishment
    • null <- gss2016 %>% specify(response=cappun, success=“FAVOR”) %>% hypothesize(null=“point”, p=0.5) %>% generate(reps=500, type=“simulate”) %>% calculate(stat=“prop”)
    • null %>% summarize(mean(stat > p_hat)) %>% pull() * 2 # The times 2 is for a two-sided test

Intervals for differences:

  • Can also look at differences in proportions, for example men vs. women belief in afterlife
  • Can generate null data by rewording the null hypothesis to “there is no association between belief in the afterlife and gender” - enables test by permutation
    • gss2016 %>% specify(response=postlife, explanatory=sex, success=“YES”) %>% hypothesize(null=“independence”) %>% generate(reps=1, type=“permute”)
    • gss2016 %>% specify(postlife ~ sex, success=“YES”) %>% hypothesize(null=“independence”) %>% generate(reps=1, type=“permute”) # can use formula notation; same command as above, but simplified
    • null <- gss2016 %>% specify(postlife ~ sex, success=“YES”) %>% hypothesize(null=“independence”) %>% generate(reps=500, type=“permute”) %>% calculate(stat=“diff in props”, order=c(“FEMALE”, “MALE”)) # Full command
    • null %>% summarize(mean(stat > d_hat)) %>% pull() * 2

Statistical errors:

  • Type I errors - probability of rejecting a true null hypothesis - will happen with probability alpha
  • Type II errors - probability of not rejecting a false null hypothesis - will happen with probability beta, meaning the test has power 1-beta

Example code includes:

# Construct plot
ggplot(gss2016, aes(x = postlife)) + 
    geom_bar()

# Compute and save proportion that believe
p_hat <- gss2016 %>%
    summarize(mean(postlife == "YES", na.rm = TRUE)) %>%
    pull()

# Generate one data set under H0
sim1 <- gss2016 %>%
    specify(response = postlife, success = "YES") %>%
    hypothesize(null = "point", p = 0.75) %>%
    generate(reps = 1, type = "simulate")
## Warning: Removed 279 rows containing missing values.
# Construct plot
ggplot(sim1, aes(x=postlife)) +
    geom_bar()

# Compute proportion that believe
sim1 %>%
    summarize(mean(postlife == "YES")) %>%
    pull()
## [1] 0.7472952
# Generate null distribution
null <- gss2016 %>%
    specify(response = postlife, success = "YES") %>%
    hypothesize(null = "point", p = .75) %>%
    generate(reps = 100, type = "simulate") %>%
    calculate(stat = "prop")
## Warning: Removed 279 rows containing missing values.
# Visualize null distribution
ggplot(null, aes(x = stat)) +
    geom_density() +
    geom_vline(xintercept = p_hat, color = "red")

# Compute the two-tailed p-value
null %>%
    summarize(mean(stat > p_hat)) %>%
    pull() * 2
## [1] 0
# Plot distribution
ggplot(gss2016, aes(x = sex, fill = cappun)) +
    geom_bar(position = "fill")

# Compute two proportions
p_hats <- gss2016 %>%
    group_by(sex) %>%
    summarize(mean(cappun == "FAVOR", na.rm = TRUE)) %>%
    pull()

# Compute difference in proportions
d_hat <- diff(p_hats)


# Create null distribution
null <- gss2016 %>%
    specify(cappun ~ sex, success = "FAVOR") %>%
    hypothesize(null = "independence") %>%
    generate(reps = 500, type = "permute") %>%
    calculate(stat = "diff in props", order = c("FEMALE", "MALE"))
## Warning: Removed 172 rows containing missing values.
# Visualize null
ggplot(null, aes(x = stat)) +
    geom_density() +
    geom_vline(xintercept = d_hat, col = "red")

# Compute two-tailed p-value
null %>%
    summarize(mean(stat < d_hat)) %>%
    pull() * 2
## [1] 0
# Create the bootstrap distribution
boot <- gss2016 %>%
    specify(cappun ~ sex, success="FAVOR") %>%
    generate(reps=500, type="bootstrap") %>%
    calculate(stat = "diff in props", order = c("FEMALE", "MALE"))
## Warning: Removed 172 rows containing missing values.
# Compute the standard error
SE <- boot %>%
    summarize(sd(stat)) %>%
    pull()
  
# Form the CI (lower, upper)
c( d_hat - 2*SE, d_hat + 2*SE )
## [1] -0.12636862 -0.05205316
gssmod <- gss2016 %>%
    mutate(coinflip=sample(c("heads", "tails"), size=nrow(.), replace=TRUE))
table(gssmod$coinflip)
## 
## heads tails 
##  1434  1433
# Find difference in props
p_hats <- gssmod %>%
    group_by(coinflip) %>%
    summarize(mean(cappun == "FAVOR", na.rm = TRUE)) %>%
    pull()

# Compute difference in proportions
d_hat <- diff(p_hats)

# Form null distribution
null <- gssmod %>%
    specify(cappun ~ coinflip, success = "FAVOR") %>%
    hypothesize(null = "independence") %>%
    generate(reps = 500, type = "permute") %>%
    calculate(stat = "diff in props", order = c("heads", "tails"))
## Warning: Removed 172 rows containing missing values.
ggplot(null, aes(x = stat)) +
    geom_density() +
    geom_vline(xintercept = d_hat, color = "red")

# Set alpha
alpha <- 0.05

# Find cutoffs
upper <- null %>%
    summarize(quantile(stat, probs = c(1-alpha/2))) %>%
    pull()
lower <- null %>%
    summarize(quantile(stat, probs = alpha/2)) %>%
    pull()
  
# Visualize cutoffs
ggplot(null, aes(x = stat)) +
    geom_density() +
    geom_vline(xintercept = d_hat, color = "red") +
    geom_vline(xintercept = lower, color = "blue") +
    geom_vline(xintercept = upper, color = "blue")

# check if inside cutoffs
d_hat %>%
    between(lower, upper)
## [1] TRUE

Chapter 3 - Comparing Many Parameters (Independence)

Contingency tables:

  • Can look at bivariate relationships, such as political party affiliation vs. opinions on military spending
    • The broom package can help in movements to/from contingency tables, by keeping things cleaner
    • tab <- gss2016 %>% select(natarms, party) %>% table()
    • tab %>% broom::tidy() %>% uncount(Freq)

Chi-squared test statistic:

  • Can use Chi-squared to look at dependence of variables
  • Can create a contingency table O of the observations and a contingency table E of the expected distribution if there is pure independence
    • Can then look at (O-E)**2 / E, and sum up to get the overall Chi-squared distribution
    • Hypothesis tests can then assess how extreme a given Chi-squared may be

Alternative method - chi-squared test statistic:

  • The Chi-squared statistic is derived from the Chi-squared distribution, which is specified solely by the number of degrees of freedom
    • The degrees of freedom are (nRows - 1) * (nCols - 1)
    • pchisq(chi_obs_spac, df=4) # gives the likelihood of actual being less than, can use 1-pchisq() for the amount that is greater (the p-value of interest
  • Generally, need to have 5+ counts per cell, and to only use chi-squared for df=2+ (for df=1, can just compare proportions using the normal distribution)

Intervals for chi-squared:

  • Can remove the hypothesize() call and use bootstrap() instead, but there is no real meaning to a Chi-squared in the absence of a null hypothesis
  • It is very unlikely that you would ever see a confidence interval attached to a Chi-squared interval

Example code includes:

# Exclude "other" party
gss_party <- gss2016 %>%
    mutate(party=fct_collapse(partyid, 
                              "D"=c("STRONG DEMOCRAT", "NOT STR DEMOCRAT"), 
                              "R"=c("NOT STR REPUBLICAN", "STRONG REPUBLICAN"),
                              "I"=c("IND,NEAR DEM", "INDEPENDENT", "IND,NEAR REP"),
                              "O"="OTHER PARTY"
                              )
           ) %>%
    filter(!is.na(party), party != "O") %>%
    droplevels()

# Bar plot of proportions
gss_party %>%
    ggplot(aes(x = party, fill = natspac)) +
    geom_bar(position = "fill")

# Bar plot of counts
gss_party %>%
    ggplot(aes(x=party, fill = natspac)) +
    geom_bar()

# Create table of natspac and party
O <- gss_party %>%
    select(natspac, party) %>%
    table()

# Convert table back to tidy df
O %>%
    broom::tidy() %>%
    uncount(n)
## # A tibble: 1,249 x 2
##    natspac    party
##    <chr>      <chr>
##  1 TOO LITTLE D    
##  2 TOO LITTLE D    
##  3 TOO LITTLE D    
##  4 TOO LITTLE D    
##  5 TOO LITTLE D    
##  6 TOO LITTLE D    
##  7 TOO LITTLE D    
##  8 TOO LITTLE D    
##  9 TOO LITTLE D    
## 10 TOO LITTLE D    
## # ... with 1,239 more rows
# Create one permuted data set
perm_1 <- gss_party %>%
    specify(natarms ~ party) %>%
    hypothesize(null = "independence") %>%
    generate(reps = 1, type = "permute")
## Warning: Removed 1412 rows containing missing values.
# Visualize permuted data
ggplot(perm_1, aes(x = party, fill = natarms)) +
    geom_bar()

# Make contingency table
tab <- perm_1 %>%
    ungroup() %>%
    select(natarms, party) %>%
    table()
  
# Compute chi-squared stat
(chi_obs_arms <- chisq.test(tab)$statistic)
## X-squared 
##   1.34665
(chi_obs_spac <- chisq.test(gss_party$natspac, gss_party$party)$statistic)
## X-squared 
##  7.568185
# Create null
null <- gss_party %>%
    specify(natspac ~ party) %>%
    hypothesize(null = "independence") %>%
    generate(reps = 100, type = "permute") %>%
    calculate(stat = "Chisq")
## Warning: Removed 1514 rows containing missing values.
# Visualize H_0 and obs
ggplot(null, aes(x = stat)) +
    geom_density() +
    geom_vline(xintercept = chi_obs_spac, color = "red")

# Create null
null <- gss_party %>%
    specify(natarms ~ party) %>%
    hypothesize(null = "independence") %>%
    generate(reps = 100, type = "permute") %>%
    calculate(stat = "Chisq")
## Warning: Removed 1412 rows containing missing values.
# Visualize H_0 and obs
ggplot(null, aes(x = stat)) +
    geom_density() +
    geom_vline(xintercept = chi_obs_arms, color = "red")

# create bar plot
gss2016 %>%
    ggplot(aes(x = region, fill = happy)) +
    geom_bar(position = "fill") +
    coord_flip()

# create table
tab <- gss2016 %>%
    select(happy, region) %>%
    table()
  
# compute observed statistic
(chi_obs_stat <- chisq.test(tab)$statistic)
## X-squared 
##  12.60899
# generate null distribution
null <- gss2016 %>%
    mutate(happy=fct_other(happy, keep=c("VERY HAPPY"))) %>%
    specify(happy ~ region, success = "VERY HAPPY") %>%
    hypothesize(null = "independence") %>%
    generate(reps = 500, type = "permute") %>%
    calculate(stat = "Chisq")
## Warning: Removed 8 rows containing missing values.
# plot null(s)
ggplot(null, aes(x = stat)) +
    geom_density() +
    geom_vline(xintercept = chi_obs_stat) +
    stat_function(fun = dchisq, args = list(df = (9-1)*(2-1)), color = "blue")

# permutation p-value
null %>% 
    summarize(mean(stat > chi_obs_stat)) %>% 
    pull()
## [1] 0.116
# approximation p-value
1 - pchisq(chi_obs_stat, df = (9-1)*(2-1))
## X-squared 
## 0.1260301

Chapter 4 - Comparing Many Parameters (Goodness of Fit)

Case Study: Election Fraud:

  • Election fraud has many meanings; this course will focus on altering vote totals
  • Benford’s Law applies when looking at broad collections of data, and considering only the first digit
    • The law proposed that 30.1% of the first digits should be 1, with decreases as the numbers increase
    • The basic idea is that the 1’s always happen first (get to the 100s before any other x00s)
  • Can look at the 2009 Iranian election, and assess in comparison to Benford’s Law

Goodness of Fit:

  • Desire to assess whether the voter data is well aligned with Benford’s law - Chi-squared is a good statistic for this
    • chisq.test(myTab, p=myProbNull)
  • Can simulate the null hypothesis, for example by using
    • gss2016 %>% specify(response=party) %>% hypothesize(null=“point”, p=p_uniform) %>% generate(reps=1, type=“simulate”)

Now to the US:

  • Comparison to the US election in Iowa in 2016
  • Can look at county-level data

Wrap-Up:

  • Could have rejected the null hypothesis even when it is true - typically 5%
  • More fundamental errors could be at play, such as assuming the first digit should follow Benford’s Law
    • Population of world cities tend to fit Benford’s Law criteria (uniform distribution, consistency of logs, etc.)
  • Techniques for carrying out inference on categorical data - confidence intervals, hypothesis tests, Chi-squared tests for independence, goodness of fit of distributions
  • All tests follow specify-hypohteize-generate-calculate

Example code includes:

iran <- readr::read_csv("./RInputFiles/iran.csv")
## Parsed with column specification:
## cols(
##   province = col_character(),
##   city = col_character(),
##   ahmadinejad = col_integer(),
##   rezai = col_integer(),
##   karrubi = col_integer(),
##   mousavi = col_integer(),
##   total_votes_cast = col_integer(),
##   voided_votes = col_integer(),
##   legitimate_votes = col_integer()
## )
glimpse(iran)
## Observations: 366
## Variables: 9
## $ province         <chr> "East Azerbaijan", "East Azerbaijan", "East A...
## $ city             <chr> "Azar Shahr", "Asko", "Ahar", "Bostan Abad", ...
## $ ahmadinejad      <int> 37203, 32510, 47938, 38610, 36395, 435728, 20...
## $ rezai            <int> 453, 481, 568, 281, 485, 9830, 166, 55, 442, ...
## $ karrubi          <int> 138, 468, 173, 53, 190, 3513, 74, 46, 211, 12...
## $ mousavi          <int> 18312, 18799, 26220, 12603, 33695, 419983, 14...
## $ total_votes_cast <int> 56712, 52643, 75500, 51911, 71389, 876919, 35...
## $ voided_votes     <int> 606, 385, 601, 364, 624, 7865, 195, 102, 634,...
## $ legitimate_votes <int> 56106, 52258, 74899, 51547, 70765, 869054, 35...
# Compute candidate totals
totals <- iran %>%
  summarize(ahmadinejad = sum(ahmadinejad),
            rezai = sum(rezai),
            karrubi = sum(karrubi),
            mousavi = sum(mousavi))

# Plot totals
totals %>%
  gather(key = "candidate", value = "votes") %>%
  ggplot(aes(x = candidate, y = votes)) +
  geom_bar(stat = "identity")

# Cities won by #2
iran %>%
  group_by(province) %>%
  summarize(ahmadinejad = sum(ahmadinejad),
            mousavi = sum(mousavi)) %>%
  mutate(mousavi_win = mousavi > ahmadinejad) %>%
  filter(mousavi_win)
## # A tibble: 2 x 4
##   province               ahmadinejad mousavi mousavi_win
##   <chr>                        <int>   <int> <lgl>      
## 1 Sistan and Baluchestan      450269  507946 TRUE       
## 2 West Azerbaijan             623946  656508 TRUE
# Print get_first
get_first <- function(x) {
    substr(as.character(x), 1, 1) %>%
      as.numeric() %>%
      as.factor()
}

# Create first_digit
iran2 <- iran %>%
  mutate(first_digit = get_first(total_votes_cast))
  
# Construct barchart
iran2 %>%
  ggplot(aes(x=first_digit)) +
  geom_bar()

# Tabulate the counts of each digit
tab <- iran2 %>%
  select(first_digit) %>%
  table()

# Compute observed stat
p_benford <- c(0.301029995663981, 0.176091259055681, 0.1249387366083, 0.0969100130080564, 0.0791812460476248, 0.0669467896306132, 0.0579919469776867, 0.0511525224473813, 0.0457574905606751)
names(p_benford) <- 1:9
p_benford[9] <- 1 - sum(p_benford[-9])
sum(p_benford)
## [1] 1
chi_obs_stat <- chisq.test(tab, p = p_benford)$stat

# Form null distribution
null <- iran2 %>%
  specify(response=first_digit) %>%
  hypothesize(null = "point", p = p_benford) %>%
  generate(reps=500, type = "simulate") %>%
  calculate(stat = "Chisq")


# plot both nulls
ggplot(null, aes(x = stat)) +
  geom_density() +
  geom_vline(xintercept = chi_obs_stat) + 
  stat_function(fun = dchisq, args = list(df = 9-1), color = "blue")

# permutation p-value
null %>%
  summarize(mean(stat > chi_obs_stat)) %>%
  pull()
## [1] 0.006
# approximation p-value
pchisq(chi_obs_stat, df=9-1, lower.tail=FALSE)
##   X-squared 
## 0.006836367
iowa <- readr::read_csv("./RInputFiles/iowa.csv")
## Parsed with column specification:
## cols(
##   office = col_character(),
##   candidate = col_character(),
##   party = col_character(),
##   county = col_character(),
##   votes = col_integer()
## )
glimpse(iowa)
## Observations: 1,386
## Variables: 5
## $ office    <chr> "President/Vice President", "President/Vice Presiden...
## $ candidate <chr> "Evan McMullin / Nathan Johnson", "Under Votes", "Ga...
## $ party     <chr> "Nominated by Petition", NA, "Libertarian", NA, "Soc...
## $ county    <chr> "Adair", "Adair", "Adair", "Adair", "Adair", "Adair"...
## $ votes     <int> 10, 32, 127, 5, 0, 10, 1133, 14, 3, 2461, 3848, 38, ...
# Get R+D county totals
iowa2 <- iowa %>%
  filter(candidate == "Hillary Clinton / Tim Kaine" | candidate == "Donald Trump / Mike Pence") %>%
  group_by(county) %>%
  summarize(dem_rep_votes = sum(votes, na.rm = TRUE)) 

# Add first_digit
iowa3 <- iowa2 %>%
  mutate(first_digit = get_first(dem_rep_votes))

# Construct bar plot
iowa3 %>%
  ggplot(aes(x=first_digit)) + 
  geom_bar()

# Tabulate the counts of each digit
tab <- iowa3 %>%
  select(first_digit) %>%
  table()

# Compute observed stat
chi_obs_stat <- chisq.test(tab, p = p_benford)$stat
## Warning in chisq.test(tab, p = p_benford): Chi-squared approximation may be
## incorrect
# Form null distribution
null <- iowa3 %>%
  specify(response = first_digit) %>%
  hypothesize(null = "point", p = p_benford) %>%
  generate(reps = 500, type = "simulate") %>%
  calculate(stat = "Chisq")
## Warning in stats::chisq.test(table(first_digit), p = attr(x, "params")):
## Chi-squared approximation may be incorrect
## Warning in stats::chisq.test(table(first_digit), p = attr(x, "params")):
## Chi-squared approximation may be incorrect

## Warning in stats::chisq.test(table(first_digit), p = attr(x, "params")):
## Chi-squared approximation may be incorrect

## Warning in stats::chisq.test(table(first_digit), p = attr(x, "params")):
## Chi-squared approximation may be incorrect

## Warning in stats::chisq.test(table(first_digit), p = attr(x, "params")):
## Chi-squared approximation may be incorrect

## Warning in stats::chisq.test(table(first_digit), p = attr(x, "params")):
## Chi-squared approximation may be incorrect

## Warning in stats::chisq.test(table(first_digit), p = attr(x, "params")):
## Chi-squared approximation may be incorrect

## Warning in stats::chisq.test(table(first_digit), p = attr(x, "params")):
## Chi-squared approximation may be incorrect

## Warning in stats::chisq.test(table(first_digit), p = attr(x, "params")):
## Chi-squared approximation may be incorrect

## Warning in stats::chisq.test(table(first_digit), p = attr(x, "params")):
## Chi-squared approximation may be incorrect

## Warning in stats::chisq.test(table(first_digit), p = attr(x, "params")):
## Chi-squared approximation may be incorrect

## Warning in stats::chisq.test(table(first_digit), p = attr(x, "params")):
## Chi-squared approximation may be incorrect

## Warning in stats::chisq.test(table(first_digit), p = attr(x, "params")):
## Chi-squared approximation may be incorrect

## Warning in stats::chisq.test(table(first_digit), p = attr(x, "params")):
## Chi-squared approximation may be incorrect

## Warning in stats::chisq.test(table(first_digit), p = attr(x, "params")):
## Chi-squared approximation may be incorrect

## Warning in stats::chisq.test(table(first_digit), p = attr(x, "params")):
## Chi-squared approximation may be incorrect

## Warning in stats::chisq.test(table(first_digit), p = attr(x, "params")):
## Chi-squared approximation may be incorrect

## Warning in stats::chisq.test(table(first_digit), p = attr(x, "params")):
## Chi-squared approximation may be incorrect

## Warning in stats::chisq.test(table(first_digit), p = attr(x, "params")):
## Chi-squared approximation may be incorrect

## Warning in stats::chisq.test(table(first_digit), p = attr(x, "params")):
## Chi-squared approximation may be incorrect

## Warning in stats::chisq.test(table(first_digit), p = attr(x, "params")):
## Chi-squared approximation may be incorrect

## Warning in stats::chisq.test(table(first_digit), p = attr(x, "params")):
## Chi-squared approximation may be incorrect

## Warning in stats::chisq.test(table(first_digit), p = attr(x, "params")):
## Chi-squared approximation may be incorrect

## Warning in stats::chisq.test(table(first_digit), p = attr(x, "params")):
## Chi-squared approximation may be incorrect

## Warning in stats::chisq.test(table(first_digit), p = attr(x, "params")):
## Chi-squared approximation may be incorrect

## Warning in stats::chisq.test(table(first_digit), p = attr(x, "params")):
## Chi-squared approximation may be incorrect

## Warning in stats::chisq.test(table(first_digit), p = attr(x, "params")):
## Chi-squared approximation may be incorrect

## Warning in stats::chisq.test(table(first_digit), p = attr(x, "params")):
## Chi-squared approximation may be incorrect

## Warning in stats::chisq.test(table(first_digit), p = attr(x, "params")):
## Chi-squared approximation may be incorrect

## Warning in stats::chisq.test(table(first_digit), p = attr(x, "params")):
## Chi-squared approximation may be incorrect

## Warning in stats::chisq.test(table(first_digit), p = attr(x, "params")):
## Chi-squared approximation may be incorrect

## Warning in stats::chisq.test(table(first_digit), p = attr(x, "params")):
## Chi-squared approximation may be incorrect

## Warning in stats::chisq.test(table(first_digit), p = attr(x, "params")):
## Chi-squared approximation may be incorrect

## Warning in stats::chisq.test(table(first_digit), p = attr(x, "params")):
## Chi-squared approximation may be incorrect

## Warning in stats::chisq.test(table(first_digit), p = attr(x, "params")):
## Chi-squared approximation may be incorrect

## Warning in stats::chisq.test(table(first_digit), p = attr(x, "params")):
## Chi-squared approximation may be incorrect

## Warning in stats::chisq.test(table(first_digit), p = attr(x, "params")):
## Chi-squared approximation may be incorrect

## Warning in stats::chisq.test(table(first_digit), p = attr(x, "params")):
## Chi-squared approximation may be incorrect

## Warning in stats::chisq.test(table(first_digit), p = attr(x, "params")):
## Chi-squared approximation may be incorrect

## Warning in stats::chisq.test(table(first_digit), p = attr(x, "params")):
## Chi-squared approximation may be incorrect

## Warning in stats::chisq.test(table(first_digit), p = attr(x, "params")):
## Chi-squared approximation may be incorrect

## Warning in stats::chisq.test(table(first_digit), p = attr(x, "params")):
## Chi-squared approximation may be incorrect

## Warning in stats::chisq.test(table(first_digit), p = attr(x, "params")):
## Chi-squared approximation may be incorrect

## Warning in stats::chisq.test(table(first_digit), p = attr(x, "params")):
## Chi-squared approximation may be incorrect

## Warning in stats::chisq.test(table(first_digit), p = attr(x, "params")):
## Chi-squared approximation may be incorrect

## Warning in stats::chisq.test(table(first_digit), p = attr(x, "params")):
## Chi-squared approximation may be incorrect

## Warning in stats::chisq.test(table(first_digit), p = attr(x, "params")):
## Chi-squared approximation may be incorrect

## Warning in stats::chisq.test(table(first_digit), p = attr(x, "params")):
## Chi-squared approximation may be incorrect

## Warning in stats::chisq.test(table(first_digit), p = attr(x, "params")):
## Chi-squared approximation may be incorrect

## Warning in stats::chisq.test(table(first_digit), p = attr(x, "params")):
## Chi-squared approximation may be incorrect

## Warning in stats::chisq.test(table(first_digit), p = attr(x, "params")):
## Chi-squared approximation may be incorrect

## Warning in stats::chisq.test(table(first_digit), p = attr(x, "params")):
## Chi-squared approximation may be incorrect

## Warning in stats::chisq.test(table(first_digit), p = attr(x, "params")):
## Chi-squared approximation may be incorrect

## Warning in stats::chisq.test(table(first_digit), p = attr(x, "params")):
## Chi-squared approximation may be incorrect

## Warning in stats::chisq.test(table(first_digit), p = attr(x, "params")):
## Chi-squared approximation may be incorrect

## Warning in stats::chisq.test(table(first_digit), p = attr(x, "params")):
## Chi-squared approximation may be incorrect

## Warning in stats::chisq.test(table(first_digit), p = attr(x, "params")):
## Chi-squared approximation may be incorrect

## Warning in stats::chisq.test(table(first_digit), p = attr(x, "params")):
## Chi-squared approximation may be incorrect

## Warning in stats::chisq.test(table(first_digit), p = attr(x, "params")):
## Chi-squared approximation may be incorrect

## Warning in stats::chisq.test(table(first_digit), p = attr(x, "params")):
## Chi-squared approximation may be incorrect

## Warning in stats::chisq.test(table(first_digit), p = attr(x, "params")):
## Chi-squared approximation may be incorrect

## Warning in stats::chisq.test(table(first_digit), p = attr(x, "params")):
## Chi-squared approximation may be incorrect

## Warning in stats::chisq.test(table(first_digit), p = attr(x, "params")):
## Chi-squared approximation may be incorrect

## Warning in stats::chisq.test(table(first_digit), p = attr(x, "params")):
## Chi-squared approximation may be incorrect

## Warning in stats::chisq.test(table(first_digit), p = attr(x, "params")):
## Chi-squared approximation may be incorrect

## Warning in stats::chisq.test(table(first_digit), p = attr(x, "params")):
## Chi-squared approximation may be incorrect

## Warning in stats::chisq.test(table(first_digit), p = attr(x, "params")):
## Chi-squared approximation may be incorrect

## Warning in stats::chisq.test(table(first_digit), p = attr(x, "params")):
## Chi-squared approximation may be incorrect

## Warning in stats::chisq.test(table(first_digit), p = attr(x, "params")):
## Chi-squared approximation may be incorrect

## Warning in stats::chisq.test(table(first_digit), p = attr(x, "params")):
## Chi-squared approximation may be incorrect

## Warning in stats::chisq.test(table(first_digit), p = attr(x, "params")):
## Chi-squared approximation may be incorrect

## Warning in stats::chisq.test(table(first_digit), p = attr(x, "params")):
## Chi-squared approximation may be incorrect

## Warning in stats::chisq.test(table(first_digit), p = attr(x, "params")):
## Chi-squared approximation may be incorrect

## Warning in stats::chisq.test(table(first_digit), p = attr(x, "params")):
## Chi-squared approximation may be incorrect

## Warning in stats::chisq.test(table(first_digit), p = attr(x, "params")):
## Chi-squared approximation may be incorrect

## Warning in stats::chisq.test(table(first_digit), p = attr(x, "params")):
## Chi-squared approximation may be incorrect

## Warning in stats::chisq.test(table(first_digit), p = attr(x, "params")):
## Chi-squared approximation may be incorrect

## Warning in stats::chisq.test(table(first_digit), p = attr(x, "params")):
## Chi-squared approximation may be incorrect

## Warning in stats::chisq.test(table(first_digit), p = attr(x, "params")):
## Chi-squared approximation may be incorrect

## Warning in stats::chisq.test(table(first_digit), p = attr(x, "params")):
## Chi-squared approximation may be incorrect

## Warning in stats::chisq.test(table(first_digit), p = attr(x, "params")):
## Chi-squared approximation may be incorrect

## Warning in stats::chisq.test(table(first_digit), p = attr(x, "params")):
## Chi-squared approximation may be incorrect

## Warning in stats::chisq.test(table(first_digit), p = attr(x, "params")):
## Chi-squared approximation may be incorrect

## Warning in stats::chisq.test(table(first_digit), p = attr(x, "params")):
## Chi-squared approximation may be incorrect

## Warning in stats::chisq.test(table(first_digit), p = attr(x, "params")):
## Chi-squared approximation may be incorrect

## Warning in stats::chisq.test(table(first_digit), p = attr(x, "params")):
## Chi-squared approximation may be incorrect

## Warning in stats::chisq.test(table(first_digit), p = attr(x, "params")):
## Chi-squared approximation may be incorrect

## Warning in stats::chisq.test(table(first_digit), p = attr(x, "params")):
## Chi-squared approximation may be incorrect

## Warning in stats::chisq.test(table(first_digit), p = attr(x, "params")):
## Chi-squared approximation may be incorrect

## Warning in stats::chisq.test(table(first_digit), p = attr(x, "params")):
## Chi-squared approximation may be incorrect

## Warning in stats::chisq.test(table(first_digit), p = attr(x, "params")):
## Chi-squared approximation may be incorrect

## Warning in stats::chisq.test(table(first_digit), p = attr(x, "params")):
## Chi-squared approximation may be incorrect

## Warning in stats::chisq.test(table(first_digit), p = attr(x, "params")):
## Chi-squared approximation may be incorrect

## Warning in stats::chisq.test(table(first_digit), p = attr(x, "params")):
## Chi-squared approximation may be incorrect

## Warning in stats::chisq.test(table(first_digit), p = attr(x, "params")):
## Chi-squared approximation may be incorrect

## Warning in stats::chisq.test(table(first_digit), p = attr(x, "params")):
## Chi-squared approximation may be incorrect

## Warning in stats::chisq.test(table(first_digit), p = attr(x, "params")):
## Chi-squared approximation may be incorrect

## Warning in stats::chisq.test(table(first_digit), p = attr(x, "params")):
## Chi-squared approximation may be incorrect

## Warning in stats::chisq.test(table(first_digit), p = attr(x, "params")):
## Chi-squared approximation may be incorrect

## Warning in stats::chisq.test(table(first_digit), p = attr(x, "params")):
## Chi-squared approximation may be incorrect

## Warning in stats::chisq.test(table(first_digit), p = attr(x, "params")):
## Chi-squared approximation may be incorrect

## Warning in stats::chisq.test(table(first_digit), p = attr(x, "params")):
## Chi-squared approximation may be incorrect

## Warning in stats::chisq.test(table(first_digit), p = attr(x, "params")):
## Chi-squared approximation may be incorrect

## Warning in stats::chisq.test(table(first_digit), p = attr(x, "params")):
## Chi-squared approximation may be incorrect

## Warning in stats::chisq.test(table(first_digit), p = attr(x, "params")):
## Chi-squared approximation may be incorrect

## Warning in stats::chisq.test(table(first_digit), p = attr(x, "params")):
## Chi-squared approximation may be incorrect

## Warning in stats::chisq.test(table(first_digit), p = attr(x, "params")):
## Chi-squared approximation may be incorrect

## Warning in stats::chisq.test(table(first_digit), p = attr(x, "params")):
## Chi-squared approximation may be incorrect

## Warning in stats::chisq.test(table(first_digit), p = attr(x, "params")):
## Chi-squared approximation may be incorrect

## Warning in stats::chisq.test(table(first_digit), p = attr(x, "params")):
## Chi-squared approximation may be incorrect

## Warning in stats::chisq.test(table(first_digit), p = attr(x, "params")):
## Chi-squared approximation may be incorrect

## Warning in stats::chisq.test(table(first_digit), p = attr(x, "params")):
## Chi-squared approximation may be incorrect

## Warning in stats::chisq.test(table(first_digit), p = attr(x, "params")):
## Chi-squared approximation may be incorrect

## Warning in stats::chisq.test(table(first_digit), p = attr(x, "params")):
## Chi-squared approximation may be incorrect

## Warning in stats::chisq.test(table(first_digit), p = attr(x, "params")):
## Chi-squared approximation may be incorrect

## Warning in stats::chisq.test(table(first_digit), p = attr(x, "params")):
## Chi-squared approximation may be incorrect

## Warning in stats::chisq.test(table(first_digit), p = attr(x, "params")):
## Chi-squared approximation may be incorrect

## Warning in stats::chisq.test(table(first_digit), p = attr(x, "params")):
## Chi-squared approximation may be incorrect

## Warning in stats::chisq.test(table(first_digit), p = attr(x, "params")):
## Chi-squared approximation may be incorrect

## Warning in stats::chisq.test(table(first_digit), p = attr(x, "params")):
## Chi-squared approximation may be incorrect

## Warning in stats::chisq.test(table(first_digit), p = attr(x, "params")):
## Chi-squared approximation may be incorrect

## Warning in stats::chisq.test(table(first_digit), p = attr(x, "params")):
## Chi-squared approximation may be incorrect

## Warning in stats::chisq.test(table(first_digit), p = attr(x, "params")):
## Chi-squared approximation may be incorrect

## Warning in stats::chisq.test(table(first_digit), p = attr(x, "params")):
## Chi-squared approximation may be incorrect

## Warning in stats::chisq.test(table(first_digit), p = attr(x, "params")):
## Chi-squared approximation may be incorrect

## Warning in stats::chisq.test(table(first_digit), p = attr(x, "params")):
## Chi-squared approximation may be incorrect

## Warning in stats::chisq.test(table(first_digit), p = attr(x, "params")):
## Chi-squared approximation may be incorrect

## Warning in stats::chisq.test(table(first_digit), p = attr(x, "params")):
## Chi-squared approximation may be incorrect

## Warning in stats::chisq.test(table(first_digit), p = attr(x, "params")):
## Chi-squared approximation may be incorrect

## Warning in stats::chisq.test(table(first_digit), p = attr(x, "params")):
## Chi-squared approximation may be incorrect

## Warning in stats::chisq.test(table(first_digit), p = attr(x, "params")):
## Chi-squared approximation may be incorrect

## Warning in stats::chisq.test(table(first_digit), p = attr(x, "params")):
## Chi-squared approximation may be incorrect

## Warning in stats::chisq.test(table(first_digit), p = attr(x, "params")):
## Chi-squared approximation may be incorrect

## Warning in stats::chisq.test(table(first_digit), p = attr(x, "params")):
## Chi-squared approximation may be incorrect

## Warning in stats::chisq.test(table(first_digit), p = attr(x, "params")):
## Chi-squared approximation may be incorrect

## Warning in stats::chisq.test(table(first_digit), p = attr(x, "params")):
## Chi-squared approximation may be incorrect

## Warning in stats::chisq.test(table(first_digit), p = attr(x, "params")):
## Chi-squared approximation may be incorrect

## Warning in stats::chisq.test(table(first_digit), p = attr(x, "params")):
## Chi-squared approximation may be incorrect

## Warning in stats::chisq.test(table(first_digit), p = attr(x, "params")):
## Chi-squared approximation may be incorrect

## Warning in stats::chisq.test(table(first_digit), p = attr(x, "params")):
## Chi-squared approximation may be incorrect

## Warning in stats::chisq.test(table(first_digit), p = attr(x, "params")):
## Chi-squared approximation may be incorrect

## Warning in stats::chisq.test(table(first_digit), p = attr(x, "params")):
## Chi-squared approximation may be incorrect

## Warning in stats::chisq.test(table(first_digit), p = attr(x, "params")):
## Chi-squared approximation may be incorrect

## Warning in stats::chisq.test(table(first_digit), p = attr(x, "params")):
## Chi-squared approximation may be incorrect

## Warning in stats::chisq.test(table(first_digit), p = attr(x, "params")):
## Chi-squared approximation may be incorrect

## Warning in stats::chisq.test(table(first_digit), p = attr(x, "params")):
## Chi-squared approximation may be incorrect

## Warning in stats::chisq.test(table(first_digit), p = attr(x, "params")):
## Chi-squared approximation may be incorrect

## Warning in stats::chisq.test(table(first_digit), p = attr(x, "params")):
## Chi-squared approximation may be incorrect

## Warning in stats::chisq.test(table(first_digit), p = attr(x, "params")):
## Chi-squared approximation may be incorrect

## Warning in stats::chisq.test(table(first_digit), p = attr(x, "params")):
## Chi-squared approximation may be incorrect

## Warning in stats::chisq.test(table(first_digit), p = attr(x, "params")):
## Chi-squared approximation may be incorrect

## Warning in stats::chisq.test(table(first_digit), p = attr(x, "params")):
## Chi-squared approximation may be incorrect

## Warning in stats::chisq.test(table(first_digit), p = attr(x, "params")):
## Chi-squared approximation may be incorrect

## Warning in stats::chisq.test(table(first_digit), p = attr(x, "params")):
## Chi-squared approximation may be incorrect

## Warning in stats::chisq.test(table(first_digit), p = attr(x, "params")):
## Chi-squared approximation may be incorrect

## Warning in stats::chisq.test(table(first_digit), p = attr(x, "params")):
## Chi-squared approximation may be incorrect

## Warning in stats::chisq.test(table(first_digit), p = attr(x, "params")):
## Chi-squared approximation may be incorrect

## Warning in stats::chisq.test(table(first_digit), p = attr(x, "params")):
## Chi-squared approximation may be incorrect

## Warning in stats::chisq.test(table(first_digit), p = attr(x, "params")):
## Chi-squared approximation may be incorrect

## Warning in stats::chisq.test(table(first_digit), p = attr(x, "params")):
## Chi-squared approximation may be incorrect

## Warning in stats::chisq.test(table(first_digit), p = attr(x, "params")):
## Chi-squared approximation may be incorrect

## Warning in stats::chisq.test(table(first_digit), p = attr(x, "params")):
## Chi-squared approximation may be incorrect

## Warning in stats::chisq.test(table(first_digit), p = attr(x, "params")):
## Chi-squared approximation may be incorrect

## Warning in stats::chisq.test(table(first_digit), p = attr(x, "params")):
## Chi-squared approximation may be incorrect

## Warning in stats::chisq.test(table(first_digit), p = attr(x, "params")):
## Chi-squared approximation may be incorrect

## Warning in stats::chisq.test(table(first_digit), p = attr(x, "params")):
## Chi-squared approximation may be incorrect

## Warning in stats::chisq.test(table(first_digit), p = attr(x, "params")):
## Chi-squared approximation may be incorrect

## Warning in stats::chisq.test(table(first_digit), p = attr(x, "params")):
## Chi-squared approximation may be incorrect

## Warning in stats::chisq.test(table(first_digit), p = attr(x, "params")):
## Chi-squared approximation may be incorrect

## Warning in stats::chisq.test(table(first_digit), p = attr(x, "params")):
## Chi-squared approximation may be incorrect

## Warning in stats::chisq.test(table(first_digit), p = attr(x, "params")):
## Chi-squared approximation may be incorrect

## Warning in stats::chisq.test(table(first_digit), p = attr(x, "params")):
## Chi-squared approximation may be incorrect

## Warning in stats::chisq.test(table(first_digit), p = attr(x, "params")):
## Chi-squared approximation may be incorrect

## Warning in stats::chisq.test(table(first_digit), p = attr(x, "params")):
## Chi-squared approximation may be incorrect

## Warning in stats::chisq.test(table(first_digit), p = attr(x, "params")):
## Chi-squared approximation may be incorrect

## Warning in stats::chisq.test(table(first_digit), p = attr(x, "params")):
## Chi-squared approximation may be incorrect

## Warning in stats::chisq.test(table(first_digit), p = attr(x, "params")):
## Chi-squared approximation may be incorrect

## Warning in stats::chisq.test(table(first_digit), p = attr(x, "params")):
## Chi-squared approximation may be incorrect

## Warning in stats::chisq.test(table(first_digit), p = attr(x, "params")):
## Chi-squared approximation may be incorrect

## Warning in stats::chisq.test(table(first_digit), p = attr(x, "params")):
## Chi-squared approximation may be incorrect

## Warning in stats::chisq.test(table(first_digit), p = attr(x, "params")):
## Chi-squared approximation may be incorrect

## Warning in stats::chisq.test(table(first_digit), p = attr(x, "params")):
## Chi-squared approximation may be incorrect

## Warning in stats::chisq.test(table(first_digit), p = attr(x, "params")):
## Chi-squared approximation may be incorrect

## Warning in stats::chisq.test(table(first_digit), p = attr(x, "params")):
## Chi-squared approximation may be incorrect

## Warning in stats::chisq.test(table(first_digit), p = attr(x, "params")):
## Chi-squared approximation may be incorrect

## Warning in stats::chisq.test(table(first_digit), p = attr(x, "params")):
## Chi-squared approximation may be incorrect

## Warning in stats::chisq.test(table(first_digit), p = attr(x, "params")):
## Chi-squared approximation may be incorrect

## Warning in stats::chisq.test(table(first_digit), p = attr(x, "params")):
## Chi-squared approximation may be incorrect

## Warning in stats::chisq.test(table(first_digit), p = attr(x, "params")):
## Chi-squared approximation may be incorrect

## Warning in stats::chisq.test(table(first_digit), p = attr(x, "params")):
## Chi-squared approximation may be incorrect

## Warning in stats::chisq.test(table(first_digit), p = attr(x, "params")):
## Chi-squared approximation may be incorrect

## Warning in stats::chisq.test(table(first_digit), p = attr(x, "params")):
## Chi-squared approximation may be incorrect

## Warning in stats::chisq.test(table(first_digit), p = attr(x, "params")):
## Chi-squared approximation may be incorrect

## Warning in stats::chisq.test(table(first_digit), p = attr(x, "params")):
## Chi-squared approximation may be incorrect

## Warning in stats::chisq.test(table(first_digit), p = attr(x, "params")):
## Chi-squared approximation may be incorrect

## Warning in stats::chisq.test(table(first_digit), p = attr(x, "params")):
## Chi-squared approximation may be incorrect

## Warning in stats::chisq.test(table(first_digit), p = attr(x, "params")):
## Chi-squared approximation may be incorrect

## Warning in stats::chisq.test(table(first_digit), p = attr(x, "params")):
## Chi-squared approximation may be incorrect

## Warning in stats::chisq.test(table(first_digit), p = attr(x, "params")):
## Chi-squared approximation may be incorrect

## Warning in stats::chisq.test(table(first_digit), p = attr(x, "params")):
## Chi-squared approximation may be incorrect

## Warning in stats::chisq.test(table(first_digit), p = attr(x, "params")):
## Chi-squared approximation may be incorrect

## Warning in stats::chisq.test(table(first_digit), p = attr(x, "params")):
## Chi-squared approximation may be incorrect

## Warning in stats::chisq.test(table(first_digit), p = attr(x, "params")):
## Chi-squared approximation may be incorrect

## Warning in stats::chisq.test(table(first_digit), p = attr(x, "params")):
## Chi-squared approximation may be incorrect

## Warning in stats::chisq.test(table(first_digit), p = attr(x, "params")):
## Chi-squared approximation may be incorrect

## Warning in stats::chisq.test(table(first_digit), p = attr(x, "params")):
## Chi-squared approximation may be incorrect

## Warning in stats::chisq.test(table(first_digit), p = attr(x, "params")):
## Chi-squared approximation may be incorrect

## Warning in stats::chisq.test(table(first_digit), p = attr(x, "params")):
## Chi-squared approximation may be incorrect

## Warning in stats::chisq.test(table(first_digit), p = attr(x, "params")):
## Chi-squared approximation may be incorrect

## Warning in stats::chisq.test(table(first_digit), p = attr(x, "params")):
## Chi-squared approximation may be incorrect

## Warning in stats::chisq.test(table(first_digit), p = attr(x, "params")):
## Chi-squared approximation may be incorrect

## Warning in stats::chisq.test(table(first_digit), p = attr(x, "params")):
## Chi-squared approximation may be incorrect

## Warning in stats::chisq.test(table(first_digit), p = attr(x, "params")):
## Chi-squared approximation may be incorrect

## Warning in stats::chisq.test(table(first_digit), p = attr(x, "params")):
## Chi-squared approximation may be incorrect

## Warning in stats::chisq.test(table(first_digit), p = attr(x, "params")):
## Chi-squared approximation may be incorrect

## Warning in stats::chisq.test(table(first_digit), p = attr(x, "params")):
## Chi-squared approximation may be incorrect

## Warning in stats::chisq.test(table(first_digit), p = attr(x, "params")):
## Chi-squared approximation may be incorrect

## Warning in stats::chisq.test(table(first_digit), p = attr(x, "params")):
## Chi-squared approximation may be incorrect

## Warning in stats::chisq.test(table(first_digit), p = attr(x, "params")):
## Chi-squared approximation may be incorrect

## Warning in stats::chisq.test(table(first_digit), p = attr(x, "params")):
## Chi-squared approximation may be incorrect

## Warning in stats::chisq.test(table(first_digit), p = attr(x, "params")):
## Chi-squared approximation may be incorrect

## Warning in stats::chisq.test(table(first_digit), p = attr(x, "params")):
## Chi-squared approximation may be incorrect

## Warning in stats::chisq.test(table(first_digit), p = attr(x, "params")):
## Chi-squared approximation may be incorrect

## Warning in stats::chisq.test(table(first_digit), p = attr(x, "params")):
## Chi-squared approximation may be incorrect

## Warning in stats::chisq.test(table(first_digit), p = attr(x, "params")):
## Chi-squared approximation may be incorrect

## Warning in stats::chisq.test(table(first_digit), p = attr(x, "params")):
## Chi-squared approximation may be incorrect

## Warning in stats::chisq.test(table(first_digit), p = attr(x, "params")):
## Chi-squared approximation may be incorrect

## Warning in stats::chisq.test(table(first_digit), p = attr(x, "params")):
## Chi-squared approximation may be incorrect

## Warning in stats::chisq.test(table(first_digit), p = attr(x, "params")):
## Chi-squared approximation may be incorrect

## Warning in stats::chisq.test(table(first_digit), p = attr(x, "params")):
## Chi-squared approximation may be incorrect

## Warning in stats::chisq.test(table(first_digit), p = attr(x, "params")):
## Chi-squared approximation may be incorrect

## Warning in stats::chisq.test(table(first_digit), p = attr(x, "params")):
## Chi-squared approximation may be incorrect

## Warning in stats::chisq.test(table(first_digit), p = attr(x, "params")):
## Chi-squared approximation may be incorrect

## Warning in stats::chisq.test(table(first_digit), p = attr(x, "params")):
## Chi-squared approximation may be incorrect

## Warning in stats::chisq.test(table(first_digit), p = attr(x, "params")):
## Chi-squared approximation may be incorrect

## Warning in stats::chisq.test(table(first_digit), p = attr(x, "params")):
## Chi-squared approximation may be incorrect

## Warning in stats::chisq.test(table(first_digit), p = attr(x, "params")):
## Chi-squared approximation may be incorrect

## Warning in stats::chisq.test(table(first_digit), p = attr(x, "params")):
## Chi-squared approximation may be incorrect

## Warning in stats::chisq.test(table(first_digit), p = attr(x, "params")):
## Chi-squared approximation may be incorrect

## Warning in stats::chisq.test(table(first_digit), p = attr(x, "params")):
## Chi-squared approximation may be incorrect

## Warning in stats::chisq.test(table(first_digit), p = attr(x, "params")):
## Chi-squared approximation may be incorrect

## Warning in stats::chisq.test(table(first_digit), p = attr(x, "params")):
## Chi-squared approximation may be incorrect

## Warning in stats::chisq.test(table(first_digit), p = attr(x, "params")):
## Chi-squared approximation may be incorrect

## Warning in stats::chisq.test(table(first_digit), p = attr(x, "params")):
## Chi-squared approximation may be incorrect

## Warning in stats::chisq.test(table(first_digit), p = attr(x, "params")):
## Chi-squared approximation may be incorrect

## Warning in stats::chisq.test(table(first_digit), p = attr(x, "params")):
## Chi-squared approximation may be incorrect

## Warning in stats::chisq.test(table(first_digit), p = attr(x, "params")):
## Chi-squared approximation may be incorrect

## Warning in stats::chisq.test(table(first_digit), p = attr(x, "params")):
## Chi-squared approximation may be incorrect

## Warning in stats::chisq.test(table(first_digit), p = attr(x, "params")):
## Chi-squared approximation may be incorrect

## Warning in stats::chisq.test(table(first_digit), p = attr(x, "params")):
## Chi-squared approximation may be incorrect

## Warning in stats::chisq.test(table(first_digit), p = attr(x, "params")):
## Chi-squared approximation may be incorrect

## Warning in stats::chisq.test(table(first_digit), p = attr(x, "params")):
## Chi-squared approximation may be incorrect

## Warning in stats::chisq.test(table(first_digit), p = attr(x, "params")):
## Chi-squared approximation may be incorrect

## Warning in stats::chisq.test(table(first_digit), p = attr(x, "params")):
## Chi-squared approximation may be incorrect

## Warning in stats::chisq.test(table(first_digit), p = attr(x, "params")):
## Chi-squared approximation may be incorrect

## Warning in stats::chisq.test(table(first_digit), p = attr(x, "params")):
## Chi-squared approximation may be incorrect

## Warning in stats::chisq.test(table(first_digit), p = attr(x, "params")):
## Chi-squared approximation may be incorrect

## Warning in stats::chisq.test(table(first_digit), p = attr(x, "params")):
## Chi-squared approximation may be incorrect

## Warning in stats::chisq.test(table(first_digit), p = attr(x, "params")):
## Chi-squared approximation may be incorrect

## Warning in stats::chisq.test(table(first_digit), p = attr(x, "params")):
## Chi-squared approximation may be incorrect

## Warning in stats::chisq.test(table(first_digit), p = attr(x, "params")):
## Chi-squared approximation may be incorrect

## Warning in stats::chisq.test(table(first_digit), p = attr(x, "params")):
## Chi-squared approximation may be incorrect

## Warning in stats::chisq.test(table(first_digit), p = attr(x, "params")):
## Chi-squared approximation may be incorrect

## Warning in stats::chisq.test(table(first_digit), p = attr(x, "params")):
## Chi-squared approximation may be incorrect

## Warning in stats::chisq.test(table(first_digit), p = attr(x, "params")):
## Chi-squared approximation may be incorrect

## Warning in stats::chisq.test(table(first_digit), p = attr(x, "params")):
## Chi-squared approximation may be incorrect

## Warning in stats::chisq.test(table(first_digit), p = attr(x, "params")):
## Chi-squared approximation may be incorrect

## Warning in stats::chisq.test(table(first_digit), p = attr(x, "params")):
## Chi-squared approximation may be incorrect

## Warning in stats::chisq.test(table(first_digit), p = attr(x, "params")):
## Chi-squared approximation may be incorrect

## Warning in stats::chisq.test(table(first_digit), p = attr(x, "params")):
## Chi-squared approximation may be incorrect

## Warning in stats::chisq.test(table(first_digit), p = attr(x, "params")):
## Chi-squared approximation may be incorrect

## Warning in stats::chisq.test(table(first_digit), p = attr(x, "params")):
## Chi-squared approximation may be incorrect

## Warning in stats::chisq.test(table(first_digit), p = attr(x, "params")):
## Chi-squared approximation may be incorrect

## Warning in stats::chisq.test(table(first_digit), p = attr(x, "params")):
## Chi-squared approximation may be incorrect

## Warning in stats::chisq.test(table(first_digit), p = attr(x, "params")):
## Chi-squared approximation may be incorrect

## Warning in stats::chisq.test(table(first_digit), p = attr(x, "params")):
## Chi-squared approximation may be incorrect

## Warning in stats::chisq.test(table(first_digit), p = attr(x, "params")):
## Chi-squared approximation may be incorrect

## Warning in stats::chisq.test(table(first_digit), p = attr(x, "params")):
## Chi-squared approximation may be incorrect

## Warning in stats::chisq.test(table(first_digit), p = attr(x, "params")):
## Chi-squared approximation may be incorrect

## Warning in stats::chisq.test(table(first_digit), p = attr(x, "params")):
## Chi-squared approximation may be incorrect

## Warning in stats::chisq.test(table(first_digit), p = attr(x, "params")):
## Chi-squared approximation may be incorrect

## Warning in stats::chisq.test(table(first_digit), p = attr(x, "params")):
## Chi-squared approximation may be incorrect

## Warning in stats::chisq.test(table(first_digit), p = attr(x, "params")):
## Chi-squared approximation may be incorrect

## Warning in stats::chisq.test(table(first_digit), p = attr(x, "params")):
## Chi-squared approximation may be incorrect

## Warning in stats::chisq.test(table(first_digit), p = attr(x, "params")):
## Chi-squared approximation may be incorrect

## Warning in stats::chisq.test(table(first_digit), p = attr(x, "params")):
## Chi-squared approximation may be incorrect

## Warning in stats::chisq.test(table(first_digit), p = attr(x, "params")):
## Chi-squared approximation may be incorrect

## Warning in stats::chisq.test(table(first_digit), p = attr(x, "params")):
## Chi-squared approximation may be incorrect

## Warning in stats::chisq.test(table(first_digit), p = attr(x, "params")):
## Chi-squared approximation may be incorrect

## Warning in stats::chisq.test(table(first_digit), p = attr(x, "params")):
## Chi-squared approximation may be incorrect

## Warning in stats::chisq.test(table(first_digit), p = attr(x, "params")):
## Chi-squared approximation may be incorrect

## Warning in stats::chisq.test(table(first_digit), p = attr(x, "params")):
## Chi-squared approximation may be incorrect

## Warning in stats::chisq.test(table(first_digit), p = attr(x, "params")):
## Chi-squared approximation may be incorrect

## Warning in stats::chisq.test(table(first_digit), p = attr(x, "params")):
## Chi-squared approximation may be incorrect

## Warning in stats::chisq.test(table(first_digit), p = attr(x, "params")):
## Chi-squared approximation may be incorrect

## Warning in stats::chisq.test(table(first_digit), p = attr(x, "params")):
## Chi-squared approximation may be incorrect

## Warning in stats::chisq.test(table(first_digit), p = attr(x, "params")):
## Chi-squared approximation may be incorrect

## Warning in stats::chisq.test(table(first_digit), p = attr(x, "params")):
## Chi-squared approximation may be incorrect

## Warning in stats::chisq.test(table(first_digit), p = attr(x, "params")):
## Chi-squared approximation may be incorrect

## Warning in stats::chisq.test(table(first_digit), p = attr(x, "params")):
## Chi-squared approximation may be incorrect

## Warning in stats::chisq.test(table(first_digit), p = attr(x, "params")):
## Chi-squared approximation may be incorrect

## Warning in stats::chisq.test(table(first_digit), p = attr(x, "params")):
## Chi-squared approximation may be incorrect

## Warning in stats::chisq.test(table(first_digit), p = attr(x, "params")):
## Chi-squared approximation may be incorrect

## Warning in stats::chisq.test(table(first_digit), p = attr(x, "params")):
## Chi-squared approximation may be incorrect

## Warning in stats::chisq.test(table(first_digit), p = attr(x, "params")):
## Chi-squared approximation may be incorrect

## Warning in stats::chisq.test(table(first_digit), p = attr(x, "params")):
## Chi-squared approximation may be incorrect

## Warning in stats::chisq.test(table(first_digit), p = attr(x, "params")):
## Chi-squared approximation may be incorrect

## Warning in stats::chisq.test(table(first_digit), p = attr(x, "params")):
## Chi-squared approximation may be incorrect

## Warning in stats::chisq.test(table(first_digit), p = attr(x, "params")):
## Chi-squared approximation may be incorrect

## Warning in stats::chisq.test(table(first_digit), p = attr(x, "params")):
## Chi-squared approximation may be incorrect

## Warning in stats::chisq.test(table(first_digit), p = attr(x, "params")):
## Chi-squared approximation may be incorrect

## Warning in stats::chisq.test(table(first_digit), p = attr(x, "params")):
## Chi-squared approximation may be incorrect

## Warning in stats::chisq.test(table(first_digit), p = attr(x, "params")):
## Chi-squared approximation may be incorrect

## Warning in stats::chisq.test(table(first_digit), p = attr(x, "params")):
## Chi-squared approximation may be incorrect

## Warning in stats::chisq.test(table(first_digit), p = attr(x, "params")):
## Chi-squared approximation may be incorrect

## Warning in stats::chisq.test(table(first_digit), p = attr(x, "params")):
## Chi-squared approximation may be incorrect

## Warning in stats::chisq.test(table(first_digit), p = attr(x, "params")):
## Chi-squared approximation may be incorrect

## Warning in stats::chisq.test(table(first_digit), p = attr(x, "params")):
## Chi-squared approximation may be incorrect

## Warning in stats::chisq.test(table(first_digit), p = attr(x, "params")):
## Chi-squared approximation may be incorrect

## Warning in stats::chisq.test(table(first_digit), p = attr(x, "params")):
## Chi-squared approximation may be incorrect

## Warning in stats::chisq.test(table(first_digit), p = attr(x, "params")):
## Chi-squared approximation may be incorrect

## Warning in stats::chisq.test(table(first_digit), p = attr(x, "params")):
## Chi-squared approximation may be incorrect

## Warning in stats::chisq.test(table(first_digit), p = attr(x, "params")):
## Chi-squared approximation may be incorrect

## Warning in stats::chisq.test(table(first_digit), p = attr(x, "params")):
## Chi-squared approximation may be incorrect

## Warning in stats::chisq.test(table(first_digit), p = attr(x, "params")):
## Chi-squared approximation may be incorrect

## Warning in stats::chisq.test(table(first_digit), p = attr(x, "params")):
## Chi-squared approximation may be incorrect

## Warning in stats::chisq.test(table(first_digit), p = attr(x, "params")):
## Chi-squared approximation may be incorrect

## Warning in stats::chisq.test(table(first_digit), p = attr(x, "params")):
## Chi-squared approximation may be incorrect

## Warning in stats::chisq.test(table(first_digit), p = attr(x, "params")):
## Chi-squared approximation may be incorrect

## Warning in stats::chisq.test(table(first_digit), p = attr(x, "params")):
## Chi-squared approximation may be incorrect

## Warning in stats::chisq.test(table(first_digit), p = attr(x, "params")):
## Chi-squared approximation may be incorrect

## Warning in stats::chisq.test(table(first_digit), p = attr(x, "params")):
## Chi-squared approximation may be incorrect

## Warning in stats::chisq.test(table(first_digit), p = attr(x, "params")):
## Chi-squared approximation may be incorrect

## Warning in stats::chisq.test(table(first_digit), p = attr(x, "params")):
## Chi-squared approximation may be incorrect

## Warning in stats::chisq.test(table(first_digit), p = attr(x, "params")):
## Chi-squared approximation may be incorrect

## Warning in stats::chisq.test(table(first_digit), p = attr(x, "params")):
## Chi-squared approximation may be incorrect

## Warning in stats::chisq.test(table(first_digit), p = attr(x, "params")):
## Chi-squared approximation may be incorrect

## Warning in stats::chisq.test(table(first_digit), p = attr(x, "params")):
## Chi-squared approximation may be incorrect

## Warning in stats::chisq.test(table(first_digit), p = attr(x, "params")):
## Chi-squared approximation may be incorrect

## Warning in stats::chisq.test(table(first_digit), p = attr(x, "params")):
## Chi-squared approximation may be incorrect

## Warning in stats::chisq.test(table(first_digit), p = attr(x, "params")):
## Chi-squared approximation may be incorrect

## Warning in stats::chisq.test(table(first_digit), p = attr(x, "params")):
## Chi-squared approximation may be incorrect

## Warning in stats::chisq.test(table(first_digit), p = attr(x, "params")):
## Chi-squared approximation may be incorrect

## Warning in stats::chisq.test(table(first_digit), p = attr(x, "params")):
## Chi-squared approximation may be incorrect

## Warning in stats::chisq.test(table(first_digit), p = attr(x, "params")):
## Chi-squared approximation may be incorrect

## Warning in stats::chisq.test(table(first_digit), p = attr(x, "params")):
## Chi-squared approximation may be incorrect

## Warning in stats::chisq.test(table(first_digit), p = attr(x, "params")):
## Chi-squared approximation may be incorrect

## Warning in stats::chisq.test(table(first_digit), p = attr(x, "params")):
## Chi-squared approximation may be incorrect

## Warning in stats::chisq.test(table(first_digit), p = attr(x, "params")):
## Chi-squared approximation may be incorrect

## Warning in stats::chisq.test(table(first_digit), p = attr(x, "params")):
## Chi-squared approximation may be incorrect

## Warning in stats::chisq.test(table(first_digit), p = attr(x, "params")):
## Chi-squared approximation may be incorrect

## Warning in stats::chisq.test(table(first_digit), p = attr(x, "params")):
## Chi-squared approximation may be incorrect

## Warning in stats::chisq.test(table(first_digit), p = attr(x, "params")):
## Chi-squared approximation may be incorrect

## Warning in stats::chisq.test(table(first_digit), p = attr(x, "params")):
## Chi-squared approximation may be incorrect

## Warning in stats::chisq.test(table(first_digit), p = attr(x, "params")):
## Chi-squared approximation may be incorrect

## Warning in stats::chisq.test(table(first_digit), p = attr(x, "params")):
## Chi-squared approximation may be incorrect

## Warning in stats::chisq.test(table(first_digit), p = attr(x, "params")):
## Chi-squared approximation may be incorrect

## Warning in stats::chisq.test(table(first_digit), p = attr(x, "params")):
## Chi-squared approximation may be incorrect

## Warning in stats::chisq.test(table(first_digit), p = attr(x, "params")):
## Chi-squared approximation may be incorrect

## Warning in stats::chisq.test(table(first_digit), p = attr(x, "params")):
## Chi-squared approximation may be incorrect

## Warning in stats::chisq.test(table(first_digit), p = attr(x, "params")):
## Chi-squared approximation may be incorrect

## Warning in stats::chisq.test(table(first_digit), p = attr(x, "params")):
## Chi-squared approximation may be incorrect

## Warning in stats::chisq.test(table(first_digit), p = attr(x, "params")):
## Chi-squared approximation may be incorrect

## Warning in stats::chisq.test(table(first_digit), p = attr(x, "params")):
## Chi-squared approximation may be incorrect

## Warning in stats::chisq.test(table(first_digit), p = attr(x, "params")):
## Chi-squared approximation may be incorrect

## Warning in stats::chisq.test(table(first_digit), p = attr(x, "params")):
## Chi-squared approximation may be incorrect

## Warning in stats::chisq.test(table(first_digit), p = attr(x, "params")):
## Chi-squared approximation may be incorrect

## Warning in stats::chisq.test(table(first_digit), p = attr(x, "params")):
## Chi-squared approximation may be incorrect

## Warning in stats::chisq.test(table(first_digit), p = attr(x, "params")):
## Chi-squared approximation may be incorrect

## Warning in stats::chisq.test(table(first_digit), p = attr(x, "params")):
## Chi-squared approximation may be incorrect

## Warning in stats::chisq.test(table(first_digit), p = attr(x, "params")):
## Chi-squared approximation may be incorrect

## Warning in stats::chisq.test(table(first_digit), p = attr(x, "params")):
## Chi-squared approximation may be incorrect

## Warning in stats::chisq.test(table(first_digit), p = attr(x, "params")):
## Chi-squared approximation may be incorrect

## Warning in stats::chisq.test(table(first_digit), p = attr(x, "params")):
## Chi-squared approximation may be incorrect

## Warning in stats::chisq.test(table(first_digit), p = attr(x, "params")):
## Chi-squared approximation may be incorrect

## Warning in stats::chisq.test(table(first_digit), p = attr(x, "params")):
## Chi-squared approximation may be incorrect

## Warning in stats::chisq.test(table(first_digit), p = attr(x, "params")):
## Chi-squared approximation may be incorrect

## Warning in stats::chisq.test(table(first_digit), p = attr(x, "params")):
## Chi-squared approximation may be incorrect

## Warning in stats::chisq.test(table(first_digit), p = attr(x, "params")):
## Chi-squared approximation may be incorrect

## Warning in stats::chisq.test(table(first_digit), p = attr(x, "params")):
## Chi-squared approximation may be incorrect

## Warning in stats::chisq.test(table(first_digit), p = attr(x, "params")):
## Chi-squared approximation may be incorrect

## Warning in stats::chisq.test(table(first_digit), p = attr(x, "params")):
## Chi-squared approximation may be incorrect

## Warning in stats::chisq.test(table(first_digit), p = attr(x, "params")):
## Chi-squared approximation may be incorrect

## Warning in stats::chisq.test(table(first_digit), p = attr(x, "params")):
## Chi-squared approximation may be incorrect

## Warning in stats::chisq.test(table(first_digit), p = attr(x, "params")):
## Chi-squared approximation may be incorrect

## Warning in stats::chisq.test(table(first_digit), p = attr(x, "params")):
## Chi-squared approximation may be incorrect

## Warning in stats::chisq.test(table(first_digit), p = attr(x, "params")):
## Chi-squared approximation may be incorrect

## Warning in stats::chisq.test(table(first_digit), p = attr(x, "params")):
## Chi-squared approximation may be incorrect

## Warning in stats::chisq.test(table(first_digit), p = attr(x, "params")):
## Chi-squared approximation may be incorrect

## Warning in stats::chisq.test(table(first_digit), p = attr(x, "params")):
## Chi-squared approximation may be incorrect

## Warning in stats::chisq.test(table(first_digit), p = attr(x, "params")):
## Chi-squared approximation may be incorrect

## Warning in stats::chisq.test(table(first_digit), p = attr(x, "params")):
## Chi-squared approximation may be incorrect

## Warning in stats::chisq.test(table(first_digit), p = attr(x, "params")):
## Chi-squared approximation may be incorrect

## Warning in stats::chisq.test(table(first_digit), p = attr(x, "params")):
## Chi-squared approximation may be incorrect

## Warning in stats::chisq.test(table(first_digit), p = attr(x, "params")):
## Chi-squared approximation may be incorrect

## Warning in stats::chisq.test(table(first_digit), p = attr(x, "params")):
## Chi-squared approximation may be incorrect

## Warning in stats::chisq.test(table(first_digit), p = attr(x, "params")):
## Chi-squared approximation may be incorrect

## Warning in stats::chisq.test(table(first_digit), p = attr(x, "params")):
## Chi-squared approximation may be incorrect

## Warning in stats::chisq.test(table(first_digit), p = attr(x, "params")):
## Chi-squared approximation may be incorrect

## Warning in stats::chisq.test(table(first_digit), p = attr(x, "params")):
## Chi-squared approximation may be incorrect

## Warning in stats::chisq.test(table(first_digit), p = attr(x, "params")):
## Chi-squared approximation may be incorrect

## Warning in stats::chisq.test(table(first_digit), p = attr(x, "params")):
## Chi-squared approximation may be incorrect

## Warning in stats::chisq.test(table(first_digit), p = attr(x, "params")):
## Chi-squared approximation may be incorrect

## Warning in stats::chisq.test(table(first_digit), p = attr(x, "params")):
## Chi-squared approximation may be incorrect

## Warning in stats::chisq.test(table(first_digit), p = attr(x, "params")):
## Chi-squared approximation may be incorrect

## Warning in stats::chisq.test(table(first_digit), p = attr(x, "params")):
## Chi-squared approximation may be incorrect

## Warning in stats::chisq.test(table(first_digit), p = attr(x, "params")):
## Chi-squared approximation may be incorrect

## Warning in stats::chisq.test(table(first_digit), p = attr(x, "params")):
## Chi-squared approximation may be incorrect

## Warning in stats::chisq.test(table(first_digit), p = attr(x, "params")):
## Chi-squared approximation may be incorrect

## Warning in stats::chisq.test(table(first_digit), p = attr(x, "params")):
## Chi-squared approximation may be incorrect

## Warning in stats::chisq.test(table(first_digit), p = attr(x, "params")):
## Chi-squared approximation may be incorrect

## Warning in stats::chisq.test(table(first_digit), p = attr(x, "params")):
## Chi-squared approximation may be incorrect

## Warning in stats::chisq.test(table(first_digit), p = attr(x, "params")):
## Chi-squared approximation may be incorrect

## Warning in stats::chisq.test(table(first_digit), p = attr(x, "params")):
## Chi-squared approximation may be incorrect

## Warning in stats::chisq.test(table(first_digit), p = attr(x, "params")):
## Chi-squared approximation may be incorrect

## Warning in stats::chisq.test(table(first_digit), p = attr(x, "params")):
## Chi-squared approximation may be incorrect

## Warning in stats::chisq.test(table(first_digit), p = attr(x, "params")):
## Chi-squared approximation may be incorrect

## Warning in stats::chisq.test(table(first_digit), p = attr(x, "params")):
## Chi-squared approximation may be incorrect

## Warning in stats::chisq.test(table(first_digit), p = attr(x, "params")):
## Chi-squared approximation may be incorrect

## Warning in stats::chisq.test(table(first_digit), p = attr(x, "params")):
## Chi-squared approximation may be incorrect

## Warning in stats::chisq.test(table(first_digit), p = attr(x, "params")):
## Chi-squared approximation may be incorrect

## Warning in stats::chisq.test(table(first_digit), p = attr(x, "params")):
## Chi-squared approximation may be incorrect

## Warning in stats::chisq.test(table(first_digit), p = attr(x, "params")):
## Chi-squared approximation may be incorrect

## Warning in stats::chisq.test(table(first_digit), p = attr(x, "params")):
## Chi-squared approximation may be incorrect

## Warning in stats::chisq.test(table(first_digit), p = attr(x, "params")):
## Chi-squared approximation may be incorrect

## Warning in stats::chisq.test(table(first_digit), p = attr(x, "params")):
## Chi-squared approximation may be incorrect

## Warning in stats::chisq.test(table(first_digit), p = attr(x, "params")):
## Chi-squared approximation may be incorrect

## Warning in stats::chisq.test(table(first_digit), p = attr(x, "params")):
## Chi-squared approximation may be incorrect

## Warning in stats::chisq.test(table(first_digit), p = attr(x, "params")):
## Chi-squared approximation may be incorrect

## Warning in stats::chisq.test(table(first_digit), p = attr(x, "params")):
## Chi-squared approximation may be incorrect

## Warning in stats::chisq.test(table(first_digit), p = attr(x, "params")):
## Chi-squared approximation may be incorrect

## Warning in stats::chisq.test(table(first_digit), p = attr(x, "params")):
## Chi-squared approximation may be incorrect

## Warning in stats::chisq.test(table(first_digit), p = attr(x, "params")):
## Chi-squared approximation may be incorrect

## Warning in stats::chisq.test(table(first_digit), p = attr(x, "params")):
## Chi-squared approximation may be incorrect

## Warning in stats::chisq.test(table(first_digit), p = attr(x, "params")):
## Chi-squared approximation may be incorrect

## Warning in stats::chisq.test(table(first_digit), p = attr(x, "params")):
## Chi-squared approximation may be incorrect

## Warning in stats::chisq.test(table(first_digit), p = attr(x, "params")):
## Chi-squared approximation may be incorrect

## Warning in stats::chisq.test(table(first_digit), p = attr(x, "params")):
## Chi-squared approximation may be incorrect

## Warning in stats::chisq.test(table(first_digit), p = attr(x, "params")):
## Chi-squared approximation may be incorrect

## Warning in stats::chisq.test(table(first_digit), p = attr(x, "params")):
## Chi-squared approximation may be incorrect

## Warning in stats::chisq.test(table(first_digit), p = attr(x, "params")):
## Chi-squared approximation may be incorrect

## Warning in stats::chisq.test(table(first_digit), p = attr(x, "params")):
## Chi-squared approximation may be incorrect

## Warning in stats::chisq.test(table(first_digit), p = attr(x, "params")):
## Chi-squared approximation may be incorrect

## Warning in stats::chisq.test(table(first_digit), p = attr(x, "params")):
## Chi-squared approximation may be incorrect

## Warning in stats::chisq.test(table(first_digit), p = attr(x, "params")):
## Chi-squared approximation may be incorrect

## Warning in stats::chisq.test(table(first_digit), p = attr(x, "params")):
## Chi-squared approximation may be incorrect

## Warning in stats::chisq.test(table(first_digit), p = attr(x, "params")):
## Chi-squared approximation may be incorrect

## Warning in stats::chisq.test(table(first_digit), p = attr(x, "params")):
## Chi-squared approximation may be incorrect

## Warning in stats::chisq.test(table(first_digit), p = attr(x, "params")):
## Chi-squared approximation may be incorrect

## Warning in stats::chisq.test(table(first_digit), p = attr(x, "params")):
## Chi-squared approximation may be incorrect

## Warning in stats::chisq.test(table(first_digit), p = attr(x, "params")):
## Chi-squared approximation may be incorrect

## Warning in stats::chisq.test(table(first_digit), p = attr(x, "params")):
## Chi-squared approximation may be incorrect

## Warning in stats::chisq.test(table(first_digit), p = attr(x, "params")):
## Chi-squared approximation may be incorrect

## Warning in stats::chisq.test(table(first_digit), p = attr(x, "params")):
## Chi-squared approximation may be incorrect

## Warning in stats::chisq.test(table(first_digit), p = attr(x, "params")):
## Chi-squared approximation may be incorrect

## Warning in stats::chisq.test(table(first_digit), p = attr(x, "params")):
## Chi-squared approximation may be incorrect

## Warning in stats::chisq.test(table(first_digit), p = attr(x, "params")):
## Chi-squared approximation may be incorrect

## Warning in stats::chisq.test(table(first_digit), p = attr(x, "params")):
## Chi-squared approximation may be incorrect

## Warning in stats::chisq.test(table(first_digit), p = attr(x, "params")):
## Chi-squared approximation may be incorrect

## Warning in stats::chisq.test(table(first_digit), p = attr(x, "params")):
## Chi-squared approximation may be incorrect

## Warning in stats::chisq.test(table(first_digit), p = attr(x, "params")):
## Chi-squared approximation may be incorrect

## Warning in stats::chisq.test(table(first_digit), p = attr(x, "params")):
## Chi-squared approximation may be incorrect

## Warning in stats::chisq.test(table(first_digit), p = attr(x, "params")):
## Chi-squared approximation may be incorrect

## Warning in stats::chisq.test(table(first_digit), p = attr(x, "params")):
## Chi-squared approximation may be incorrect

## Warning in stats::chisq.test(table(first_digit), p = attr(x, "params")):
## Chi-squared approximation may be incorrect

## Warning in stats::chisq.test(table(first_digit), p = attr(x, "params")):
## Chi-squared approximation may be incorrect

## Warning in stats::chisq.test(table(first_digit), p = attr(x, "params")):
## Chi-squared approximation may be incorrect

## Warning in stats::chisq.test(table(first_digit), p = attr(x, "params")):
## Chi-squared approximation may be incorrect

## Warning in stats::chisq.test(table(first_digit), p = attr(x, "params")):
## Chi-squared approximation may be incorrect

## Warning in stats::chisq.test(table(first_digit), p = attr(x, "params")):
## Chi-squared approximation may be incorrect

## Warning in stats::chisq.test(table(first_digit), p = attr(x, "params")):
## Chi-squared approximation may be incorrect

## Warning in stats::chisq.test(table(first_digit), p = attr(x, "params")):
## Chi-squared approximation may be incorrect

## Warning in stats::chisq.test(table(first_digit), p = attr(x, "params")):
## Chi-squared approximation may be incorrect

## Warning in stats::chisq.test(table(first_digit), p = attr(x, "params")):
## Chi-squared approximation may be incorrect

## Warning in stats::chisq.test(table(first_digit), p = attr(x, "params")):
## Chi-squared approximation may be incorrect

## Warning in stats::chisq.test(table(first_digit), p = attr(x, "params")):
## Chi-squared approximation may be incorrect

## Warning in stats::chisq.test(table(first_digit), p = attr(x, "params")):
## Chi-squared approximation may be incorrect

## Warning in stats::chisq.test(table(first_digit), p = attr(x, "params")):
## Chi-squared approximation may be incorrect

## Warning in stats::chisq.test(table(first_digit), p = attr(x, "params")):
## Chi-squared approximation may be incorrect

## Warning in stats::chisq.test(table(first_digit), p = attr(x, "params")):
## Chi-squared approximation may be incorrect

## Warning in stats::chisq.test(table(first_digit), p = attr(x, "params")):
## Chi-squared approximation may be incorrect

## Warning in stats::chisq.test(table(first_digit), p = attr(x, "params")):
## Chi-squared approximation may be incorrect

## Warning in stats::chisq.test(table(first_digit), p = attr(x, "params")):
## Chi-squared approximation may be incorrect

## Warning in stats::chisq.test(table(first_digit), p = attr(x, "params")):
## Chi-squared approximation may be incorrect

## Warning in stats::chisq.test(table(first_digit), p = attr(x, "params")):
## Chi-squared approximation may be incorrect

## Warning in stats::chisq.test(table(first_digit), p = attr(x, "params")):
## Chi-squared approximation may be incorrect

## Warning in stats::chisq.test(table(first_digit), p = attr(x, "params")):
## Chi-squared approximation may be incorrect

## Warning in stats::chisq.test(table(first_digit), p = attr(x, "params")):
## Chi-squared approximation may be incorrect

## Warning in stats::chisq.test(table(first_digit), p = attr(x, "params")):
## Chi-squared approximation may be incorrect

## Warning in stats::chisq.test(table(first_digit), p = attr(x, "params")):
## Chi-squared approximation may be incorrect

## Warning in stats::chisq.test(table(first_digit), p = attr(x, "params")):
## Chi-squared approximation may be incorrect

## Warning in stats::chisq.test(table(first_digit), p = attr(x, "params")):
## Chi-squared approximation may be incorrect

## Warning in stats::chisq.test(table(first_digit), p = attr(x, "params")):
## Chi-squared approximation may be incorrect

## Warning in stats::chisq.test(table(first_digit), p = attr(x, "params")):
## Chi-squared approximation may be incorrect

## Warning in stats::chisq.test(table(first_digit), p = attr(x, "params")):
## Chi-squared approximation may be incorrect

## Warning in stats::chisq.test(table(first_digit), p = attr(x, "params")):
## Chi-squared approximation may be incorrect

## Warning in stats::chisq.test(table(first_digit), p = attr(x, "params")):
## Chi-squared approximation may be incorrect

## Warning in stats::chisq.test(table(first_digit), p = attr(x, "params")):
## Chi-squared approximation may be incorrect

## Warning in stats::chisq.test(table(first_digit), p = attr(x, "params")):
## Chi-squared approximation may be incorrect

## Warning in stats::chisq.test(table(first_digit), p = attr(x, "params")):
## Chi-squared approximation may be incorrect
# Visualize null
ggplot(null, aes(x = stat)) +
  geom_density() +
  geom_vline(xintercept = chi_obs_stat)


Building Dashboards with flexdashboard

Chapter 1 - Dashboard Layouts

Introduction:

  • Dashboards are a collection of components in a single display - graphs, text, tables, widgets, etc.
  • The flexdashboard is an R package that allows for using R Markdown to create a dashboard
    • Can include all the power of R
    • Can combine with Shiny for reactive elements
  • Course will include capabilities of flexdashboard, decision as to whether to incorporate Shiny, and potential extensions

Anatomy of flexdashboard:

  • Within R Markdown, the header controls the type of document created during knitting
    • output: flexdashboard::flex_dashboard (will create the flesdashboard output)
  • The flexdashboard is made up of charts, with each chart denoted by ### ChartName
    • The succeeding lines can then be R code, similar to other R Markdown processes
  • By default, all of the charts will stack in a single column, though multiple columns can also be declared
    • Columns are created using 14+ dashes, with everything underneath contained in that column
    • Can give a specific name and specify options for each of the columns
  • Can start in Rstudio using File - New File - R Markdown - From Template - flexdashboard
  • Course data will include bicycle sharing data from San Francisco

Layout basics:

  • Columns can be of variable width by using data-width= such that they add up to 1000
  • Can create by rows rather than columns using orientation:rows underneath flexdashboard::flex_dashboard:
    • Can use data-height to vary the row heights
    • Can use certical_layout: scroll as an option to allow for scrolling rather than forcing everything on to one page (this is considered poor dashboard design, though)

Advanced layouts:

  • Options for extending the dashboard include tabsets
    • Column {.tabset} - will apply the tabset to every chart in that column
  • Can also extend by using pages, where columns and rows are children of their respective pages
    • Sixteen (16) or more equal signs under a Page title specify a call to the page
    • Can add Page xxx {data-navmenu=yyy} to specify that the page xxx should belong to the navmenu yyy

Example code includes (not added due to need for separate dashboard file):


Chapter 2 - Data Visualization for Dashboards

Graphs:

  • The easiest way to add a graph is to include it as part of a code snippet in flexdashboard
  • Graphs will flex and resize to stay in the container
  • Sometimes, may want to set the figure width and height to match the aspect ratio of the target device as closely as possible
    • {r, fig.width=10, fig.height=5}
    • Downside #1 - trial and error needed
    • Downside #2 - need to adjust every time charts are added
    • Downside #3 - graphs are no longer responsive to user inputs

Web-Friendly Visualizations:

  • Web-friendly packages include plotly, highcharter, dygraphs, rbokeh, ggvis
  • The plotly calls are helpful since they are closely linked to ggplot2
    • library(plotly)
    • ggplotly(my_ggplot) # my_ggplot is a ggplot2 object

htmlwidgets:

  • htmlwidgets are a framework that connects R with Javascript (web-friendly and well-suited to dashboards)
  • The leaflet package allows for adding interactive maps
    • library(leaflet)
    • leaflet() %>% addTiles() %>% addMarkers(lng = data_df\(longitude, lat = data_df\)latitude)
    • leaflet(data_df) %>% addTiles() %>% addMarkers() # leaflet called on a data frame

Example code includes (not added due to need for separate dashboard file):


Chapter 3 - Dashboard Components

Highlighting Single Values:

  • Gauges can be helpful for values in a defined range, such as 0%-100%
    • gauge(value = pct_subscriber_trips, min = 0, max = 100) # basics for creating a gauge include the value, the min, and the max
    • gauge(value = pct_subscriber_trips, min = 0, max = 100, sectors = gaugeSectors( success = c(90, 100), warning = c(70, 89), danger = c(0, 69) ), symbol = ‘%’) # additional features
  • Value boxes can be helpful for values that do not fall in a pre-defined range
    • valueBox(prettyNum(num_trips, big.mark = “,”), caption = “Total Daily Trips”, icon = “fa-bicycle”) # font-awesome bicycles
  • Both gauges and value boxes can be linked
    • valueBox(prettyNum(num_trips, big.mark = ‘,’), caption = ‘Total Daily Trips’, icon = ‘fa-bicycle’, href = ‘#trip-raw-data’) # href makes the caption linked and clickable

Dashboard Tables:

  • The kable function from knitr is one of the easiest ways to create a table - but, not very well tuned to html
    • library(knitr)
    • kable(my_data_df)
  • The DT package is better suited to making responsive tables
    • library(DT)
    • datatable(my_data_df)
    • datatable(my_data_df, rownames = FALSE) # eliminate row numbering
    • datatable(my_data_df, rownames = FALSE, options = list(pageLength = 15)) # most options are set by way of a list; note the contrast to rownames
    • datatable( my_data_df, rownames = FALSE, extensions = ‘Buttons’, options = list( dom = ‘Bfrtip’, buttons = c(‘copy’, ‘csv’, ‘excel’, ‘pdf’, ‘print’) ) ) # buttons for extract

Text for Dashboards:

  • Captions (notes) are a common way to add text to a chart, and are added using a greater than sign with text; there must be an empty line between the end of the chunk and the caption
  • Another way to provide more context is with the storyboard format
    • Presents one chart at a time in a specified order, where the user controls the navigation speed between the charts
    • Good format for content that runs in order
    • Requires storyboard: true in the yaml header in the flexdashboard::flex_dashboard items
    • Within the story, the ### signal the next page of the story, and should have descriptive text
    • Can add commentary using the triple asterisk (***) which needs to be AFTER the R chunk and separated by at least one space
  • Can also mix in storyboard on some pages but not on others (requires leaving this out of the yaml header)
    • Add {.storyboard} to the end of the page description

Example code includes (not added due to need for separate dashboard file):


Chapter 4 - Adding Interactivity with Shiny

Incorporating Shiny into Dashboards:

  • Incorporating Shiny is optional but can mak the dashboards even more interactive
    • Shiny is interactive and lightweight, though at the expense of greater complication and hosting challenges
  • Even after incorporating Shiny, the flexdashboard document is still an interactive R Markdown document
  • runtime:shiny in the yaml header will make the flexdashboard in to a Shiny App

Reactive Dataframe Pattern:

  • Creating a narrow sidebar using
    • Column {data-width=200 .sidebar}
  • Widgets can be use inside of an R chunk, like any other dashboard component
    • sliderInput(“duration_slider”, label=“Select maximum trip duration to display (in minutes):”, min=0, max=120, value=15, step=5, dragRange=TRUE)
    • show_trips_df <- reactive({ trips_df %>% filter(duration_sec <= input$duration_slider * 60) })
    • To call the reactice data frame later, use show_trips_df()
  • Output from the reactive needs to be encloses in the appropriate render*() function
    • renderLeaflet({ show_trips_df() %>% . %>% leaflet() %>% . }) # no need for the output call like there would be in a typical Shiny document
  • Five key steps for the reactive data frame pattern
    • Create a sidebar column
    • Add user inputs to the sidebar - *Input() Shiny widgets
    • Make a data frame that uses the inputs, called later using ()
    • Replace the dataframe in the dashboard component code with the reactive version
    • Wrap with the appropriate rendering function render*()

Customized Inputs for Charts:

  • Can have a reactive component impact everything, as per the example worked through in the previous section
  • May also want to have sliders that only impact a single object
    • Putting these together in the same loaction can cause headaches due to the need to work with layouts
  • Example code to implement includes
    • fillCol(height=600, flex=c(NA, 1), inputPanel(sliderInput(“my_input”, .)), plotOutput(“my_plot”, height=“100%”)) # flex is the flexible height for the components
    • output$my_plot <- renderPlot({ . })
  • Can use a global shortcut
    • Can put all of the charts that are driven by the same slider on to the same page
    • Can put the sidebar as a class with its own page, followed by all the other pages, to have the same sidebar drive all of the pages

Wrap-up:

  • Additional resources available through Rstudio and htmlwidgets.org (information about all html widgets available in R)
    • The highcharter can be helpful - high quality charts with some interactivity
  • Can use shinydashboard for just Shiny if R Markdown and flexdasboard are not needed

Example code includes (not added due to need for separate dashboard file):


Network Analysis in R: Case Studies

Chapter 1 - Exploring Graphs Through Time

Exploring Data Set:

  • Daily snapshots of items purchased together (co-purchases) from Amazon in 2003
    • There is the to and from that will make up the graph, plus associated metadata
    • Desire to look only at a single data, and only the from-to data (assuming a directional graph)
  • Can look at a smaller subset of the graph, for example
    • sg <- induced_subgraph(amzn_g, 1:500)
    • sg <- delete.vertices(sg, degree(sg) == 0)
    • plot(sg, vertex.label = NA, edge.arrow.width = 0, edge.arrow.size = 0, margin = 0, vertex.size = 2)
  • Can count the number of diad (2-connect) and triad (3-connect) in the data
    • null, asymmetric, and mutual are the potential results for diads
    • Three-digit codes are used to reflect the 16 potential triad states - #Bi/#Assym/#Uncon - plus a letter D, U, and C

Exploring Temporal Structure:

  • Dataset has 4 days worth of data - can build from the earliest date to the latest date
  • Can create a list to hold the igraphs at each time period, loop over the times, and then plot them
    • A handful of vertices may be important and interesting across time

Example code includes:

library(igraph)
## 
## Attaching package: 'igraph'
## The following objects are masked from 'package:dplyr':
## 
##     as_data_frame, groups, union
## The following objects are masked from 'package:purrr':
## 
##     compose, simplify
## The following object is masked from 'package:tidyr':
## 
##     crossing
## The following object is masked from 'package:tibble':
## 
##     as_data_frame
## The following objects are masked from 'package:stats':
## 
##     decompose, spectrum
## The following object is masked from 'package:base':
## 
##     union
amzn_g <- read.graph("./RInputFiles/amzn_g.gml", format=c("gml"))
amzn_g
## IGRAPH f83085a DN-- 10245 10754 -- 
## + attr: id (v/n), name (v/c)
## + edges from f83085a (vertex names):
##  [1] 44  ->42   179 ->71   410 ->730  415 ->741  656 ->1267 669 ->672 
##  [7] 672 ->669  689 ->690  689 ->1284 690 ->689  690 ->1284 730 ->410 
## [13] 741 ->909  786 ->1767 802 ->806  806 ->802  856 ->205  857 ->211 
## [19] 867 ->866  868 ->866  909 ->741  911 ->748  921 ->190  1015->151 
## [25] 1016->1015 1047->1049 1049->1047 1204->1491 1267->656  1272->669 
## [31] 1278->152  1282->943  1284->689  1285->1286 1286->1285 1290->1293
## [37] 1293->1290 1293->1606 1294->1295 1295->1294 1312->730  1350->2783
## [43] 1362->156  1366->190  1438->1580 1438->1581 1467->3996 1479->158 
## + ... omitted several edges
# Perform dyad census
dc <- dyad_census(amzn_g)

# Perform triad census
tc <- triad_census(amzn_g)

# Find the edge density
ed <- edge_density(amzn_g)

# Output values
print(dc)
## $mut
## [1] 3199
## 
## $asym
## [1] 4356
## 
## $null
## [1] 52467335
print(tc)
##  [1] 179089386743     44610360     32763436          215         1906
##  [6]          507         1198          457          118            0
## [11]          301          170          119           33          239
## [16]          288
print(ed)
## [1] 0.0001024681
# Calculate transitivity
transitivity(amzn_g)
## [1] 0.3875752
# Calculate reciprocity
amzn_rp <- reciprocity(amzn_g)

# Simulate our outputs
nv <- gorder(amzn_g)
ed <- edge_density(amzn_g)
rep_sim <- rep(NA, 1000)

# Simulate 
for(i in 1:1000){
  rep_sim[i] <- reciprocity(erdos.renyi.game(nv, ed, "gnp", directed = TRUE))
}

# Compare
quantile(rep_sim, c(0.25, .5, 0.975))
##          25%          50%        97.5% 
## 0.0000000000 0.0000000000 0.0005504297
print(amzn_rp)
## [1] 0.5949414
# Get the distribution of in and out degrees
table(degree(amzn_g, mode = "in"))
## 
##    0    1    2    3    4    5    6    7    8    9   11   12   17 
## 2798 5240 1549  424  139   50   20    7    9    5    1    2    1
table(degree(amzn_g, mode = "out"))
## 
##    0    1    2    3    4    5 
## 1899 6350 1635  313   45    3
# Find important products based on the ratio of out to in and look for extremes
imp_prod <- V(amzn_g)[degree(amzn_g, mode = "out") > 3 & degree(amzn_g, mode = "in") < 3]

## Output the vertices
print(imp_prod)
## + 8/10245 vertices, named, from f83085a:
## [1] 1629   4545   6334   20181  62482  64344  155513 221085
ipFrom <- c(1629, 1629, 1629, 1629, 1629, 1629, 1629, 1629, 1629, 1629, 1629, 11163, 11163, 11163, 11163, 11163, 11163, 11163, 11163, 11163, 11163, 11163, 32129, 32129, 32129, 32129, 32129, 32129, 32129, 38131, 38131, 38131, 38131, 38131, 38131, 45282, 45282, 45282, 45282, 52831, 52831, 52831, 52831, 52831, 52831, 52831, 52831, 53591, 53591, 53591, 53591, 53591, 53591, 53591, 53591, 56427, 56427, 56427, 56427, 59706, 59706, 59706, 59706, 59706, 59706, 59706, 59706, 62482, 62482, 62482, 62482, 62482, 62482, 67038, 67038, 67038, 67038, 71192, 71192, 71192, 71192, 71192, 77957, 77957, 77957, 77957, 77957, 77957, 103733, 103733, 103733, 103733, 103733, 117841, 117841, 117841, 117841, 117841, 117841, 117841, 117841, 117841, 117841, 123808, 123808, 123808, 123808, 123808, 123808, 123808, 123808, 123808, 132757, 132757, 132757, 132757, 132757, 132757, 132757, 132757, 132757, 132757, 132757, 132757, 132757, 132757, 144749, 144749, 144749, 144749, 144749, 144749, 144749, 170830, 170830, 170830, 170830, 170830, 170830, 177282, 177282, 177282, 177282, 177282, 177282, 177432, 177432, 177432, 177432, 177432, 177432, 177432, 184526, 184526, 184526, 184526, 184526, 191825, 191825, 191825, 191825, 191825, 215668, 215668, 215668, 221085, 221085, 221085, 221085, 221085, 231604, 231604, 231604, 231604, 231604, 231604, 239014, 239014, 239014, 239014, 239014, 242693, 242693, 242693, 242693, 242693, 257621, 257621, 257621, 257621, 261587, 261587, 261587, 261587, 261587, 261587, 261657, 261657, 261657, 261657, 261657, 261657)
ipTo <- c(190, 1366, 2679, 4023, 1625, 1627, 7529, 1272, 1628, 1630, 1631, 11124, 15360, 20175, 10626, 20970, 10776, 11164, 11166, 5955, 8719, 11164, 23842, 23843, 24115, 15312, 23329, 32127, 80473, 44848, 44849, 44850, 38133, 31084, 33711, 10920, 20178, 20179, 87093, 2134, 2136, 4119, 9995, 36524, 64698, 64700, 52833, 120083, 120085, 120086, 36689, 12340, 113789, 32094, 51015, 1898, 10076, 15800, 61488, 63836, 63837, 63838, 8882, 59708, 59711, 26982, 59708, 69497, 69498, 69499, 69500, 23349, 62480, 58926, 58928, 64118, 52271, 71190, 71380, 75384, 9762, 57876, 43543, 43546, 98488, 77951, 77953, 116842, 103732, 103734, 103735, 103728, 124733, 117842, 117843, 117845, 117842, 117843, 117845, 117842, 117842, 117843, 117845, 59267, 89503, 89506, 156, 190, 105428, 184973, 195785, 195787, 132753, 132754, 132755, 52563, 132755, 132756, 132759, 132762, 126757, 132754, 132755, 132756, 189269, 265886, 43155, 80519, 159667, 82479, 152760, 136747, 65216, 114684, 114686, 114687, 117132, 132667, 81755, 109198, 109199, 109202, 144124, 75023, 216449, 139527, 149146, 152038, 177428, 177430, 177428, 177430, 56930, 61658, 207112, 250755, 250756, 56930, 141148, 191036, 147084, 245110, 175959, 177376, 177377, 88463, 103641, 115111, 165118, 228427, 43553, 76706, 78278, 131353, 75725, 119146, 12615, 15740, 229533, 151325, 237568, 239545, 239546, 239547, 110872, 215593, 60310, 60312, 133398, 44502, 261582, 261590, 261599, 271593, 261584, 261588, 261649, 261653, 261654, 261658, 261662, 105814)
ipGroupFrom <- factor(c('DVD', 'DVD', 'DVD', 'DVD', 'DVD', 'DVD', 'DVD', 'DVD', 'DVD', 'DVD', 'DVD', 'DVD', 'DVD', 'DVD', 'DVD', 'DVD', 'DVD', 'DVD', 'DVD', 'DVD', 'DVD', 'DVD', 'Video', 'Video', 'Video', 'Video', 'Video', 'Video', 'Video', 'DVD', 'DVD', 'DVD', 'DVD', 'DVD', 'DVD', 'DVD', 'DVD', 'DVD', 'DVD', 'Video', 'Video', 'Video', 'Video', 'Video', 'Video', 'Video', 'Video', 'Video', 'Video', 'Video', 'Video', 'Video', 'Video', 'Video', 'Video', 'Video', 'Video', 'Video', 'Video', 'Video', 'Video', 'Video', 'Video', 'Video', 'Video', 'Video', 'Video', 'DVD', 'DVD', 'DVD', 'DVD', 'DVD', 'DVD', 'Video', 'Video', 'Video', 'Video', 'Video', 'Video', 'Video', 'Video', 'Video', 'Video', 'Video', 'Video', 'Video', 'Video', 'Video', 'DVD', 'DVD', 'DVD', 'DVD', 'DVD', 'DVD', 'DVD', 'DVD', 'DVD', 'DVD', 'DVD', 'DVD', 'DVD', 'DVD', 'DVD', 'Video', 'Video', 'Video', 'Video', 'Video', 'Video', 'Video', 'Video', 'Video', 'DVD', 'DVD', 'DVD', 'DVD', 'DVD', 'DVD', 'DVD', 'DVD', 'DVD', 'DVD', 'DVD', 'DVD', 'DVD', 'DVD', 'DVD', 'DVD', 'DVD', 'DVD', 'DVD', 'DVD', 'DVD', 'DVD', 'DVD', 'DVD', 'DVD', 'DVD', 'DVD', 'DVD', 'DVD', 'DVD', 'DVD', 'DVD', 'DVD', 'DVD', 'DVD', 'DVD', 'DVD', 'DVD', 'DVD', 'DVD', 'Video', 'Video', 'Video', 'Video', 'Video', 'Video', 'Video', 'Video', 'Video', 'Video', 'DVD', 'DVD', 'DVD', 'DVD', 'DVD', 'DVD', 'DVD', 'DVD', 'DVD', 'DVD', 'DVD', 'DVD', 'DVD', 'DVD', 'Video', 'Video', 'Video', 'Video', 'Video', 'DVD', 'DVD', 'DVD', 'DVD', 'DVD', 'Video', 'Video', 'Video', 'Video', 'DVD', 'DVD', 'DVD', 'DVD', 'DVD', 'DVD', 'DVD', 'DVD', 'DVD', 'DVD', 'DVD', 'DVD'), levels=c("DVD", "Video"))
ipSRFrom <- c(30, 30, 30, 30, 30, 30, 30, 30, 30, 30, 30, 8, 8, 8, 8, 8, 8, 8, 8, 8, 8, 8, 16, 16, 16, 16, 16, 16, 16, 37, 37, 37, 37, 37, 37, 26, 26, 26, 26, 14, 14, 14, 14, 14, 14, 14, 14, 16, 16, 16, 16, 16, 16, 16, 16, 10, 10, 10, 10, 1, 1, 1, 1, 1, 1, 1, 1, 19, 19, 19, 19, 19, 19, 10, 10, 10, 10, 5, 5, 5, 5, 5, 3, 3, 3, 3, 3, 3, 17, 17, 17, 17, 17, 10, 10, 10, 10, 10, 10, 10, 10, 10, 10, 4, 4, 4, 4, 4, 4, 4, 4, 4, 4, 4, 4, 4, 4, 4, 4, 4, 4, 4, 4, 4, 4, 4, 27, 27, 27, 27, 27, 27, 27, 10, 10, 10, 10, 10, 10, 6, 6, 6, 6, 6, 6, 19, 19, 19, 19, 19, 19, 19, 25, 25, 25, 25, 25, 3, 3, 3, 3, 3, 8, 8, 8, 27, 27, 27, 27, 27, 17, 17, 17, 17, 17, 17, 17, 17, 17, 17, 17, 26, 26, 26, 26, 26, 15, 15, 15, 15, 8, 8, 8, 8, 8, 8, 26, 26, 26, 26, 26, 26)
ipSRTo <- c(5, 2, 18, 20, 12, 6, 8, 14, 16, 4, 18, 20, 3, 6, 14, 5, 3, 3, 4, 3, 13, 3, 5, 9, 18, 17, 8, 2, 8, 9, 16, 9, 24, 11, 25, 6, 9, 3, 21, 1, 5, 2, 24, 2, 6, 6, 8, 18, 7, 4, 20, 6, 22, 13, 10, 19, 4, 22, 7, 7, 9, 7, 11, 21, 12, 17, 21, 5, 7, 2, 1, 26, 6, 14, 2, 17, 4, 13, 12, 6, 8, 13, 4, 7, 1, 7, 9, 15, 19, 6, 20, 0, 19, 14, 18, 11, 14, 18, 11, 14, 14, 18, 11, 16, 1, 5, 3, 5, 6, 22, 5, 20, 10, 29, 9, 22, 9, 12, 10, 9, 12, 29, 9, 12, 13, 6, 23, 6, 18, 10, 18, 6, 9, 11, 8, 8, 19, 12, 10, 9, 8, 14, 1, 7, 10, 13, 18, 6, 6, 4, 6, 4, 4, 22, 5, 8, 4, 4, 13, 11, 3, 4, 21, 22, 8, 18, 1, 6, 5, 5, 4, 8, 6, 12, 6, 3, 13, 8, 10, 1, 1, 22, 12, 18, 19, 5, 18, 31, 8, 13, 10, 14, 25, 4, 19, 17, 5, 21, 3, 1, 19, 10)
ipTRFrom <- c(290, 290, 290, 290, 290, 290, 290, 290, 290, 290, 290, 15, 15, 15, 15, 15, 15, 15, 15, 15, 15, 15, 73, 73, 73, 73, 73, 73, 73, 294, 294, 294, 294, 294, 294, 43, 43, 43, 43, 5, 5, 5, 5, 5, 5, 5, 5, 13, 13, 13, 13, 13, 13, 13, 13, 28, 28, 28, 28, 1, 1, 1, 1, 1, 1, 1, 1, 110, 110, 110, 110, 110, 110, 7, 7, 7, 7, 2, 2, 2, 2, 2, 3, 3, 3, 3, 3, 3, 5, 5, 5, 5, 5, 8, 8, 8, 8, 8, 8, 8, 8, 8, 8, 0, 0, 0, 0, 0, 0, 0, 0, 0, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 25, 25, 25, 25, 25, 25, 25, 2, 2, 2, 2, 2, 2, 12, 12, 12, 12, 12, 12, 111, 111, 111, 111, 111, 111, 111, 294, 294, 294, 294, 294, 0, 0, 0, 0, 0, 0, 0, 0, 243, 243, 243, 243, 243, 43, 43, 43, 43, 43, 43, 15, 15, 15, 15, 15, 483, 483, 483, 483, 483, 1, 1, 1, 1, 12, 12, 12, 12, 12, 12, 2, 2, 2, 2, 2, 2)
ipTRTo <- c(19, 2, 22, 105, 22, 1, 6, 55, 40, 21, 47, 13, 0, 42, 14, 51, 2, 4, 0, 2, 41, 4, 0, 19, 21, 63, 5, 0, 2, 4, 63, 63, 7, 1, 8, 11, 134, 134, 12, 5, 10, 3, 58, 1, 6, 2, 27, 39, 2, 18, 87, 12, 218, 2, 30, 17, 0, 41, 13, 9, 3, 2, 13, 8, 10, 1, 8, 1, 0, 7, 1, 167, 63, 28, 0, 6, 1, 10, 4, 0, 2, 0, 5, 2, 3, 2, 2, 12, 24, 45, 21, 0, 8, 2, 21, 20, 2, 21, 20, 2, 2, 21, 20, 14, 6, 6, 3, 19, 13, 88, 4, 9, 6, 0, 19, 54, 19, 6, 9, 1, 2, 0, 19, 6, 3, 13, 46, 29, 6, 1, 15, 1, 4, 18, 28, 5, 15, 21, 10, 12, 3, 5, 4, 3, 8, 5, 0, 0, 5, 0, 5, 0, 1, 221, 1, 13, 3, 1, 7, 40, 5, 0, 8, 37, 67, 48, 0, 6, 1, 25, 1, 69, 0, 55, 3, 0, 5, 5, 2, 13, 0, 44, 53, 9, 4, 5, 13, 212, 3, 3, 1, 3, 8, 0, 3, 12, 11, 10, 5, 0, 49, 42)
ipTitleFrom <- c(16, 16, 16, 16, 16, 16, 16, 16, 16, 16, 16, 8, 8, 8, 8, 8, 8, 8, 8, 8, 8, 8, 13, 13, 13, 13, 13, 13, 13, 30, 30, 30, 30, 30, 30, 11, 11, 11, 11, 26, 26, 26, 26, 26, 26, 26, 26, 5, 5, 5, 5, 5, 5, 5, 5, 23, 23, 23, 23, 22, 22, 22, 22, 22, 22, 22, 22, 18, 18, 18, 18, 18, 18, 25, 25, 25, 25, 14, 14, 14, 14, 14, 12, 12, 12, 12, 12, 12, 21, 21, 21, 21, 21, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 27, 27, 27, 27, 27, 27, 27, 27, 27, 20, 20, 20, 20, 20, 20, 20, 20, 20, 20, 20, 20, 20, 20, 29, 29, 29, 29, 29, 29, 29, 2, 2, 2, 2, 2, 2, 4, 4, 4, 4, 4, 4, 15, 15, 15, 15, 15, 15, 15, 30, 30, 30, 30, 30, 7, 7, 7, 7, 7, 6, 6, 6, 9, 9, 9, 9, 9, 17, 17, 17, 17, 17, 17, 10, 10, 10, 10, 10, 24, 24, 24, 24, 24, 19, 19, 19, 19, 3, 3, 3, 3, 3, 3, 28, 28, 28, 28, 28, 28)
ipNames <- c('Attraction', 'Barbara The Fair With The Silken Hair', 'Cannibal Apocalypse', "DJ Qbert's Wave Twisters", 'David and Lisa', 'Def Comedy Jam  Vol. 13', 'Detroit Lions 2001 NFL Team Video', 'Donnie McClurkin: Live in London and More', 'El Hombre Sin Sombra (Hollow Man)', 'Gladiator', 'Kindergarten Cop', "Kingsley's Meadow - Wise Guy", "Lady & The Tramp II - Scamp's Adventure", 'Lojong - Transforming the Mind (Boxed Set)', 'Menace II Society', 'Merlin', 'Modern Times', 'Murder by Numbers (Full Screen Edition)', 'Nancy Drew: A Haunting We Will Go', 'Princess Nine - Triple Play (Vol. 3)', 'Secret Agent AKA Danger Man  Set 2', 'Seguire Tus Pasos', 'Selena Remembered', 'Seven (New Line Platinum Series)', 'Sheba  Baby', 'Slaughter', 'The Complete Guide to Medicine Ball Training', 'The Gambler', 'The Getaway', 'The Sum of All Fears')
ip_df <- data.frame(X=1:202, 
                    from=ipFrom, 
                    to=ipTo, 
                    salesrank.from=ipSRFrom, 
                    salesrank.to=ipSRTo, 
                    totalreviews.from=ipTRFrom, 
                    totalreviews.to=ipTRTo, 
                    group.from=ipGroupFrom, 
                    title.from=factor(ipNames[ipTitleFrom], levels=ipNames)
                    )


# Create a new graph
ip_g <- graph_from_data_frame(ip_df %>% select(from, to), directed = TRUE)

# Add color to the edges based on sales rank, blue is higer to lower, red is lower to higher
E(ip_g)$rank_flag <- ifelse(ip_df$salesrank.from <= ip_df$salesrank.to, "blue", "red")

# Plot and add a legend
plot(ip_g, vertex.label = NA, edge.arrow.width = 1, edge.arrow.size = 0, 
    edge.width = 4, margin = 0, vertex.size = 4, 
    edge.color = E(ip_g)$rank_flag, vertex.color = "black" )
legend("bottomleft", legend = c("Lower to Higher Rank", "Higher to Lower Rank"), 
       fill = unique(E(ip_g)$rank_flag ), cex = .7)

# Get a count of out degrees for all vertices
# deg_ct <- lapply(time_graph, function(x){return(degree(x, mode = "out") )})

# Create a dataframe starting by adding the degree count
# deg_df <- data.frame(ct = unlist(deg_ct))

# Add a column with the vertex names 
# deg_df$vertex_name <- names(unlist(deg_ct))

# Add a time stamp 
# deg_df$date <- ymd(rep(d, unlist(lapply(time_graph, function(x){length(V(x))}))))

# See all the vertices that have more than three out degrees
# lapply(time_graph, function(x){return(V(x)[degree(x, mode = "out") > 3])})

# Create a dataframe to plot of three important vertices
# vert_df <- deg_df %>% filter(vertex_name %in% c(1629, 132757, 117841))

# Draw the plot to see how they change through time
# ggplot(vert_df, aes(x = date, y = ct, group = vertex_name, colour = vertex_name)) + geom_path()


# Calculate clustering and reciprocity metrics
# trans <- unlist(lapply(all_graphs, FUN=transitivity))
# rp <- unlist(lapply(all_graphs, FUN=reciprocity))

# Create daaframe for plotting
# met_df <- data.frame("metric" = c(trans, rp))

# Repeat the data
# met_df$date <- rep(ymd(d), 2)

# Sort and then Repeat the metric labels
# met_df$name <- sort(rep(c("clustering", "reciprocity"), 4))

# Plot
# ggplot(met_df, aes(x= date, y= metric, group = name, colour = name)) + geom_path()

Chapter 2 - Talk About R on Twitter

Creating retweet graphs:

  • Data is several days of tweets from #rstats - want to use retweets (starts with RT) to form the network
    • raw_tweets <- read.csv(“datasets/rstatstweets.csv”, stringsAsFactors = F)
    • all_sn <- unique(raw_tweets$screen_name)
    • rt_g <- graph.empty()
    • rt_g <- rt_g + vertices(all_sn)
    • for(i in 1:dim(raw_tweets)[1]){
    • rt_name <- find_rt(raw_tweets$tweet_text[i])
    • if(!is.null(rt_name)){
    •   if(!rt_name %in% all_sn){   
    •       rt_g <- rt_g + vertices(rt_name)  
    •   }  
    • rt_g <- rt_g + edges(c(raw_tweets$screen_name[i], rt_name))
    • }
    • }
    • sum(degree(rt_g) == 0)
    • rt_g <- simplify(rt_g)
    • rt_g <- delete.vertices(rt_g, degree(rt_g) == 0)

Building mentions graphs:

  • Tweets that mention someone can be a reply or a callout
  • There is more complexity than with the retweets, since there is no common format to a mention such as “starts with RT”
    • ment_g <- graph.empty()
    • ment_g <- ment_g + vertices(all_sn)
    • for(i in 1:dim(raw_tweets)[1]) {
    • ment_name <- mention_ext(raw_tweets$tweet_text[i])
    • if(length(ment_name) > 0 ) {
    •   for(j in ment_name) {  
    •       if(!j %in% all_sn) {  
    •           ment_g <- ment_g + vertices(j)  
    •       }  
    •   ment_g <- ment_g + edges(c(raw_tweets$screen_name[i], j))  
    •   }  
    • }
    • }
  • The mentions graph is significantly different, with many more small conversations shown by way of a sub-graph

Finding communities:

  • Communities are natural way to think of graphs - people who talk much more to each other than to the full network
    • ment_edg <- cluster_edge_betweenness(as.undirected(ment_g))
    • ment_eigen <- cluster_leading_eigen(as.undirected(ment_g))
    • ment_lp <- cluster_label_prop(as.undirected(ment_g))
    • length(ment_edg)
    • table(sizes(ment_edg))
  • Can compare similarities within community structures
    • compare(ment_edg, ment_eigen, method = ‘vi’) # “vi” is “variance information”
    • compare(ment_eigen, ment_lp, method = ‘vi’)
    • compare(ment_lp, ment_edg, method = ‘vi’)
  • Can also plot the community structures
    • lrg_eigen <- as.numeric(names(ment_eigen[which(sizes(ment_eigen) >45)]))
    • eigen_sg <- induced.subgraph(ment_g, V(ment_g)[ eigen %in% lrg_eigen])
  • plot(eigen_sg, vertex.label = NA, edge.arrow.width = .8, edge.arrow.size = 0.2,
  • coords = layout_with_fr(ment_sg), margin = 0, vertex.size = 6,
  • vertex.color = as.numeric(as.factor(V(eigen_sg)$eigen))
  • )

Example code includes:

rt_g <- read.graph("./RInputFiles/rt_g.gml", format=c("gml"))
rt_g
## IGRAPH 096a106 DN-- 4118 6052 -- 
## + attr: id (v/n), name (v/c)
## + edges from 096a106 (vertex names):
##  [1] thinkR_fr      ->thw_ch          thinkR_fr      ->omarwagih      
##  [3] KJMillidine    ->Rbloggers       earino         ->d4tagirl       
##  [5] ReecheshJC     ->KirkDBorne      SCMansbridge   ->rstudiotips    
##  [7] DeepSingularity->gp_pulipaka     chrisderv      ->thinkR_fr      
##  [9] chrisderv      ->_ColinFay       chrisderv      ->joshua_ulrich  
## [11] mtrost2        ->romain_francois mtrost2        ->rstudiotips    
## [13] mtrost2        ->RLangTip        dani_sola      ->rstudiotips    
## [15] hrhotz         ->rstudiotips     hrhotz         ->cboettig       
## + ... omitted several edges
# Calculate the number of nodes
gsize(rt_g)
## [1] 6052
# Calculate the number of edges
gorder(rt_g)
## [1] 4118
# Calculate the density
graph.density(rt_g)
## [1] 0.00035697
# Create the plot
plot(rt_g, vertex.label = NA, edge.arrow.width = .8, edge.arrow.size = 0.4, vertex.size = 3)

# Set the default color to black
V(rt_g)$color <- "black"

# Set the color of nodes that were retweeted just once to blue
V(rt_g)[degree(rt_g, mode = "in") == 1]$color <- "blue"

# Set the color of nodes that were retweeters just once to green 
V(rt_g)[degree(rt_g, mode = "out") == 1 ]$color <- "green"

# Plot the network
plot(rt_g, vertex.label = NA, edge.arrow.width = .8, 
    edge.arrow.size = 0.25, 
    vertex.size = 4, vertex.color = V(rt_g)$color)

# Set the default color to black
V(rt_g)$color <- "black"

# Set the color of nodes that were retweeted just once to blue
V(rt_g)[degree(rt_g, mode = "in") == 1 & degree(rt_g, mode = "out") == 0]$color <- "blue"

# Set the color of nodes that were retweeters just once to green 
V(rt_g)[degree(rt_g, mode = "in") == 0 & degree(rt_g, mode = "out") == 1 ]$color <- "green"

# Plot the network
plot(rt_g, vertex.label = NA, edge.arrow.width = .8, 
    edge.arrow.size = 0.25, 
    vertex.size = 4, vertex.color = V(rt_g)$color)

# Calculate betweenness
rt_btw <- igraph::betweenness(rt_g, directed = TRUE)

# Plot histogram
hist(rt_btw, breaks = 2000, xlim = c(0, 1000), main = "Betweenness")

# Calculate eigen centrality
rt_ec <- eigen_centrality(rt_g, directed = TRUE)

# Plot histogram
hist(rt_ec$vector, breaks = 100, xlim = c(0, .2), main = "Eigen Centrality")

# Get top 1% of vertices by eigen centrality
top_ec <- rt_ec$vector[rt_ec$vector > quantile(rt_ec$vector, .99)]

# Get top 1% of vertices by betweenness
top_btw <- rt_btw[rt_btw > quantile(rt_btw, .99)]

# Make a nice data frame to print, with three columns, Rank, Betweenness, and Eigencentrality
most_central <- as.data.frame(cbind(1:length(top_ec), names(sort(top_btw, decreasing = T)), 
                                    names(sort(top_ec, decreasing = T))
                                    )
                              )

# Set column names
colnames(most_central) <- c("Rank", "Betweenness", "Eigen Centrality")

# Print out the data frame
print(most_central)
##    Rank    Betweenness Eigen Centrality
## 1     1  hadleywickham        ma_salmon
## 2     2        kierisi      rstudiotips
## 3     3           drob          opencpu
## 4     4        opencpu     AchimZeileis
## 5     5      ma_salmon        dataandme
## 6     6       rmflight             drob
## 7     7      dataandme        _ColinFay
## 8     8      _ColinFay         rOpenSci
## 9     9     juliasilge        kearneymw
## 10   10      revodavid    RobertMylesMc
## 11   11       rOpenSci        ptrckprry
## 12   12     nj_tierney         rmflight
## 13   13     jonmcalder      thosjleeper
## 14   14      Md_Harris        revodavid
## 15   15   mauro_lepore       juliasilge
## 16   16       sckottie    RLadiesGlobal
## 17   17  RLadiesGlobal    hadleywickham
## 18   18      kearneymw     mauro_lepore
## 19   19      lenkiefer       JennyBryan
## 20   20       NumFOCUS         tudosgar
## 21   21         tjmahr         cboettig
## 22   22  TheRealEveret         antuki13
## 23   23     RLadiesMAD         jasdumas
## 24   24       jasdumas        Rbloggers
## 25   25     JennyBryan         rensa_co
## 26   26       hrbrmstr         timtrice
## 27   27       antuki13         daattali
## 28   28        Voovarb         johnlray
## 29   29       timtrice       joranelias
## 30   30      thinkR_fr     StatsbyLopez
## 31   31     benmarwick          kierisi
## 32   32  RosanaFerrero    joshua_ulrich
## 33   33     clquezadar        thinkR_fr
## 34   34       drsimonj           ledell
## 35   35        zentree           pssGuy
## 36   36      thomasp85     bastistician
## 37   37       OilGains          zentree
## 38   38    yodacomplex   brookLYNevery1
## 39   39  annakrystalli        Md_Harris
## 40   40 davidhughjones         sckottie
## 41   41       noamross       jonmcalder
## 42   42       AlexaLFH       nj_tierney
# Transform rt_btw and add as centrality
V(rt_g)$cent <-  log(rt_btw+2)

# Visualize
plot(rt_g, vertex.label = NA, edge.arrow.width = .2,
     edge.arrow.size = 0.0,
     vertex.size = unlist(V(rt_g)$cent), vertex.color = "red")

# Create subgraph 
rt_sub <-induced_subgraph(rt_g, V(rt_g)[V(rt_g)$cent >= quantile(V(rt_g)$cent, 0.99 )])

# Plot subgraph
plot(rt_sub, vertex.label = NA, edge.arrow.width = .2,
     edge.arrow.size = 0.0,
     vertex.size = unlist(V(rt_sub)$cent), vertex.color = "red")

ment_g <- read.graph("./RInputFiles/ment_g.gml", format=c("gml"))
ment_g
## IGRAPH 1c93213 DN-- 955 975 -- 
## + attr: id (v/n), name (v/c)
## + edges from 1c93213 (vertex names):
##  [1] thinkR_fr  ->ma_salmon       thinkR_fr  ->rstudio        
##  [3] thinkR_fr  ->rforjournalists thinkR_fr  ->aschinchon     
##  [5] thinkR_fr  ->zedsamurai      thinkR_fr  ->ikashnitsky    
##  [7] thinkR_fr  ->NSSDeviations   thinkR_fr  ->BeginTry       
##  [9] chrisderv  ->pbaumgartner    njogukennly->rstudio        
## [11] ma_salmon  ->rOpenSci        ma_salmon  ->RLadiesDC      
## [13] ma_salmon  ->marvin_dpr      ma_salmon  ->drob           
## [15] ma_salmon  ->kearneymw       ma_salmon  ->LucyStats      
## + ... omitted several edges
rt_ratio <- degree(rt_g, mode="in") / (degree(rt_g, mode="out"))
ment_ratio <- degree(ment_g, mode="in") / (degree(ment_g, mode="out"))

# Create a dataframe to plot with ggplot
ratio_df <- data.frame(io_ratio = c(ment_ratio, rt_ratio))
ratio_df["graph_type"] <- c(rep("Mention", length(ment_ratio)), rep("Retweet", length(rt_ratio)) )
ratio_df_filtered <- ratio_df %>% filter(!is.infinite(io_ratio) & io_ratio > 0)

# Plot the graph
ggplot(ratio_df, aes(x = io_ratio , fill= graph_type, group = graph_type)) +
  geom_density(alpha = .5) +
  xlim(0, 10)
## Warning: Removed 891 rows containing non-finite values (stat_density).

# Check the mean and median of each ratio
ratio_df %>% group_by(graph_type) %>% summarise(m_ratio = mean(io_ratio))
## # A tibble: 2 x 2
##   graph_type m_ratio
##   <chr>        <dbl>
## 1 Mention        Inf
## 2 Retweet        Inf
ratio_df %>% group_by(graph_type) %>% summarise(med = median(io_ratio))
## # A tibble: 2 x 2
##   graph_type   med
##   <chr>      <dbl>
## 1 Mention      Inf
## 2 Retweet        0
ratio_df %>% filter(io_ratio != +Inf) %>% group_by(graph_type) %>% summarise(m_ratio = mean(io_ratio))
## # A tibble: 2 x 2
##   graph_type m_ratio
##   <chr>        <dbl>
## 1 Mention      0.294
## 2 Retweet      0.268
ratio_df %>% filter(io_ratio != +Inf) %>% group_by(graph_type) %>% summarise(med = median(io_ratio))
## # A tibble: 2 x 2
##   graph_type   med
##   <chr>      <dbl>
## 1 Mention        0
## 2 Retweet        0
# Plot mention graph 
plot(ment_g, vertex.label = NA, edge.arrow.width = .8,
     edge.arrow.size = 0.2,
     margin = 0,
     vertex.size = 3)

# Find the assortivity of each graph
assortativity_degree(rt_g, directed = TRUE)
## [1] -0.1502212
assortativity_degree(ment_g, directed = TRUE)
## [1] -0.07742748
# Find the reciprocity of each graph
reciprocity(rt_g) 
## [1] 0.005948447
reciprocity(ment_g)
## [1] 0.01846154
# Get size 3 cliques
clq_list <- cliques(ment_g, min = 3, max = 3)
## Warning in cliques(ment_g, min = 3, max = 3): At igraph_cliquer.c:56 :Edge
## directions are ignored for clique calculations
# Convert to a dataframe and filter down to just revodavid cliques
clq_df <- data.frame(matrix(names(unlist(clq_list)), nrow = length(clq_list), byrow = T))
rev_d <- clq_df %>% filter(X1 == "revodavid" | X2 == "revodavid" | X3 == "revodavid") %>% droplevels()

# Create empty graph and build it up
clq_g_empty <- graph.empty()
clq_g <- clq_g_empty + vertices(unique(unlist(rev_d)))
for(i in 1:dim(rev_d)[1]){
  clq_g <- clq_g + edges(rev_d[i, 1], rev_d[i, 2])
  clq_g <- clq_g + edges(rev_d[i, 2], rev_d[i, 3])
  clq_g <- clq_g + edges(rev_d[i, 1], rev_d[i, 3])}

# Trim graph and plot using `simplify()`
clq_g_trimmed <- as.undirected(simplify(clq_g))
plot(clq_g_trimmed)

# Find the communities
rt_fgc <-  cluster_fast_greedy(as.undirected(rt_g))
rt_info <- cluster_infomap(as.undirected(rt_g))
rt_clust <- cluster_louvain(as.undirected(rt_g))

# Compare all the communities
compare(rt_fgc, rt_clust, method = 'vi')
## [1] 2.144703
compare(rt_info, rt_clust, method = 'vi')
## [1] 1.623552
compare(rt_fgc, rt_info, method = 'vi')
## [1] 2.324274
# Test membership of the same users
fgc_test <- which(names(membership(rt_fgc)) %in% c("bass_analytics", "big_data_flow"))
membership(rt_fgc)[fgc_test]
## bass_analytics  big_data_flow 
##              3              3
info_test <- which(names(membership(rt_info)) %in% c("bass_analytics", "big_data_flow"))
membership(rt_info)[info_test]
## bass_analytics  big_data_flow 
##            102             77
# The crossing() function in igraph will return true if a particular edge crosses communities
# This is useful when we want to see certain vertices that are bridges between communities

# Assign cluster membership to each vertex in rt_g using membership()
V(rt_g)$clust <- membership(rt_clust)

# Assign crossing value to each edge
E(rt_g)$cross <- crossing(rt_clust, rt_g)

# Plot the whole graph (this is probably a mess)
plot(rt_g, vertex.label = NA, edge.arrow.width = .8, edge.arrow.size = 0.2, 
     coords = layout_with_fr(rt_g), margin = 0, vertex.size = 3, 
     vertex.color = V(rt_g)$clust, edge.color = E(rt_g)$cross+1)

# Create a subgraph with just a few communities greater than 50 but less than 90 in size
mid_comm <- as.numeric(names(sizes(rt_clust)[sizes(rt_clust) > 50 & sizes(rt_clust) < 90 ]))
rt_sg <- induced.subgraph(rt_g, V(rt_g)[ clust %in% mid_comm ])

# Plot the subgraph
plot(rt_sg, vertex.label = NA, edge.arrow.width = .8, edge.arrow.size = 0.2, 
     coords = layout_with_fr(rt_sg), margin = 0, vertex.size = 3, 
     vertex.color = V(rt_sg)$clust, edge.color = E(rt_sg)$cross+1)


Chapter 3 - Bike Sharing in Chicago

Creating our graph from raw data:

  • Dataset based on Chicago Divvy bike sharing, from freely available data
    • bike_dat <- read.csv(“/Users/edmundhart/wkspace/courses-case-studies-network-r/datasets/bike2_test3.csv”, stringsAsFactors = F)
    • trip_df <- bike_dat %>% group_by(from_station_id, to_station_id) %>% summarise(weights = n())
    • head(trip_df)
    • trip_g <- graph_from_data_frame(trip_df[, 1:2])
    • E(trip_g)\(weight <- trip_df\)weights
    • gsize(trip_g)
    • gorder(trip_g)
  • Can create a sub-graph and run some initial explorations on the network - will notice that there are many loops (trips where to/from is the same)
    • sg <- induced_subgraph(trip_g, 1:12)
    • plot(sg, vertex.label = NA, edge.arrow.width = .8, edge.arrow.size = 0.6, margin = 0, vertex.size = 6, edge.width = log(E(sg)$weight+2))

Compare Graph Distance vs. Geographic Distance:

  • Graphs do not always reflect the geography well; graph distance may or may not be related to geographic distance
  • Can get graph distances using built in functions
    • farthest_vertices(trip_g_simp)
    • get_diameter(trip_g_simp)
  • Can use geographic coding (lat/lon) to find the geographic distances
    • library(geosphere)
    • st_to <- bike_dat %>% filter(from_station_id == 336 ) %>% sample_n(1) %>% select(from_longitude, from_latitude)
    • st_from <- bike_dat %>% filter(from_station_id == 340 ) %>% sample_n(1) %>% select(from_longitude, from_latitude)
    • farthest_dist <- distm(st_from, st_to, fun = distHaversine)
    • bike_dist <- function(station_1, station_2, divy_bike_df){
    • st1 <- divy_bike_df %>% filter(from_station_id == station_1 ) %>% sample_n(1) %>% select(from_longitude, from_latitude)
    • st2 <- divy_bike_df %>% filter(from_station_id == station_2 ) %>% sample_n(1) %>% select(from_longitude, from_latitude)
    • farthest_dist <- distm(st1, st2, fun = distHaversine)
    • return(farthest_dist)
    • }

Connectivity:

  • Can be measured either for vertex or edges - how many need to be removed to create 2 distinct graphs
    • rand_g <- erdos.renyi.game(10, .4, “gnp”, directed = F)
    • plot(rand_g)
    • vertex_connectivity(rand_g)
    • edge_connectivity(rand_g)
    • min_cut(rand_g, value.only = F) # more information about the connectivity
  • Can then run comparisons between random graphs and bike-sharing graphs
    • nv <- gorder(trip_g_ud)
    • ed <- edge_density(trip_g_ud)
    • graph_vec <- rep(NA, 1000)
    • for(i in 1:1000){ w1 <- erdos.renyi.game(nv, ed, “gnp”, directed = T) ; graph_vec[i]<- edge_connectivity(w1) }

Example code includes:

bike_dat <- readr::read_csv("./RInputFiles/divvy_bike_sample.csv")
## Parsed with column specification:
## cols(
##   tripduration = col_integer(),
##   from_station_id = col_integer(),
##   from_station_name = col_character(),
##   to_station_id = col_integer(),
##   to_station_name = col_character(),
##   usertype = col_character(),
##   gender = col_character(),
##   birthyear = col_integer(),
##   from_latitude = col_double(),
##   from_longitude = col_double(),
##   to_latitude = col_double(),
##   to_longitude = col_double(),
##   geo_distance = col_double()
## )
glimpse(bike_dat)
## Observations: 52,800
## Variables: 13
## $ tripduration      <int> 295, 533, 1570, 2064, 2257, 296, 412, 948, 8...
## $ from_station_id   <int> 49, 165, 25, 300, 85, 174, 75, 45, 85, 99, 3...
## $ from_station_name <chr> "Dearborn St & Monroe St", "Clark St & Wavel...
## $ to_station_id     <int> 174, 308, 287, 296, 313, 198, 56, 147, 174, ...
## $ to_station_name   <chr> "Canal St & Madison St", "Seeley Ave & Rosco...
## $ usertype          <chr> "Subscriber", "Subscriber", "Customer", "Cus...
## $ gender            <chr> "Male", "Male", NA, NA, "Male", "Female", "M...
## $ birthyear         <int> 1964, 1972, NA, NA, 1963, 1973, 1989, 1965, ...
## $ from_latitude     <dbl> 41.88132, 41.95078, 41.89766, 41.93773, 41.9...
## $ from_longitude    <dbl> -87.62952, -87.65917, -87.62351, -87.64409, ...
## $ to_latitude       <dbl> 41.88209, 41.94340, 41.88032, 41.94011, 41.9...
## $ to_longitude      <dbl> -87.63983, -87.67962, -87.63519, -87.64545, ...
## $ geo_distance      <dbl> 858.9672, 1881.5034, 2159.4804, 287.8546, 30...
# Create trip_df_subs
trip_df_subs <- bike_dat %>% 
  filter(usertype == "Subscriber") %>% 
  group_by(from_station_id, to_station_id) %>% 
  summarise(weights = n())

# Create igraph object
trip_g_subs <- graph_from_data_frame(trip_df_subs[, 1:2])

# Add edge weights
E(trip_g_subs)$weights <- trip_df_subs$weights / sum(trip_df_subs$weights)

# Now work the same code and filter it down to non-subs
trip_df_non_subs <- bike_dat %>% 
  filter(usertype == "Customer") %>% 
  group_by(from_station_id, to_station_id) %>% 
  summarise(weights = n())

# Create igraph object
trip_g_non_subs <- graph_from_data_frame(trip_df_non_subs[, 1:2])

# Add edge weights
E(trip_g_non_subs)$weights <- trip_df_non_subs$weights / sum(trip_df_non_subs$weights)

# Now let's compare these graphs
gsize(trip_g_subs)
## [1] 14679
gsize(trip_g_non_subs)
## [1] 9528
# Create the subgraphs
sg_sub <- induced_subgraph(trip_g_subs, 1:12)
sg_non_sub <- induced_subgraph(trip_g_non_subs, 1:12)

# Plot sg_sub
plot(sg_sub, vertex.size = 20, edge.arrow.width = .8, edge.arrow.size = 0.4, 
     margin = 0, edge.width = E(sg_sub)$weights*10000, main = "Subscribers")

# Plot sg_non_sub
plot(sg_non_sub, vertex.size = 20, edge.arrow.width = .8, edge.arrow.size = 0.4, 
     margin = 0, vertex.size = 10, edge.width = E(sg_non_sub)$weights*10000, 
     main = "Customers")

bike_dist <- function(station_1, station_2, divy_bike_df){ 
   st1 <- divy_bike_df %>% filter(from_station_id == station_1 ) %>% sample_n(1) %>% select(from_longitude, from_latitude)
   st2 <- divy_bike_df %>% filter(from_station_id == station_2 ) %>% sample_n(1) %>% select(from_longitude, from_latitude)
   farthest_dist <- geosphere::distm(st1, st2, fun = geosphere::distHaversine)
   return(farthest_dist)
}


# See the diameter of each graph
get_diameter(trip_g_subs)
## + 7/300 vertices, named, from fce6a54:
## [1] 200 336 267 150 45  31  298
get_diameter(trip_g_non_subs)
## + 6/299 vertices, named, from fcea75e:
## [1] 116 31  25  137 135 281
# Find the farthest vertices
farthest_vertices(trip_g_subs)
## $vertices
## + 2/300 vertices, named, from fce6a54:
## [1] 200 298
## 
## $distance
## [1] 6
farthest_vertices(trip_g_non_subs)
## $vertices
## + 2/299 vertices, named, from fcea75e:
## [1] 116 281
## 
## $distance
## [1] 5
# See how far apart each one is and compare the distances
bike_dist(200, 298, bike_dat)
##          [,1]
## [1,] 17078.31
bike_dist(116, 281, bike_dat)
##          [,1]
## [1,] 7465.656
# Create trip_df
trip_df <- bike_dat %>% 
  group_by(from_station_id, to_station_id) %>% 
  summarise(weights = n())

# Create igraph object
trip_g_df <- graph_from_data_frame(trip_df[, 1:2])

# Add edge weights
E(trip_g_df)$weights <- trip_df$weights / sum(trip_df$weights)


trip_g_simp <- simplify(trip_g_df, remove.multiple=FALSE)
trip_g_simp
## IGRAPH fd0fffd DN-- 300 18773 -- 
## + attr: name (v/c), weights (e/n)
## + edges from fd0fffd (vertex names):
##  [1] 5->14  5->16  5->25  5->29  5->33  5->35  5->36  5->37  5->43  5->49 
## [11] 5->51  5->52  5->53  5->55  5->59  5->66  5->68  5->72  5->74  5->75 
## [21] 5->76  5->81  5->85  5->90  5->92  5->97  5->98  5->99  5->100 5->108
## [31] 5->110 5->111 5->117 5->120 5->128 5->134 5->135 5->137 5->140 5->141
## [41] 5->144 5->146 5->148 5->149 5->168 5->169 5->171 5->174 5->175 5->176
## [51] 5->177 5->178 5->181 5->191 5->192 5->193 5->194 5->198 5->210 5->214
## [61] 5->218 5->227 5->233 5->237 5->255 5->264 5->268 5->273 5->277 5->291
## [71] 5->309 5->321 5->333 5->335 5->341
## + ... omitted several edges
# Find the degree distribution
trip_out <- degree(trip_g_simp, mode = "out")
trip_in <- degree(trip_g_simp, mode = "in")

# Create a data frame for easier filtering 
trip_deg <- data.frame(cbind(trip_out, trip_in))
trip_deg$station_id <- names(trip_out)
trip_deg_adj <- trip_deg %>% mutate(ratio = trip_out / trip_in)

# Filter out rarely traveled to stations
trip_deg_filter <- trip_deg_adj %>% filter(trip_out > 10) %>% filter(trip_in > 10) 

# Plot histogram
hist(trip_deg_filter$ratio)

# See which stations were the most skewed using which.min() and which.max()
trip_deg_filter %>% slice(which.min(ratio))
##   trip_out trip_in station_id     ratio
## 1       14      24        207 0.5833333
trip_deg_filter %>% slice(which.max(ratio))
##   trip_out trip_in station_id    ratio
## 1       19      11        135 1.727273
# If the weights are the same across all stations, then an unweighted degree ratio would work
# But if we want to know how many bikes are actually flowing, we need to consider weights
# The weighted analog to degree distribution is strength
# We can calculate this with the strength() function, which presents a weighted degree distribution based on the weight attribute of a graph's edges

# Calculate the weighted in and out degrees
trip_out_w <- strength(trip_g_simp, mode = "out")
trip_in_w <- strength(trip_g_simp, mode = "in")

# Create a data frame for easier filtering 
trip_deg_w <- data.frame(cbind(trip_out_w, trip_in_w))
trip_deg_w$station_id <- names(trip_out_w)
trip_deg_w_adj <- trip_deg_w %>% mutate(ratio = trip_out_w / trip_in_w)

# Filter out rarely traveled to stations
trip_deg_w_filter <- trip_deg_w_adj %>% filter(trip_out_w > 10) %>% filter(trip_in_w > 10) 

# Plot histogram of ratio
hist(trip_deg_w_filter$ratio)

# See which stations were the most skewed using which.min() and which.max()
trip_deg_w_filter %>% slice(which.min(ratio))
##   trip_out_w trip_in_w station_id     ratio
## 1         14        24        207 0.5833333
trip_deg_w_filter %>% slice(which.max(ratio))
##   trip_out_w trip_in_w station_id    ratio
## 1         19        11        135 1.727273
latlong <- data.frame(from_longitude=c(-87.656495, -87.660996, -87.6554864, -87.642746, -87.67328, -87.661535, -87.623727, -87.668745, -87.65103, -87.666507, -87.666611), 
                      from_latitude=c(41.858166, 41.869417, 41.8694821, 41.880422, 41.87501, 41.857556, 41.864059, 41.857901, 41.871737, 41.865234, 41.891072)
                      )

# Create a sub graph of the least traveled graph 275
g275 <- make_ego_graph(trip_g_simp,  1, nodes = "275", mode= "out")[[1]]

# Plot graph with geographic coordinates
plot(g275, layout = as.matrix(latlong), vertex.label.color = "blue", vertex.label.cex = .6,
     edge.color = 'black', vertex.size = 15, edge.arrow.size = .1,
     edge.width = E(g275)$weight, main = "Lat/Lon Layout")

# Plot graph without geographic coordinates
plot(g275, vertex.label.color = "blue", vertex.label.cex = .6,
     edge.color = 'black', vertex.size = 15, edge.arrow.size = .1,
     edge.width = E(g275)$weight,
     main = "Default Layout")

# Eigen centrality weighted
ec_weight <- eigen_centrality(trip_g_simp, directed = T, weights = NULL)

# Eigen centrality unweighted
ec_unweight <- eigen_centrality(trip_g_simp, directed = T, weights = NA)

# Closeness weighted
close_weight <- closeness(trip_g_simp, weights = NULL)

# Closeness unweighted
close_unweight <- closeness(trip_g_simp, weights = NA)

# Output nicely with cbind()
cbind(c(
  names(V(trip_g_simp))[which.min(ec_weight$vector)],
  names(V(trip_g_simp))[which.min(close_weight)],
  names(V(trip_g_simp))[which.min(ec_unweight$vector)],
  names(V(trip_g_simp))[which.min(close_unweight)]
  ), c("Weighted Eigen Centrality", "Weighted Closeness", "Unweighted Eigen Centrality", "Unweighted Closeness")
)
##      [,1]  [,2]                         
## [1,] "204" "Weighted Eigen Centrality"  
## [2,] "336" "Weighted Closeness"         
## [3,] "204" "Unweighted Eigen Centrality"
## [4,] "336" "Unweighted Closeness"
trip_g_ud <- as.undirected(trip_g_simp)
trip_g_ud
## IGRAPH fd3eb1a UN-- 300 12972 -- 
## + attr: name (v/c)
## + edges from fd3eb1a (vertex names):
##  [1] 5 --14 14--15 5 --16 13--16 15--16 16--17 5 --19 14--19 15--19 5 --20
## [11] 13--20 16--20 17--20 14--21 16--21 17--21 19--21 14--22 15--22 19--22
## [21] 21--22 5 --23 17--23 20--23 5 --24 16--24 17--24 23--24 5 --25 13--25
## [31] 16--25 17--25 20--25 21--25 22--25 23--25 24--25 5 --26 17--26 19--26
## [41] 20--26 24--26 25--26 13--27 16--27 20--27 24--27 26--27 17--28 20--28
## [51] 5 --29 16--29 17--29 20--29 24--29 25--29 26--29 16--30 17--30 19--30
## [61] 20--30 22--30 29--30 13--31 14--31 16--31 17--31 20--31 21--31 22--31
## [71] 23--31 24--31 25--31 26--31 28--31 30--31 15--32 19--32 21--32 22--32
## + ... omitted several edges
# Find the minimum number of cuts using min_cut()
ud_cut <- min_cut(trip_g_ud, value.only = FALSE)

# Print the vertex with the minimum number of cuts
print(ud_cut$partition1)
## + 1/300 vertex, named, from fd3eb1a:
## [1] 281
# Make an ego graph
g<- make_ego_graph(trip_g_ud, 1, nodes = "281")[[1]]
plot(g, edge.color = 'black', edge.arrow.size = .1)

# Print the value
print(ud_cut$value)
## [1] 5
# Print cut object
print(ud_cut$cut)
## + 5/12972 edges from fd3eb1a (vertex names):
## [1] 71 --281 135--281 167--281 203--281 281--305
far_stations <- c("231", "321")
close_stations <- c("231", "213")

# Compare the output of close and far vertices
stMincuts(trip_g_simp, far_stations[1], far_stations[2])$value
## [1] 54
stMincuts(trip_g_simp, close_stations[1], close_stations[2])$value
## [1] 49
# Find the actual value
clust_coef <- transitivity(trip_g_simp, type = "global")

# Get randomization parameters using gorder() and edge_density()
nv <- gorder(trip_g_simp)
ed <- edge_density(trip_g_simp)

# Create an empty vector to hold output of 300 simulations
graph_vec <- rep(NA, 300)

# Calculate clustering for random graphs
for(i in 1:300){
  graph_vec[i]<- transitivity(erdos.renyi.game(nv, ed, "gnp", directed = T), type = "global")
}

# Plot a histogram of the simulated values
hist(graph_vec, xlim = c(.35, .6), main = "Unweighted clustering randomization")

# Add a line with the true value
abline(v = clust_coef, col = "red")

# Find the mean local weighted clustering coeffecient
m_clust <- mean(transitivity(trip_g_simp, type = "weighted"))
nv <- gorder(trip_g_simp)
ed <- edge_density(trip_g_simp)
graph_vec <- rep(NA, 100)

for(i in 1:100){
  g_temp <- erdos.renyi.game(nv, ed, "gnp", directed = T)
  # Sample existing weights and add them to the random graph
  E(g_temp)$weight <- sample(x = E(trip_g_simp)$weights, size = gsize(g_temp), replace = TRUE)
  graph_vec[i]<- mean(transitivity(g_temp, type = "weighted"))
}

# Plot a histogram of the simulated values
hist(graph_vec, xlim = c(.35, .7), main = "Unweighted clustering randomization")

# Add a line with the true value
abline(v = m_clust ,col = "red")


Chapter 4 - Other Ways to Visualize Graph Data

Other packages for plotting graphs:

  • Base plotting in igraph is good for quick visualizations, but other libraries can make great plots simply
  • Can use the ggplot syntax with ggnet, for example
    • library(ggnetwork)
    • library(igraph)
    • library(GGally)
    • library(intergraph)
  • The basic igraph plotting is as follows
    • rand_g <- erdos.renyi.game(30, .15, “gnp”, directed = F)
    • rand_g <- simplify(rand_g)
    • plot(rand_g)
  • The basic ggnet plotting requires use of asNetwork on the core graph
    • net <- asNetwork(rand_g)
    • ggnet2(net)
  • The basic ggnetwork plotting is more similar to ggplot2
    • gn <- ggnetwork(rand_g)
    • g <- ggplot(gn, aes(x = x, y = y, xend = xend, yend = yend)) + geom_edges() + geom_nodes() + theme_blank()
    • plot(g)
  • Where an igraph might require voluminous code for extensions, the ggnet or ggnetwork can be extended in a much simpler manner
    • ggnet2(net, node.size = “cent”, node.color = “comm”, edge.size = .8, color.legend = “Community Membership”, color.palette = “Spectral”, edge.color = c(“color”, “gray88”), size.cut = T, size.legend = “Centrality”)
    • g <- ggplot(gn, aes(x = x, y = y, xend = xend, yend = yend)) + geom_edges(aes(color = as.factor(comm))) + geom_nodes(aes(color = as.factor(comm), size = cent)) + theme_blank() + guides(color = guide_legend(title = “Community”), size = guide_legend(title = “Centrality”))
    • plot(g)

Interactive visualizations:

  • Can use R to create interactive javascript plots for outputs to html or similar
  • Examples can be built on a simple random graph
    • library(ggiraph)
    • library(htmlwidgets)
    • library(networkD3)
    • rand_g <- erdos.renyi.game(30, .12, “gnp”, directed = F)
    • rand_g <- simplify(rand_g)
    • V(rand_g)$cent <- betweenness(rand_g)
  • Can plot using ggplot2 and ggiraph
    • g <- ggplot(ggnetwork(rand_g), aes(x = x, y = y, xend = xend, yend = yend)) + geom_edges(color = “black”) + geom_nodes(aes(size = cent)) + theme_blank() + guides(size = guide_legend(title = “Centrality”))
    • my_gg <- g + geom_point_interactive(aes(tooltip = round(cent, 2)), size = 2) # Create ggiraph object
    • ggiraph(code = print(my_gg)) # Display ggiraph object
  • Can also customize the ggiraph call using valid CSS, for example using
    • hover_css = “cursor:pointer;fill:red;stroke:red;r:5pt”
    • data_id = round(cent, 2)), size = 2)
    • ggiraph(code = print(my_gg), hover_css = hover_css, tooltip_offx = 10, tooltip_offy = -10)
  • Can also plot with networkD3 which is easy to use but does not allow for much customization
    • nd3 <- igraph_to_networkD3(rand_g)
    • simpleNetwork(nd3$links)
  • Can add complexity to the D3 plot by specifying information about the nodes and edges to be plotted insinde forceNetwork()
    • nd3\(nodes\)group = V(rand_g)$comm
    • nd3\(nodes\)cent = V(rand_g)$cent
    • forceNetwork(Links = nd3\(links, Nodes = nd3\)nodes, Source = ‘source’, Target = ‘target’, NodeID = ‘name’, Group = ‘group’, Nodesize = ‘cent’, legend = T, fontSize = 20)

Alternative visualizations:

  • Hairball plots are designed to maximize spacing between vertices, but as plots get large the information is hard if not impossible to interpret
  • One potential solution is the hive plot
    • library(HiveR)
    • rand_g <- erdos.renyi.game(18, .3, “gnp”, directed = T)
    • plot(rand_g, vertex.size = 7) # standard igraph plot
    • rand_g_df <- as.data.frame(get.edgelist(rand_g))
    • rand_g_df$weight <- 1
    • rand_hive <- edge2HPD(edge_df = rand_g_df)
    • rand_hive\(nodes\)axis <- sort(rep(1:3, 6))
    • rand_hive\(nodes\)radius <- as.double(rep(1:6, 3))
    • plotHive(rand_hive, method=“abs”, bkgnd=“white”)
  • Can modify hive plots by way of either nodes or edges
    • Setting location of each node

    • rand_hive\(nodes\)axis <- sort(rep(1:3, 6))
    • rand_hive\(nodes\)radius <- as.double(rep(1:6, 3))
    • Add weights to each edge

    • rand_hive\(edges\)weight <- as.double(rpois(length(rand_hive\(edges\)weight), 5))
    • Add color based on edge origination

    • rand_hive\(edges\)color[rand_hive\(edges\)id1 %in% 1:6] <- ‘red’
    • rand_hive\(edges\)color[rand_hive\(edges\)id1 %in% 7:12] <- ‘blue’
    • rand_hive\(edges\)color[rand_hive\(edges\)id1 %in% 13:18] <- ‘green’
    • Plot

    • plotHive(rand_hive, method = “abs”, bkgnd = “white”)
  • Another alternative is the biofabric plot
    • Create random graph

    • rand_g <- erdos.renyi.game(10, .3, “gnp”, directed = F)
    • rand_g <- simplify(rand_g)
    • Add names to vertices

    • V(rand_g)$name <- LETTERS[1:length(V(rand_g))]
    • Create biofabric plot

    • biofbc <- bioFabric(rand_g)
    • bioFabric_htmlwidget(biofbc)

Example code includes:

verts <- c(1185, 3246, 1684, 3634, 3870, 188, 2172, 3669, 2267, 1877, 3931, 1862, 2783, 2351, 423, 3692, 1010, 173, 1345, 3913, 3646, 2839, 2624, 4072, 2685, 2901, 2227, 2431, 1183, 602, 3937, 3688, 2823, 3250, 101, 1951, 3097, 884, 1299, 945, 583, 1691, 1687, 1504, 622, 566, 949, 1897, 1083, 3491, 187, 1799, 3249, 496, 2280, 840, 519, 3060, 4115, 1520, 2700, 385, 1558, 1113, 3303, 1818, 3283, 3291, 3218, 1781, 3055, 2547, 2874, 3, 1923, 890, 1536, 2477, 1422, 449, 984, 2697, 1686, 3181, 415, 1754, 3972, 3600, 3573, 706, 527, 2631, 1383, 2644, 1290, 756, 3147, 377, 4109, 2056, 2411, 1337, 1963, 3833, 1939, 4030, 4111, 2442, 1647, 590, 3749, 1208, 244, 3796, 2886, 570, 2199, 3818, 2342, 1618, 2591, 1279, 1230, 878, 1476, 3930, 616, 364, 567, 2753, 2470, 3554, 2683, 2938, 2077, 2629, 3273, 3131, 3900, 1749, 1240, 1629, 42, 731, 3350, 919, 950, 305, 976, 2906, 3363, 1974, 1539, 978, 441, 1546, 4110, 860, 1762, 864, 1989, 1401, 2572, 1482, 1406, 2110, 2926, 874, 1631, 1050, 2488, 726, 3408, 2946, 2636, 2437, 1468, 2089, 3447, 2292, 3308, 1231, 2788, 1043, 2339, 1893, 3935, 2220, 3589, 3544, 1077, 1263, 4114, 2434, 3679, 1831, 1596, 2585, 598, 2246, 936, 3770, 2355, 2017, 1576, 3445, 1425, 1128, 668, 674, 1884, 989, 845, 2634, 4068, 2736, 1374, 3922, 3202, 3583, 1102, 3746, 2838, 2674, 206, 3966, 1860, 2180, 2717, 3562, 2405, 1666, 2107, 228, 1014, 1543, 768, 3229, 594, 3117, 2121, 2568, 666, 2454, 1209, 2807, 1545, 3753, 3744, 2812, 995, 858, 2293, 1034, 2053, 3034, 650, 1562, 1821, 3351, 3572, 3402, 2600, 3663, 1991, 2222, 1296, 1338, 78, 1936, 3352, 25, 278, 632, 2962, 2826, 3734, 1792, 286, 2491, 2912, 4028, 1522, 863, 223, 1518, 249, 866, 210, 2567, 1140, 386, 276, 3368, 2885, 3122, 3754, 396, 379, 3051, 2996, 36, 2973, 4106, 2404, 1834, 3920, 32, 1724, 1876, 1484, 1769, 2715, 211, 1350, 3054, 3178, 904, 1346, 3256, 3243, 1124, 559, 2672, 394, 128, 3790, 133, 1283, 3468, 3934, 1085, 2794, 3157, 1190, 1864, 2638, 2426, 2435, 3696, 1567, 451, 1987, 850, 1836, 1397, 3710, 1465, 865, 2350, 515, 3645, 1940, 614, 2341, 3711, 2516, 3914, 1216, 3140, 541, 725, 3369, 1157, 1364, 2943, 3947, 67, 1525, 1812, 1582, 1285, 4117, 1705, 1999, 3608, 2899, 782, 1155, 3632, 2187, 2844, 1393, 2873, 2008, 3412, 692, 1053, 355, 785, 3643, 1105, 2706, 2927, 393, 893, 1007, 4021, 439, 3687, 3667, 510, 3365, 2141, 1469, 1671, 2623, 307, 1259, 2526, 1176, 3083, 798, 1845, 1023, 712, 3520, 1191, 1771, 104, 2025, 2382, 2204, 3784, 3292, 2313, 1119, 1433, 593, 3182, 3516, 2079, 1215, 3673, 3831, 2257, 399, 1793, 366, 3690, 1041, 2147, 2690, 609, 3184, 2603, 2793, 540, 1315, 2471, 1922, 3792, 882, 214, 867, 3261, 3816, 2737, 3990, 457, 3566, 1595, 1697, 605, 2138, 990, 841, 2524, 1033, 2958, 343, 2998, 1559, 2756, 2414, 1620, 2285, 2, 791, 2566, 783, 2961, 1120, 2500, 3390, 421, 464, 2463, 4056, 3029, 3525, 256, 1668, 2544, 316, 3598, 917, 180, 2485, 2848, 1280, 1326, 1039, 290, 1321, 644)
verts <- c(verts, 1937, 1820, 3733, 1232, 1677, 298, 3102, 1427, 2653, 619, 1639, 2774, 226, 2934, 1084, 1312, 1123, 135, 1865, 2440, 3245, 92, 3551, 1088, 3370, 2467, 1604, 2928, 142, 2648, 1250, 2970, 1918, 983, 2866, 328, 2976, 3653, 2692, 4099, 291, 3819, 2864, 1375, 1169, 732, 2031, 3166, 1888, 2092, 2372, 1887, 1816, 58, 170, 3306, 3903, 715, 2312, 2323, 1404, 3824, 1942, 3142, 1964, 3214, 2084, 1502, 3366, 2513, 1464, 66, 2007, 1735, 3109, 2876, 3021, 1301, 3089, 535, 996, 3916, 3451, 2057, 1858, 215, 3417, 424, 312, 3103, 1791, 1189, 3149, 113, 835, 2415, 794, 3636, 612, 2816, 514, 2889, 1162, 1313, 2210, 339, 3850, 3481, 2047, 2739, 3124, 2643, 3428, 155, 3161, 3027, 2711, 1317, 148, 1273, 956, 2969, 1265, 1063, 3899, 3945, 1597, 2543, 363, 767, 3322, 2618, 2850, 1454, 2066, 2778, 3534, 1339, 314, 2174, 2589, 297, 3932, 2132, 2612, 3180, 1649, 1966, 2552, 3581, 3148, 196, 1741, 1213, 2924, 3936, 406, 3631, 813, 259, 3230, 543, 2233, 599, 70, 1797, 3607, 975, 1448, 2022, 2777, 696, 1581, 1542, 2523, 2457, 2857, 3046, 3272, 1891, 3681, 586, 1644, 871, 137, 2176, 1849, 480, 972, 1996, 565, 330, 1466, 1217, 2888, 889, 80, 3487, 1143, 2157, 3594, 3747, 634, 1463, 2150, 1775, 2247, 2484, 1658, 1309, 24, 13, 3383, 367, 1423, 2439, 2522, 3637, 2064, 3639, 4046, 2078, 3676, 3506, 1413, 2964, 2192, 3130, 4078, 1069, 2720, 3344, 1090, 5, 3848, 501, 167, 3915, 3787, 4049, 3986, 233, 2343, 3196, 3918, 4063, 537, 242, 3809, 1648, 1662, 2986, 124, 685, 1726, 4087, 1932, 3999, 1910, 484, 489, 1382, 2289, 2189, 3067, 2722, 2262, 2702, 429, 839, 1109, 1361, 2123, 4058, 3959, 2735, 52, 2183, 2707, 1538, 678, 63, 943, 3047, 3108, 1806, 730, 1628, 2664, 1355, 345, 932, 1201, 861, 3861, 1214, 403, 156, 3429, 3210, 3355, 1583, 2479, 3508, 164, 2299, 3320, 2923, 2562, 460, 4013, 417, 1947, 1853, 2272, 1027, 1997, 3266, 2449, 250, 1486, 177, 1118, 3644, 14, 2538, 3836, 2368, 3349, 1879, 2310, 3413, 4032, 319, 3155, 2413, 3842, 3724, 1802, 3319, 2940, 31, 773, 426, 1067, 2374, 3240, 2335, 4010, 3398, 3096, 392, 245, 2898, 4026, 138, 2109, 1526, 2011, 881, 512, 372, 1650, 3373, 3659, 552, 2474, 1712, 3786, 2185, 43, 3406, 2890, 3504, 348, 2982, 2186, 481, 4018, 3048, 1360, 962, 838, 720, 1826, 4011, 2161, 1763, 2617, 2447, 65, 1227, 3938, 2569, 3662, 1746, 2742, 4020, 2148, 1643, 2450, 4093, 3905, 230, 3401, 168, 2779, 1847, 1006, 3074, 1894, 1702, 1229, 3704, 2586, 3595, 1163, 3661, 2230, 3236, 1111, 1770, 438, 2504, 2828, 651, 2456, 1900, 3050, 506, 1674, 3477, 2766, 76, 3606, 3630, 1237, 3617, 295, 3512, 1286, 3623, 3495, 964, 3407, 494, 3629, 140, 1178, 3045, 2041, 194, 3852, 3800, 1605, 1420, 1968, 442, 3570, 1796, 1729, 369, 2401, 1507, 2462, 145, 2580, 848, 4043, 3443, 2979, 22, 3727, 1316, 1437, 3450, 3590, 3465, 3188, 2373, 432, 3425, 3449, 1356, 273, 700, 1789, 1251, 1767, 3998, 2005, 1222, 2214, 340)

# Create subgraph of rt_g
rt_samp <- induced_subgraph(rt_g, verts)

# Convert from igraph using asNetwork()
net <- intergraph::asNetwork(rt_samp)

# Plot using igraph
plot(rt_samp, vertex.label = NA, edge.arrow.size = 0.2, edge.size = 0.5, 
     vertex.color = "black", vertex.size = 1
     )

# Plot using ggnet2
GGally::ggnet2(net, node.size = 1, node.color = "black", edge.size = .4)

# Raw plot of rt_samp using ggnetwork()
library(ggnetwork)
library(GGally)
## 
## Attaching package: 'GGally'
## The following object is masked from 'package:dplyr':
## 
##     nasa
ggplot(ggnetwork(rt_samp, arrow.gap = .01) , aes(x = x, y = y, xend = xend, yend = yend)) + 
    geom_edges(arrow = arrow(length = unit(6, "pt"), type = "closed"), color = "black") +
    geom_nodes(size = 4) 
## Loading required package: sna
## Loading required package: statnet.common
## 
## Attaching package: 'statnet.common'
## The following object is masked from 'package:base':
## 
##     order
## Loading required package: network
## network: Classes for Relational Data
## Version 1.13.0.1 created on 2015-08-31.
## copyright (c) 2005, Carter T. Butts, University of California-Irvine
##                     Mark S. Handcock, University of California -- Los Angeles
##                     David R. Hunter, Penn State University
##                     Martina Morris, University of Washington
##                     Skye Bender-deMoll, University of Washington
##  For citation information, type citation("network").
##  Type help("network-package") to get started.
## 
## Attaching package: 'network'
## The following objects are masked from 'package:igraph':
## 
##     %c%, %s%, add.edges, add.vertices, delete.edges,
##     delete.vertices, get.edge.attribute, get.edges,
##     get.vertex.attribute, is.bipartite, is.directed,
##     list.edge.attributes, list.vertex.attributes,
##     set.edge.attribute, set.vertex.attribute
## sna: Tools for Social Network Analysis
## Version 2.4 created on 2016-07-23.
## copyright (c) 2005, Carter T. Butts, University of California-Irvine
##  For citation information, type citation("sna").
##  Type help(package="sna") to get started.
## 
## Attaching package: 'sna'
## The following objects are masked from 'package:igraph':
## 
##     betweenness, bonpow, closeness, components, degree,
##     dyad.census, evcent, hierarchy, is.connected, neighborhood,
##     triad.census

# Prettier plot of rt_samp using ggnetwork()
ggplot(ggnetwork(rt_samp, arrow.gap = .01),aes(x = x, y = y, xend = xend, yend = yend)) + 
    geom_edges(arrow = arrow(length = unit(6, "pt"), type = "closed"), color = "black", curvature = .2) +
    geom_nodes(size = 4) + theme_blank()

# NEED TO FIX!
rt_keys <- sort(table(vertex_attr(rt_g)$clust), decreasing=TRUE)
# rt_drops <- names(rt_keys)[11:length(rt_keys)]
# vt_drops <- which(vertex_attr(rt_g)$clust %in% rt_drops)
# rt_use <- delete_vertices(rt_g, vt_drops)
rt_use <- induced_subgraph(rt_g, which(V(rt_g)$clust %in% names(rt_keys[1:10])))

# Convert to a network object
net <- intergraph::asNetwork(rt_use)
ggnet2(net, node.size = "cent", node.color = "clust", edge.size = .1, 
       color.legend = "Community Membership", color.palette = "Spectral"
       )

# Now remove the centrality legend by setting size to false in the guide() function
ggnet2(net, node.size = "cent", node.color = "clust", edge.size = .1, 
       color.legend = "Community Membership", color.palette = "Spectral"
       ) + 
    guides( size = FALSE)

# Add edge colors
ggnet2(net, node.size = "cent", node.color = "clust", edge.size = .1, 
       color.legend = "Community Membership", color.palette = "Spectral", 
       edge.color = c("color", "gray88")) +
  guides( size = FALSE)

# NEED TO CREATE rt_g_smaller!
# Basic plot where we set parameters for the plots using geom_edegs() and geom_nodes()
# ggplot(ggnetwork(rt_g_smaller, arrow.gap = .01), aes(x = x, y = y, xend = xend, yend = yend)) + 
#   geom_edges(arrow = arrow(length = unit(6, "pt"), type = "closed"), curvature = .2, color = "black") + 
#   geom_nodes(size = 4, aes(color = comm)) + 
#   theme_blank()

# Added guide legend, changed line colors, added size 
# ggplot(ggnetwork(rt_g_smaller, arrow.gap = .01), aes(x = x, y = y, xend = xend, yend = yend)) + 
#   geom_edges(arrow = arrow(length = unit(6, "pt"), type = "closed"), curvature = .2, lwd = .3, aes(color=comm)) +
#   geom_nodes(aes(color = comm, size = cent)) + 
#   theme_blank() +  
#   guides(color = guide_legend(title = "Community"), size = guide_legend(title = "Centrality"))


# NEED TO FIX!
# Add betweenness centrality using betweenness()
V(trip_g_simp)$cent <- igraph::betweenness(trip_g_simp)

# Create a ggplot object with ggnetwork to render using ggiraph
g <- ggplot(ggnetwork(trip_g_simp, arrow.gap = .01), aes(x = x, y = y, xend = xend, yend = yend)) + 
    geom_edges(color = "black") + 
    geom_nodes(aes(size = cent)) + 
    theme_blank() 
plot(g)

# Create ggiraph object and assign the tooltip to be interactive
my_gg <- g + ggiraph::geom_point_interactive(aes(tooltip = round(cent, 2), 
                                                 data_id = round(cent, 2)
                                                 ), size = 2
                                             ) 

# Define some hover css so the cursor turns red
hover_css = "cursor:pointer;fill:red;stroke:red;r:3pt"
# ggiraph::ggiraph(code = print(my_gg), hover_css = hover_css, tooltip_offx = 10, tooltip_offy = -10)


# Add community membership as a vertex attribute using the cluster_walktrap algorithm
V(rt_g)$comm <- membership(cluster_walktrap(rt_g))

# Create an induced_subgraph
rt_sub_g <- induced_subgraph(rt_g, which(V(rt_g)$comm %in% 10:13))

# Plot to see what it looks like without an interactive plot using ggnetwork
ggplot(ggnetwork(rt_sub_g, arrow.gap = .01), aes(x = x, y = y, xend = xend, yend = yend)) + 
    geom_edges(color = "black") + 
    geom_nodes(aes(color = as.factor(comm))) + 
    theme_blank()  

# Convert to a networkD3 object
# nd3 <- igraph_to_networkD3(rt_sub_g)

# Assign grouping factor as community membership
# nd3$nodes$group = V(rt_sub_g)$comm

# Render your D3.js graph
# forceNetwork(Links = nd3$links, Nodes = nd3$nodes, Source = 'source', 
#              Target = 'target', NodeID = 'name', Group = 'group', legend = T, fontSize = 20
#              )

# Convert  trip_df to hive object using edge2HPD()
# bike_hive <- edge2HPD(edge_df =  as.data.frame(trip_df))

# Assign to trip_df edgecolor using our custom function
# trip_df$edgecolor <- dist_gradient(trip_df$geodist)

# Calculate centrality with betweenness()
# bike_cent <- betweenness(trip_g)

# Add axis and radius based on longitude and radius
# bike_hive$nodes$radius<- ifelse(bike_cent > 0, bike_cent, runif(1000, 0, 3))

# Set axis as integers and axis colors to black
# bike_hive$nodes$axis <- as.integer(dist_stations$axis)
# bike_hive$axis.cols <- rep("black", 3)

# Set the edge colors to a heatmap based on trip_df$edgecolor
# bike_hive$edges$color <- trip_df$edgecolor
# plotHive(bike_hive, method = "norm", bkgnd = "white")


# Add community membership as a vertex attribute
V(rt_g)$comm <- membership(cluster_walktrap(rt_g))

# Create a subgraph
rt_sub_g <- induced_subgraph(rt_g, which(V(rt_g)$comm %in% 10:15))

# Plot to see what it looks like without an interactive plot
ggplot(ggnetwork(rt_sub_g, arrow.gap = .01), aes(x = x, y = y, xend = xend, yend = yend)) + 
    geom_edges(color = "black") + 
    geom_nodes(aes(color = as.factor(comm)))+ theme_blank() +
    theme(legend.position = "none")

# Make a Biofabric plot htmlwidget
# rt_bf <- bioFabric(rt_sub_g)
# bioFabric_htmlwidget(rt_bf)


# Create a dataframe of start and end latitude and longitude and add weights
# ll_to_plot <- bike_dat %>% group_by(from_station_id, to_station_id, from_latitude, 
#                                     from_longitude, to_latitude, to_longitude, usertype
#                                     ) %>% 
#     summarise(weight = n())

# Create a base map with station points with ggmap()
# ggmap(chicago) + 
#     geom_segment(data = ll_to_plot, aes(x = from_longitude, y = from_latitude, 
#                                         xend = to_longitude, yend = to_latitude, 
#                                         colour = usertype, size = weight
#                                         ), alpha = .5
#                )

Fundamentals of Bayesian Analysis in R:

Chapter 1 - What is Bayesian Analysis?

Introduction:

  • British team spearheaded by Turing found ways to decrypt German communications in 1941
    • Key to Turing’s success was the use of Bayesian methods, which wree not very widely used
  • Bayesian inference is “A method for figuring out unobservable quantities given known facts that uses probability to describe the uncertainty over what the values of the unknown quantities could be”
    • The unknown was the configuration of the wheels in the encryption machine - British already knew what a given wheel configuration would produce
    • Turing worked backwards to figure out the probable configuration of the wheels from the messages that he had received
  • Bayesian analysis is flexible and can be problem-specific and customized to a specific dataset and analysis need

Bayesian data analysis - named for Thomas Bayes from the early-mid 1700s:

  • Bayesian data analysis is about probabilistic inference for learning from data and drawing conclusions
  • For this specific course, probability will be a statement about the certainty (p=1 means certain yes, p=0 means certain no), though there are other definitions that can be used
    • Probability need not be only about yes/no statements, and can be associated to distributions such as “amount of rainfall tomorrow”
    • “The role of probability distributions in Bayesian data analysis is to represent uncertainty, and the role of Bayesian inference is to update probability distributions to reflect what has been learned from data.”
  • Example of using a Bayesian approach to patients
    • prop_model(data) is a function that has been created to plot out probabilities vs. p
    • The data is a vector of successes and failures represented by 1s and 0s
    • There is an unknown underlying proportion of success
    • If data point is a success is only affected by this proportion
    • Prior to seeing any data, any underlying proportion of success is equally likely
    • The result is a probability distribution that represents what the model knows about the underlying proportion of success

Samples and posterior samples:

  • Prior probability distribution is a distribution PRIOR to updating with some data; for example, equally probable that p falls anywhere between 0 and 1
  • Posterior probability distribution is a distribution AFTER updating with what is learned by seeing some data
  • Can be valuable to have a vector of potential outcomes, appropriately weighted by the likelihood of each of the outcomes

Chapter wrap-up:

  • Can draw conclusions about the probabilities based on even a small sample of data observed
  • Next chapters will cover mechanics of Bayesian inference in more detail

Example code includes:

prop_model <- function(data = c(), prior_prop = c(1, 1), n_draws = 10000) {
    data <- as.logical(data)
    proportion_success <- c(0, seq(0, 1, length.out = 100), 1)
    data_indices <- round(seq(0, length(data), length.out = min(length(data) + 1, 20)))

    post_curves <- map_dfr(data_indices, function(i) {
        value <- ifelse(i == 0, "Prior", ifelse(data[i], "Success", "Failure"))
        label <- paste0("n=", i)
        probability <- dbeta(proportion_success, prior_prop[1] + sum(data[seq_len(i)]), 
                             prior_prop[2] + sum(!data[seq_len(i)])
                             )
        probability <- probability / max(probability)
        data_frame(value, label, proportion_success, probability)
        }
    )
    post_curves$label <- fct_rev(factor(post_curves$label, levels =  paste0("n=", data_indices )))
    post_curves$value <- factor(post_curves$value, levels = c("Prior", "Success", "Failure"))
  
    p <- ggplot(post_curves, aes(x = proportion_success, y = label, height = probability, fill = value)) +
        ggridges::geom_density_ridges(stat="identity", color = "white", 
                                      alpha = 0.8, panel_scaling = TRUE, size = 1
                                      ) +
        scale_y_discrete("", expand = c(0.01, 0)) +
        scale_x_continuous("Underlying proportion of success") +
        scale_fill_manual(values = hcl(120 * 2:0 + 15, 100, 65), name = "", 
                          drop = FALSE, labels =  c("Prior   ", "Success   ", "Failure   ")
                          ) +
        #ggtitle(paste0("Binomial model - Data: ", sum(data),  " successes, " , sum(!data), " failures"))  +
        theme_light(base_size = 18) +
        theme(legend.position = "top")
    print(p)
  
    invisible(rbeta(n_draws, prior_prop[1] + sum(data), prior_prop[2] + sum(!data)))
}


# Define data and run prop_model
data = c(1, 0, 0, 1)
prop_model(data)

# Define data and run prop_model
data = c(1, 0, 0, 1)
prop_model(data)

data = c(1, 0, 0, 1, 0, 0, 0, 0, 0, 0, 0, 0, 0)
posterior <- prop_model(data)

head(posterior)
## [1] 0.1036182 0.1555942 0.1115889 0.1805051 0.2815857 0.3078648
hist(posterior, breaks = 30, xlim = c(0, 1), col = "palegreen4")

# Get some more information about posterior
median(posterior)
## [1] 0.1882898
quantile(posterior, c(0.05, 0.95))
##         5%        95% 
## 0.06031634 0.38918378
sum(posterior > 0.07) / length(posterior)
## [1] 0.9263

Chapter 2 - How Does Bayesian Inference Work?

Parts needed for Bayesian inference:

  • Bayesian inference requires priors (what is known before seeing data), generative model, and data
    • The generative model is a formula or computer expression that can generate simulated data based on provided input parameters
    • For example, could assume that there is a proportion of zombies cured and a number of zombies treated and then simulate data based on these

Using a generative model:

  • The binomial distribution function can be very helpful as a generative model for summing probabilities of single 1/0 events
  • Typically in data analysis, we know the outcome and want to figure out the likely parameters in our generative model (that is the Bayesian inference)

Repressing uncertainty with priors:

  • The prior reflects our certainty/uncertainty in the parameters prior to running the analysis
    • Example could be a uniform distribution from (a, b)
    • proportion_clicks <- runif(n = 6, min = 0.0, max = 1.0) # sample 6 values that are between 0 and 1 with every number being equally likely
    • n_clicks <- rbinom(n = 6, size = 100, proportion_clicks) # rbinom will vectorize over proportion_clicks

Bayesian models and conditioning:

  • The Bayesian model is based on the generative model and the prior
    • prior <- data.frame(proportion_clicks, n_visitors) # joint PDF over proportion_clicks and n_visitors
  • Can then condition on the observed data and assess the joint PDF for the implications on the distribution of the underlying proportion
    • “Bayesian inference is conditioning on data, in order to learn about parameter values.”

Chapter wrap-up:

  • Used the binomial model as an assumed generative function and a uniform distribution as the prior probabilities
  • Calculated joint probability distributions and then found a probability distribution based on a known outcome (data)
  • The posterior can then be used as the prior for future analyses, and can be repeated indefinitely
  • Bayesian machinery from simple cases can be extended to more complex cases
    • Just need a generative model and an assumption for the prior
    • Need a computational model that can scale easily

Example code includes:

# Generative zombie drug model
# Parameters
prop_success <- 0.42
n_zombies <- 100
# Simulating data
data <- c()
for(zombie in 1:n_zombies) {
  data[zombie] <- runif(1, min = 0, max = 1) < prop_success
}
data <- as.numeric(data)
data
##   [1] 1 1 1 1 0 1 0 1 1 1 0 0 0 1 0 0 1 1 0 1 1 0 1 1 1 1 0 0 1 0 1 1 1 1 1
##  [36] 0 1 0 0 0 1 0 0 0 1 1 1 1 1 0 1 0 1 1 1 0 0 1 0 1 0 1 1 1 0 1 1 0 0 0
##  [71] 0 0 1 0 0 0 0 0 0 0 0 0 0 1 0 0 0 0 0 0 0 1 0 1 0 1 0 0 0 0
data_counts <- sum(as.numeric(data))
data_counts
## [1] 46
# Try out rbinom
rbinom(n = 1, size = 100, prob = 0.42)
## [1] 31
# Try out rbinom
rbinom(n = 200, size = 100, prob = 0.42)
##   [1] 44 51 40 48 44 37 41 41 50 49 44 42 43 41 41 33 39 40 41 39 46 43 45
##  [24] 41 42 38 41 45 45 39 41 48 45 45 43 41 36 39 45 44 37 37 39 51 43 31
##  [47] 42 39 42 42 38 46 36 41 48 42 41 37 41 38 36 43 53 37 49 35 43 51 34
##  [70] 44 40 44 39 47 47 40 43 38 41 38 40 36 35 37 37 40 41 47 39 39 45 45
##  [93] 47 44 36 49 33 40 44 39 40 36 42 38 47 39 48 48 50 42 51 39 44 42 45
## [116] 38 44 40 40 41 40 46 43 40 46 49 40 48 43 43 39 39 41 44 45 43 43 41
## [139] 48 38 47 42 45 38 44 44 38 40 36 38 46 41 42 29 40 42 40 45 33 46 54
## [162] 47 36 49 41 41 39 40 44 43 52 41 38 38 45 49 49 39 47 40 42 37 43 46
## [185] 42 41 47 48 38 50 42 40 38 36 49 39 46 37 42 36
# Fill in the parameters
n_samples <- 100000
n_ads_shown <- 100
proportion_clicks <- 0.1
n_visitors <- rbinom(n_samples, size = n_ads_shown, prob = proportion_clicks)

# Visualize the results
hist(n_visitors)

# Update proportion_clicks
n_samples <- 100000
n_ads_shown <- 100
proportion_clicks <- runif(n = n_samples, min = 0.0, max = 0.2)
n_visitors <- rbinom(n = n_samples, size = n_ads_shown, prob = proportion_clicks)

# Visualize the results
hist(n_visitors)

hist(proportion_clicks)

# Create prior
prior <- data.frame(proportion_clicks, n_visitors)
head(prior)
##   proportion_clicks n_visitors
## 1       0.102175374          6
## 2       0.066737942          6
## 3       0.007708941          0
## 4       0.123223223         13
## 5       0.070207388          6
## 6       0.112998033          7
# Create posterior
posterior <- prior[prior$n_visitors==13, ]
hist(posterior$proportion_clicks)

prior <- posterior
head(prior)
##    proportion_clicks n_visitors
## 4          0.1232232         13
## 21         0.1409067         13
## 44         0.0885686         13
## 49         0.1316969         13
## 61         0.1619553         13
## 76         0.1349985         13
prior$n_visitors <- rbinom(nrow(prior), size=100, prob=prior$proportion_clicks)
hist(prior$n_visitors)

mean(prior$n_visitors >= 5)
## [1] 0.9867033

Chapter 3 - Why Use Bayesian Data Analysis?

Four good things with Bayes:

  • Many good tools exist for Bayesian analysis, and those will be covered in Chapter 5
  • The main reasons for Bayesian analysis are the flexibility and power
    • You can include information sources such as expertise in addition to the data
    • You can make any comparisons between groups or data sets
    • You can use the results of Bayesian analysis for Decision Analysis
    • You can change the underlying statistical model
  • Background information, common knowledge, or expertise can be incorporated in to the prior
    • Can also exclude all such information by assuming a uniform distribution for the prior
    • The beta distribution can be useful for a proportion, and is set based on alpha and beta

Contrasts and comparisons:

  • The more data, the more likely that the posterior is informed by the data than by the prior
  • There is often a benefit to comparing groups - for example, two different treatments or two different campaigns
    • Can compare the posterior distributions from the two groups, which is fairly simple since each distribution is contained in a vector
    • posterior\(prop_diff <- posterior\)video_prop - posterior$text_prop

Decision analysis:

  • Can calculate median, mean, credible interval, likelihood of more extreme than a certain parameter, etc.
  • The results of a Bayesian analysis can be used for Decision analysis
  • Can add dimensions such as cost and revenue, then compare profitability
    • video_cost <- 0.25
    • text_cost <- 0.05
    • visitor_spend <- 2.53
    • posterior\(video_profit <- posterior\)video_prop * visitor_spend - video_cost
    • posterior\(text_profit <- posterior\)text_prop * visitor_spend - text_cost
    • posterior\(profit_diff <- posterior\)video_profit - posterior$text_profit

Change anything and everything:

  • There can be large uncertainty as to the outcomes, particularly if the data sizes are small and the key metrics are close to the critical parameter
  • Can switch out the generating functions and re-run the approach - example of a banner that is pay-per-day rather than pay-per-impression
    • One option is to split each day in to 1440 minutes and assume a probability of success (1/0), which has drawbacks
    • In the limiting case of smaller and smaller slices, the Poisson distribution is created - has only a single parameter, the expected value of successes
    • n_clicks <- rpois(n = 100000, labmda = 20)

Bayes is optimal, kind of . . .

  • Bayesian analysis can be useful in many ways as shown in this chapter
  • Bayesian analysis is (kind of) optimal, provided that the generative model is perfectly precise and accurate
    • In the world defined by the model the Bayesian approach is optimal
    • However, no statistical model can ever be optimal in the real world

Example code includes:

# Draw from the beta distribution
beta_sample <- rbeta(n = 1000000, shape1 = 1, shape2 = 1)

# Explore the results
hist(beta_sample)

# Draw from the beta distribution
beta_sample <- rbeta(n = 10000, shape1 = 100, shape2 = 100)

# Explore the results
hist(beta_sample)

# Draw from the beta distribution
beta_sample <- rbeta(n = 10000, shape1 = 100, shape2 = 20)

# Explore the results
hist(beta_sample)

n_draws <- 100000
n_ads_shown <- 100

# Update proportion_clicks
proportion_clicks <- rbeta(n_draws, shape1 = 5, shape2 = 95)
n_visitors <- rbinom(n_draws, size = n_ads_shown, prob = proportion_clicks)
prior <- data.frame(proportion_clicks, n_visitors)
posterior <- prior[prior$n_visitors == 13, ]

# Plots the prior and the posterior in the same plot
par(mfcol = c(2, 1))
hist(prior$proportion_clicks, 
     xlim = c(0, 0.25))
hist(posterior$proportion_clicks, 
     xlim = c(0, 0.25))

# Reset mfcol below

# Define parameters
n_draws <- 100000
n_ads_shown <- 100
proportion_clicks <- runif(n_draws, min = 0.0, max = 0.2)
n_visitors <- rbinom(n = n_draws, size = n_ads_shown, prob = proportion_clicks)
prior <- data.frame(proportion_clicks, n_visitors)

# Create posteriors
posterior_video <- prior[prior$n_visitors == 13, ]
posterior_text <- prior[prior$n_visitors == 6, ]

# Visualize posteriors
hist(posterior_video$proportion_clicks, xlim = c(0, 0.25))
hist(posterior_text$proportion_clicks, xlim = c(0, 0.25))

posterior <- data.frame(video_prop = posterior_video$proportion_clicks[1:4000], 
                        text_prop  = posterior_text$proportion_click[1:4000]
                        )
    
# Create prop_diff
posterior$prop_diff <- posterior$video_prop - posterior$text_prop

# Plot your new column
hist(posterior$prop_diff)

# Explore prop_diff
median(posterior$prop_diff)
## [1] 0.06583102
mean(posterior$prop_diff > 0)
## [1] 0.947
visitor_spend <- 2.53
video_cost <- 0.25
text_cost <- 0.05

posterior$video_profit <- posterior$video_prop * visitor_spend - video_cost
posterior$text_profit <- posterior$text_prop * visitor_spend - text_cost
head(posterior)
##   video_prop  text_prop     prop_diff video_profit text_profit
## 1 0.11438338 0.06966232  0.0447210643   0.03938996  0.12624567
## 2 0.08828099 0.08925227 -0.0009712789  -0.02664909  0.17580825
## 3 0.13337523 0.03383959  0.0995356356   0.08743932  0.03561416
## 4 0.11821430 0.08126194  0.0369523543   0.04908217  0.15559272
## 5 0.10437450 0.07691290  0.0274615984   0.01406748  0.14458963
## 6 0.13520477 0.07912402  0.0560807510   0.09206808  0.15018378
hist(posterior$video_profit)

hist(posterior$text_profit)


posterior$profit_diff <- posterior$video_profit - posterior$text_profit
head(posterior)
##   video_prop  text_prop     prop_diff video_profit text_profit profit_diff
## 1 0.11438338 0.06966232  0.0447210643   0.03938996  0.12624567 -0.08685571
## 2 0.08828099 0.08925227 -0.0009712789  -0.02664909  0.17580825 -0.20245734
## 3 0.13337523 0.03383959  0.0995356356   0.08743932  0.03561416  0.05182516
## 4 0.11821430 0.08126194  0.0369523543   0.04908217  0.15559272 -0.10651054
## 5 0.10437450 0.07691290  0.0274615984   0.01406748  0.14458963 -0.13052216
## 6 0.13520477 0.07912402  0.0560807510   0.09206808  0.15018378 -0.05811570
hist(posterior$profit_diff)

median(posterior$profit_diff)
## [1] -0.03344751
mean(posterior$profit_diff < 0)
## [1] 0.6345
x <- rpois(n = 10000, lambda = 3)
hist(x)

x <- rpois(n = 10000, lambda = 11.5)
hist(x)

x <- rpois(n = 10000, lambda = 11.5)
mean(x >= 15)
## [1] 0.182
n_draws <- 100000
n_ads_shown <- 100
mean_clicks <- runif(n_draws, min = 0, max = 80)
n_visitors <- rpois(n_draws, lambda=mean_clicks)
                     
prior <- data.frame(mean_clicks, n_visitors)
posterior <- prior[prior$n_visitors == 19, ]

hist(prior$mean_clicks)
hist(posterior$mean_clicks)

# Reset to default
par(mfcol = c(1, 1))

Chapter 4 - Bayesian Inference with Bayes’ Theorem

Probability rules:

  • The computation method used so far does not scale well, but there are alternatives
  • Bayesian statistics is a hot research error, and there are many methods to get to the same results in a faster method
  • Probability is defined as a statement of certainty/uncertainty between 0 and 1 (may be a distribution or an allocation of probabilities over all possible values)
  • Conditional probabilities are often of interest - P(A | B) is the probability of A given that B has occurred
    • Can also get a conditional probability distribution
  • Sometimes probabilities can be summed - when they are exclusive and the goal is to get 1 of them
  • Sometimes probabilities can be multiplied - when they are independent and the goal is to get all of them

Calculating likelihoods:

  • Can simulate or calculate probabilities - simulate and count with a common generative model and small dataset, or calculate using an optimized formula
  • For common distributions, can use the density functions such as dbinom() to get the key probabilities in many cases
    • dbinom(13, size = 100, prob = 0.1) + dbinom(14, size = 100, prob = 0.1) # probability of getting 13 or 14 successes in 100 trials with success 0.1 per trial
    • n_visitors = seq(0, 100, by = 1)
    • probability <- dbinom(n_visitors, size = 100, prob = 0.1)
  • For continuous distributions such as the uniform, there is no specific probability of any given value
    • Probability densities are returned instead, and can be viewed as the relative probabilities

Bayesian calculation:

  • Conditioning on the observed data is at the core of Bayesian inference
  • Example of converting previous simulations to precise calculations
    • n_ads_shown <- 100
    • n_visitors <- seq(0, 100, by = 1) # full potential range of visitors based on ads
    • proportion_clicks <- seq(0, 1, by = 0.01) # fine grid of values even if it does not fully sample the given space
    • pars <- expand.grid(proportion_clicks = proportion_clicks, n_visitors = n_visitors) # all possible combinations of n_visitors and proportion_clicks
    • pars\(prior <- dunif(pars\)proportion_clicks, min = 0, max = 0.2) # prior is of uniform density
    • pars\(likelihood <- dbinom(pars\)n_visitors, size = n_ads_shown, prob = pars$proportion_clicks) # likelihood given the rows in pars
    • pars\(probability <- pars\)likelihood * pars$prior # unscaled posterior probability
    • pars\(probability <- pars\)probability / sum(pars$probability) # normalized posterior probability
    • pars <- pars[pars$n_visitors == 13, ] # filter on the 13 observed clicks
    • pars\(probability <- pars\)probability / sum(pars$probability) # normalize remaining probs to 1

Bayes theorem:

  • An example of Bayes’ theorem is provided above by the multiplication of the prior and the probability
    • pars\(probability <- pars\)likelihood * pars$prior
    • pars\(probability <- pars\)probability / sum(pars$probability)
    • This is an example of p(Param | Data) = P(Data | Param) * P(Param Before Seeing Data) / sum-of-all-numerators
  • The grid approximation technique was used above - cannot ever get all parameters for a continuous distribution
  • Can use mathematical notations where = is a point parameter and ~ is follows a specific distribution

Example code includes:

prob_to_draw_ace <- 4 / 52
prob_to_draw_four_aces <- (4 / 52) * (3 / 51) * (2 / 50) * (1 / 49)


n_ads_shown <- 100
proportion_clicks <- 0.1
n_visitors <- rbinom(n = 99999, 
    size = n_ads_shown, prob = proportion_clicks)
prob_13_visitors <- sum(n_visitors == 13) / length(n_visitors)
prob_13_visitors
## [1] 0.07536075
prob_13_visitors <- dbinom(x=13, size=n_ads_shown, prob=proportion_clicks)
prob_13_visitors
## [1] 0.07430209
n_ads_shown <- 100
proportion_clicks <- 0.1
n_visitors <- 0:n_ads_shown
prob <- dbinom(n_visitors, 
    size = n_ads_shown, prob = proportion_clicks)
prob
##   [1]  2.656140e-05  2.951267e-04  1.623197e-03  5.891602e-03  1.587460e-02
##   [6]  3.386580e-02  5.957873e-02  8.889525e-02  1.148230e-01  1.304163e-01
##  [11]  1.318653e-01  1.198776e-01  9.878801e-02  7.430209e-02  5.130383e-02
##  [16]  3.268244e-02  1.929172e-02  1.059153e-02  5.426525e-03  2.602193e-03
##  [21]  1.170987e-03  4.956559e-04  1.977617e-04  7.451890e-05  2.656461e-05
##  [26]  8.972934e-06  2.875940e-06  8.758007e-07  2.537042e-07  6.998736e-08
##  [31]  1.840408e-08  4.617512e-09  1.106279e-09  2.532895e-10  5.545880e-11
##  [36]  1.161994e-11  2.331161e-12  4.480309e-13  8.253201e-14  1.457830e-14
##  [41]  2.470212e-15  4.016606e-16  6.269305e-17  9.395858e-18  1.352434e-18
##  [46]  1.870032e-19  2.484342e-20  3.171501e-21  3.890962e-22  4.587982e-23
##  [51]  5.199713e-24  5.664175e-25  5.930440e-26  5.967739e-27  5.771270e-28
##  [56]  5.363200e-29  4.788572e-30  4.107157e-31  3.383290e-32  2.676049e-33
##  [61]  2.031815e-34  1.480375e-35  1.034671e-36  6.934301e-38  4.454325e-39
##  [66]  2.741123e-40  1.615140e-41  9.106926e-43  4.910597e-44  2.530420e-45
##  [71]  1.245128e-46  5.845669e-48  2.616117e-49  1.114936e-50  4.520010e-52
##  [76]  1.741041e-53  6.363454e-55  2.203794e-56  7.220406e-58  2.234162e-59
##  [81]  6.516307e-61  1.787738e-62  4.602579e-64  1.109055e-65  2.493907e-67
##  [86]  5.216014e-69  1.010856e-70  1.807405e-72  2.966699e-74  4.444493e-76
##  [91]  6.035732e-78  7.369636e-80  8.010474e-82  7.656367e-84  6.335055e-86
##  [96]  4.445653e-88  2.572716e-90  1.178793e-92  4.009500e-95  9.000000e-98
## [101] 1.000000e-100
plot(x=n_visitors, y=prob, type="h")

n_ads_shown <- 100
proportion_clicks <- seq(0, 1, by = 0.01)
n_visitors <- 13
prob <- dbinom(n_visitors, 
    size = n_ads_shown, prob = proportion_clicks)
prob
##   [1]  0.000000e+00  2.965956e-11  1.004526e-07  8.009768e-06  1.368611e-04
##   [6]  1.001075e-03  4.265719e-03  1.247940e-02  2.764481e-02  4.939199e-02
##  [11]  7.430209e-02  9.703719e-02  1.125256e-01  1.178532e-01  1.129620e-01
##  [16]  1.001234e-01  8.274855e-02  6.419966e-02  4.701652e-02  3.265098e-02
##  [21]  2.158348e-02  1.362418e-02  8.234325e-03  4.775927e-03  2.663369e-03
##  [26]  1.430384e-03  7.408254e-04  3.704422e-04  1.790129e-04  8.366678e-05
##  [31]  3.784500e-05  1.657584e-05  7.032793e-06  2.891291e-06  1.151996e-06
##  [36]  4.448866e-07  1.665302e-07  6.041614e-08  2.124059e-08  7.234996e-09
##  [41]  2.386939e-09  7.624614e-10  2.357105e-10  7.048636e-11  2.037726e-11
##  [46]  5.691404e-12  1.534658e-12  3.991862e-13  1.000759e-13  2.415778e-14
##  [51]  5.609229e-15  1.251336e-15  2.678760e-16  5.495443e-17  1.078830e-17
##  [56]  2.023515e-18  3.620178e-19  6.166397e-20  9.980560e-21  1.531703e-21
##  [61]  2.223762e-22  3.046572e-23  3.927965e-24  4.752038e-25  5.377247e-26
##  [66]  5.671478e-27  5.554432e-28  5.030231e-29  4.193404e-30  3.201904e-31
##  [71]  2.227032e-32  1.402449e-33  7.942805e-35  4.015572e-36  1.797200e-37
##  [76]  7.054722e-39  2.403574e-40  7.024314e-42  1.737424e-43  3.582066e-45
##  [81]  6.048981e-47  8.199196e-49  8.713462e-51  7.062754e-53  4.226413e-55
##  [86]  1.795925e-57  5.170371e-60  9.521923e-63  1.044590e-65  6.239308e-69
##  [91]  1.807405e-72  2.180415e-76  8.911963e-81  9.240821e-86  1.591196e-91
##  [96]  2.358848e-98 1.001493e-106 1.546979e-117 8.461578e-133 6.239651e-159
## [101]  0.000000e+00
plot(x=proportion_clicks, y=prob, type="h")

n_ads_shown <- 100
proportion_clicks <- seq(0, 1, by = 0.01)
n_visitors <- seq(0, 100, by = 1)
pars <- expand.grid(proportion_clicks = proportion_clicks,
                    n_visitors = n_visitors)
pars$prior <- dunif(pars$proportion_clicks, min = 0, max = 0.2)
pars$likelihood <- dbinom(pars$n_visitors, 
    size = n_ads_shown, prob = pars$proportion_clicks)
pars$probability <- pars$likelihood * pars$prior
pars$probability <- pars$probability / sum(pars$probability)
pars_conditioned <- pars[pars$n_visitors==6, ]
pars_conditioned$probability <- pars_conditioned$probability / sum(pars_conditioned$probability)
plot(x=pars_conditioned$proportion_clicks, y=pars_conditioned$probability, type="h")

# Simplify slightly for a known result of 6
n_ads_shown <- 100
proportion_clicks <- seq(0, 1, by = 0.01)
n_visitors <- 6
pars <- expand.grid(proportion_clicks = proportion_clicks,
                    n_visitors = n_visitors)
pars$prior <- dunif(pars$proportion_clicks, min = 0, max = 0.2)
pars$likelihood <- dbinom(pars$n_visitors, 
    size = n_ads_shown, prob = pars$proportion_clicks)
pars$probability <- pars$likelihood * pars$prior
pars$probability <- pars$probability / sum(pars$probability)
plot(pars$proportion_clicks, pars$probability, type = "h")


Chapter 5 - More Parameters, Data, and Bayes

Temperature in a normal lake:

  • Example of having some water data temperature for a given day
    • temp <- c(19, 23, 20, 17, 23)
    • The normal distribution could be a good candidate for the generative function in this case - parameters with mu and sigma
    • rnorm(n = , mean = , sd = )
    • dnorm(x = , mean = , sd = )
    • like <- dnorm(x = temp, mean = 20, sd = 2) # likelihood of our observed temperatures given a mean of 20 and a standard deviation of 2
    • prod(like) # joint likelihood of probabilities
    • log(like) # addresses the problem of likelihoods being so small that computer precision becomes an issue

Bayesian model of water temperature:

  • Can define priors such as sigma ~Uniform(0, 10) and mean ~ N(18, 5)
  • Can then run an additional grid-approximation exercise
    • temp <- c(19, 23, 20, 17, 23)
    • mu <- seq(8, 30, by = 0.5)
    • sigma <- seq(0.1, 10, by = 0.3)
    • pars <- expand.grid(mu = mu, sigma = sigma))
    • pars\(mu_prior <- dnorm(pars\)mu, mean = 18, sd = 5)
    • pars\(sigma_prior <- dunif(pars\)sigma, min = 0, max = 10)
    • pars\(prior <- pars\)mu_prior * pars$sigma_prior
    • for(i in 1:nrow(pars)) {
    • likelihoods <- dnorm(temp, pars\(mu[i], pars\)sigma[i])
    • pars$likelihood[i] <- prod(likelihoods)
    • }
    • pars\(probability <- pars\)likelihood * pars$prior
    • pars\(probability <- pars\)probability / sum(pars$probability)

Beach party implications of water temperatures:

  • Suppose that there is aminimum water temperature for holding a beach party and that we want the probability of exceedence of this temperature
  • It is helpful to create a frame for further analysis; random sampling, weighted by probability, can help
    • sample_indices <- sample( 1:nrow(pars), size = 10000, replace = TRUE, prob = pars$probability) # draw some random samples proportional to each row’s probability
    • pars_sample <- pars[sample_indices, c(“mu”, “sigma”)]
    • hist(pars_sample$mu, 30)
    • pred_temp <- rnorm(10000, mean = pars_sample\(mu, sd = pars_sample\)sigma)
    • hist(pred_temp, 30)
    • sum(pred_temp >= 18) / length(pred_temp )

Practical tool (BEST):

  • Models are often available off-the-shelf which can save time; one example is BEST by John Kruschke
    • BEST assumes that data come from a t-distribution (more or less a normal distribution with the degrees of freedom added)
    • BEST estimates standard deviation, mean, and degrees of freedom
    • BEST uses MCMC (Markov chain Monte Carlo)
  • Can fit the data directly using BEST
    • library(BEST)
    • iq <- c(55, 44, 34, 18, 51, 40, 40, 49, 48, 46)
    • fit <- BESTmcmc(iq)
    • fit # note that nu is the degrees of freedom
    • plot(fit)

Wrap and up and next steps:

  • Bayesian inference as a technique for modeling uncertainty - data, generative model, and prior probability distributions
  • Can use sampling and grid approximation to calculate probabilities and distributions
    • Under-the-hood, used MCMC as implemented by way of BEST
  • Additional areas for exploration include full application of Bayesian approaches to time series, deep learning, and the like
  • Can also add more advanced computational models

Example code includes:

mu <- 3500
sigma <- 600

weight_distr <- rnorm(n = 100000, mean = mu, sd = sigma)
hist(weight_distr, xlim = c(0, 6000), col = "lightgreen")

mu <- 3500
sigma <- 600

weight <- seq(0, 6000, by=100)
likelihood <- dnorm(weight, mean=mu, sd=sigma)

plot(x=weight, y=likelihood, type="h")

# The IQ of a bunch of zombies
iq <- c(55, 44, 34, 18, 51, 40, 40, 49, 48, 46)
# Defining the parameter grid
pars <- expand.grid(mu = seq(0, 150, length.out = 100), 
                    sigma = seq(0.1, 50, length.out = 100))
# Defining and calculating the prior density for each parameter combination
pars$mu_prior <- dnorm(pars$mu, mean = 100, sd = 100)
pars$sigma_prior <- dunif(pars$sigma, min = 0.1, max = 50)
pars$prior <- pars$mu_prior * pars$sigma_prior
# Calculating the likelihood for each parameter combination
for(i in 1:nrow(pars)) {
  likelihoods <- dnorm(iq, pars$mu[i], pars$sigma[i])
  pars$likelihood[i] <- prod(likelihoods)
}
# Calculating the probability of each parameter combination
pars$probability <- pars$likelihood * pars$prior / sum(pars$likelihood * pars$prior)
lattice::levelplot(probability ~ mu * sigma, data = pars)

head(pars)
##         mu sigma    mu_prior sigma_prior        prior likelihood
## 1 0.000000   0.1 0.002419707  0.02004008 4.849113e-05          0
## 2 1.515152   0.1 0.002456367  0.02004008 4.922578e-05          0
## 3 3.030303   0.1 0.002493009  0.02004008 4.996010e-05          0
## 4 4.545455   0.1 0.002529617  0.02004008 5.069373e-05          0
## 5 6.060606   0.1 0.002566174  0.02004008 5.142633e-05          0
## 6 7.575758   0.1 0.002602661  0.02004008 5.215754e-05          0
##   probability
## 1           0
## 2           0
## 3           0
## 4           0
## 5           0
## 6           0
sample_indices <- sample( nrow(pars), size = 10000,
    replace = TRUE, prob = pars$probability)
head(sample_indices)
## [1] 2827 2728 3025 3126 4035 4727
pars_sample <- pars[sample_indices, c("mu", "sigma")]
hist(pars_sample$mu)

quantile(pars_sample$mu, c(0.025, 0.5, 0.975))
##     2.5%      50%    97.5% 
## 34.84848 42.42424 50.00000
head(pars_sample)
##            mu    sigma
## 2827 39.39394 14.21313
## 2728 40.90909 13.70909
## 3025 36.36364 15.22121
## 3126 37.87879 15.72525
## 4035 51.51515 20.26162
## 4727 39.39394 23.78990
pred_iq <- rnorm(10000, mean = pars_sample$mu, sd = pars_sample$sigma)
hist(pred_iq)

mean(pred_iq >= 60)
## [1] 0.0886
# The IQ of zombies on a regular diet and a brain based diet.
iq_brains <- c(44, 52, 42, 66, 53, 42, 55, 57, 56, 51)
iq_regular <- c(55, 44, 34, 18, 51, 40, 40, 49, 48, 46)
mean(iq_brains) - mean(iq_regular)
## [1] 9.3
# Need to load http://www.sourceforge.net/projects/mcmc-jags/files for rjags (called by BEST)
# library(BEST)
# best_posterior <- BESTmcmc(iq_brains, iq_regular)
# plot(best_posterior)

Categorical Data in the Tidyverse

Chapter 1 - Introduction to Factor Variables

Introduction to qualitative variables:

  • Identifying and inspecting categorical data, using the forcats package, effective visualization
  • Qualitative data in this course will include categorical data and ordianl data
    • Each have a fixed and known set of possible values - ordinal adds that there is an ordering, though no specific meaning such that 1 vs 2 and 2 vs 3 may be different distances
  • Categorical data is generally best converted to factors iff there is a finite set of potential values
  • Can check for factors using is.factor()

Understanding your qualitative variables:

  • Data is from the Kaggle 2017 data science survey
  • High-level summaries include category names and levels; converting to factors can be valuable
    • multipleChoiceResponses %>% mutate_if(is.character, as.factor) # nice function! Run the mutate only if the first condition (is.character) holds
    • nlevels(multipleChoiceResponses$LearningDataScienceTime) # number of levels
    • levels(multipleChoiceResponses$LearningDataScienceTime) # level names
    • multipleChoiceResponses %>% summarise_if(is.factor, nlevels) # run summarize only for the factors

Making better plots:

  • Can use forcats::fct_reorder() to reorder data for plotting - fct_reorder(factor, orderingCriteria)
    • ggplot(WorkChallenges) + geom_point(aes(x = fct_reorder(question, perc_problem), y = perc_problem))
  • Can use forcats::fct_infreq() to order based on frequency and reverse the order using forcats::fct_rev() as needed
    • ggplot(multiple_choice_responses) + geom_bar(aes(x = fct_infreq(CurrentJobTitleSelect))
    • ggplot(multiple_choice_responses) + geom_bar(aes(x = fct_rev(fct_infreq(CurrentJobTitleSelect))))

Example code includes:

multiple_choice_answers <- readr::read_csv("./RInputFiles/smc_with_js.csv")
## Parsed with column specification:
## cols(
##   .default = col_character(),
##   Age = col_integer()
## )
## See spec(...) for full column specifications.
# Print out the dataset
glimpse(multiple_choice_answers)
## Observations: 16,716
## Variables: 47
## $ LearningPlatformUsefulnessArxiv             <chr> NA, NA, "Very usef...
## $ LearningPlatformUsefulnessBlogs             <chr> NA, NA, NA, "Very ...
## $ LearningPlatformUsefulnessCollege           <chr> NA, NA, "Somewhat ...
## $ LearningPlatformUsefulnessCompany           <chr> NA, NA, NA, NA, NA...
## $ LearningPlatformUsefulnessConferences       <chr> "Very useful", NA,...
## $ LearningPlatformUsefulnessFriends           <chr> NA, NA, NA, "Very ...
## $ LearningPlatformUsefulnessKaggle            <chr> NA, "Somewhat usef...
## $ LearningPlatformUsefulnessNewsletters       <chr> NA, NA, NA, NA, NA...
## $ LearningPlatformUsefulnessCommunities       <chr> NA, NA, NA, NA, NA...
## $ LearningPlatformUsefulnessDocumentation     <chr> NA, NA, NA, "Very ...
## $ LearningPlatformUsefulnessCourses           <chr> NA, NA, "Very usef...
## $ LearningPlatformUsefulnessProjects          <chr> NA, NA, NA, "Very ...
## $ LearningPlatformUsefulnessPodcasts          <chr> "Very useful", NA,...
## $ LearningPlatformUsefulnessSO                <chr> NA, NA, NA, NA, NA...
## $ LearningPlatformUsefulnessTextbook          <chr> NA, NA, NA, NA, "S...
## $ LearningPlatformUsefulnessTradeBook         <chr> "Somewhat useful",...
## $ LearningPlatformUsefulnessTutoring          <chr> NA, NA, NA, NA, NA...
## $ LearningPlatformUsefulnessYouTube           <chr> NA, NA, "Very usef...
## $ CurrentJobTitleSelect                       <chr> "DBA/Database Engi...
## $ MLMethodNextYearSelect                      <chr> "Random Forests", ...
## $ WorkChallengeFrequencyPolitics              <chr> "Rarely", NA, NA, ...
## $ WorkChallengeFrequencyUnusedResults         <chr> NA, NA, NA, "Often...
## $ WorkChallengeFrequencyUnusefulInstrumenting <chr> NA, NA, NA, "Often...
## $ WorkChallengeFrequencyDeployment            <chr> NA, NA, NA, "Often...
## $ WorkChallengeFrequencyDirtyData             <chr> NA, NA, NA, "Often...
## $ WorkChallengeFrequencyExplaining            <chr> NA, NA, NA, "Often...
## $ WorkChallengeFrequencyPass                  <chr> NA, NA, NA, NA, NA...
## $ WorkChallengeFrequencyIntegration           <chr> NA, NA, NA, "Often...
## $ WorkChallengeFrequencyTalent                <chr> NA, NA, NA, "Often...
## $ WorkChallengeFrequencyDataFunds             <chr> NA, NA, NA, "Often...
## $ WorkChallengeFrequencyDomainExpertise       <chr> NA, NA, NA, "Most ...
## $ WorkChallengeFrequencyML                    <chr> NA, NA, NA, "Often...
## $ WorkChallengeFrequencyTools                 <chr> NA, NA, NA, "Often...
## $ WorkChallengeFrequencyExpectations          <chr> NA, NA, NA, "Often...
## $ WorkChallengeFrequencyITCoordination        <chr> NA, NA, NA, NA, "S...
## $ WorkChallengeFrequencyHiringFunds           <chr> NA, NA, NA, "Often...
## $ WorkChallengeFrequencyPrivacy               <chr> "Often", NA, NA, "...
## $ WorkChallengeFrequencyScaling               <chr> "Most of the time"...
## $ WorkChallengeFrequencyEnvironments          <chr> NA, NA, NA, "Often...
## $ WorkChallengeFrequencyClarity               <chr> NA, NA, NA, "Often...
## $ WorkChallengeFrequencyDataAccess            <chr> NA, NA, NA, "Often...
## $ WorkChallengeFrequencyOtherSelect           <chr> NA, NA, NA, NA, NA...
## $ WorkInternalVsExternalTools                 <chr> "Do not know", NA,...
## $ FormalEducation                             <chr> "Bachelor's degree...
## $ Age                                         <int> NA, 30, 28, 56, 38...
## $ DataScienceIdentitySelect                   <chr> "Yes", "Yes", "Yes...
## $ JobSatisfaction                             <chr> "5", NA, NA, "10 -...
# Check if CurrentJobTitleSelect is a factor
is.factor(multiple_choice_answers$CurrentJobTitleSelect)
## [1] FALSE
# mutate() and summarise() in dplyr both have variants where you can add the suffix if, all, or at to change the operation
# mutate_if() applies a function to all columns where the first argument is true
# mutate_all() applies a function to all columns
# mutate_at() affects columns selected with a character vector or select helpers (e.g. mutate_at(c("height", "weight"), log))

# Change all the character columns to factors
responses_as_factors <- multiple_choice_answers %>%
    mutate_if(is.character, as.factor)

# Make a two column dataset with variable names and number of levels
number_of_levels <- responses_as_factors %>%
    summarise_all(nlevels) %>%
    gather(variable, num_levels)


# dplyr has two other functions that can come in handy when exploring a dataset
# The first is top_n(x, var), which gets us the first x rows of a dataset based on the value of var
# The other is pull(), which allows us to extract a column and take out the name, leaving only the value(s) from the column

# Select the 4 rows with the highest number of levels
number_of_levels %>%
    top_n(4, num_levels)
## # A tibble: 4 x 2
##   variable               num_levels
##   <chr>                       <int>
## 1 CurrentJobTitleSelect          16
## 2 MLMethodNextYearSelect         25
## 3 FormalEducation                 7
## 4 JobSatisfaction                11
# How many levels does CurrentJobTitleSelect have? 
number_of_levels %>%
    filter(variable=="CurrentJobTitleSelect") %>%
    pull(num_levels)
## [1] 16
# Get the names of the levels of CurrentJobTitleSelect
responses_as_factors %>%
    pull(CurrentJobTitleSelect) %>%
    levels()
##  [1] "Business Analyst"                    
##  [2] "Computer Scientist"                  
##  [3] "Data Analyst"                        
##  [4] "Data Miner"                          
##  [5] "Data Scientist"                      
##  [6] "DBA/Database Engineer"               
##  [7] "Engineer"                            
##  [8] "Machine Learning Engineer"           
##  [9] "Operations Research Practitioner"    
## [10] "Other"                               
## [11] "Predictive Modeler"                  
## [12] "Programmer"                          
## [13] "Researcher"                          
## [14] "Scientist/Researcher"                
## [15] "Software Developer/Software Engineer"
## [16] "Statistician"
# Make a bar plot
ggplot(multiple_choice_answers, aes(x=FormalEducation)) + 
    geom_bar() + 
    coord_flip()

# Make a bar plot
ggplot(multiple_choice_answers, aes(x=fct_rev(fct_infreq(FormalEducation)))) + 
    geom_bar() + 
    coord_flip()

multiple_choice_answers %>%
  filter(!is.na(Age) & !is.na(FormalEducation)) %>%
  group_by(FormalEducation) %>%
  summarize(mean_age = mean(Age)) %>%
  ggplot(aes(x = fct_reorder(FormalEducation, mean_age), y = mean_age)) + 
    geom_point() + 
    coord_flip()


Chapter 2 - Manipulating Factor Variables

Reordering factors:

  • Can order by frequency or by another variable for pure categorical variables
  • For ordinal variables, typically is best to order by the implied order inside the ordinal variable - can manually enter using fct_relevel()
    • ggplot(aes(nlp_frequency, x = fct_relevel(response, “Rarely”, “Sometimes”, “Often”, “Most of the time”))) + geom_bar()
    • nlp_frequency %>% pull(response) %>% levels()
    • nlp_frequency %>% mutate(response = fct_relevel(response, “Often”, “Most of the time”)) %>% pull(response) %>% levels() # This moves Often and Most of the time to the front, leaving others alone
    • nlp_frequency %>% mutate(response = fct_relevel(response, “Often”, “Most of the time”, after = 2)) %>% pull(response) %>% levels() # move these to after 2
    • nlp_frequency %>% mutate(response = fct_relevel(response, “Often”, “Most of the time”, after = Inf) %>% pull(response) %>% levels() # move this to the end

Renaming factor levels:

  • Can convert names for factor levels using forcats::fct_recode()
    • levels(flying_etiquette$middle_arm_rest_three) # get the initial levels
    • ggplot(flying_etiquette, aes(x = fct_infreq(middle_arm_rest_three))) + geom_bar() + coord_flip() + labs(x = “Arm rest opinions”) # labels are very wordy, graph is compressed
    • flying_etiquette %>% mutate(middle_arm_rest_three = fct_recode(middle_arm_rest_three,
    • “Other” = “Other (please specify)”, “Everyone should share” = “The arm rests should be shared”,
    • “Aisle and window people” = “The people in the aisle and window seats get both arm rests”,
    • “Middle person” = “The person in the middle seat gets both arm rests”,
    • “Fastest person” = “Whoever puts their arm on the arm rest first”)
    • ) %>%
    • count(middle_arm_rest_three)

Collapsing factor levels:

  • Can collapse factor levels using forcats::fct_collapse()
    • flying_etiquette %>% mutate(height = fct_collapse(height, under_5_3 = c(“Under 5 ft.”, “5’0"”, “5’1"”, “5’2"”), over_6_1 = c(“6’1"”, “6’2"”, “6’3"”, “6’4"”, “6’5"”, “6’6" and above”))) %>% pull(height) %>% levels()
  • Can collapse factor levels to other using forcats::fct_other()
    • flying_etiquette %>% mutate(new_height = fct_other(height, keep = c(“6’4"”, “5’1"”))) %>% count(new_height) # will make everything other than keep in to Other
    • flying_etiquette %>% mutate(new_height = fct_other(height, drop = c(“Under 5 ft.”, “5’0"”, “5’1"”, “5’2"”, “5’3"”))) %>% pull(new_height) %>% levels() # will move the drop items to Other
    • flying_etiquette %>% mutate(new_height = fct_lump(height, prop = .08)) %>% count(new_height) # anything less than a proportion of 0.08 will be moved to other
    • flying_etiquette %>% mutate(new_height = fct_lump(height, n = 3)) %>% count(new_height) # keep the top 3 categories

Example code includes:

multiple_choice_responses <- multiple_choice_answers

# Print the levels of WorkInternalVsExternalTools
levels(multiple_choice_responses$WorkInternalVsExternalTools)
## NULL
# Reorder the levels from internal to external 
mc_responses_reordered <- multiple_choice_responses %>%
    mutate(WorkInternalVsExternalTools = fct_relevel(WorkInternalVsExternalTools, 
                                                     c('Entirely internal', 'More internal than external',
                                                       'Approximately half internal and half external', 
                                                       'More external than internal', 'Entirely external',
                                                       'Do not know'
                                                       )
                                                     )
           )

# Make a bar plot of the responses
ggplot(mc_responses_reordered, aes(x=WorkInternalVsExternalTools)) + 
    geom_bar() + 
    coord_flip()

multiple_choice_responses %>%
    # Move "I did not complete any formal education past high school" and "Some college/university study without earning a bachelor's degree" to the front
    mutate(FormalEducation = fct_relevel(FormalEducation, c("I did not complete any formal education past high school", "Some college/university study without earning a bachelor's degree"))) %>%
    # Move "Doctoral degree" to be the sixth level
    mutate(FormalEducation = fct_relevel(FormalEducation, after=6, "Doctoral degree")) %>%
    # Move "I prefer not to answer" to be the last level.
    mutate(FormalEducation = fct_relevel(FormalEducation, after=Inf, "I prefer not to answer")) %>%
    # Examine the new level order
    pull(FormalEducation) %>%
    levels()
## [1] "I did not complete any formal education past high school"         
## [2] "Some college/university study without earning a bachelor's degree"
## [3] "Bachelor's degree"                                                
## [4] "Master's degree"                                                  
## [5] "Professional degree"                                              
## [6] "Doctoral degree"                                                  
## [7] "I prefer not to answer"
# make a bar plot of the frequency of FormalEducation
ggplot(multiple_choice_responses, aes(x=FormalEducation)) + 
    geom_bar()

multiple_choice_responses %>%
    # rename levels
    mutate(FormalEducation = fct_recode(FormalEducation, "High school" ="I did not complete any formal education past high school", "Some college" = "Some college/university study without earning a bachelor's degree")) %>%
    # make a bar plot of FormalEducation
    ggplot(aes(x=FormalEducation)) + 
    geom_bar()

multiple_choice_responses %>%
    # Create new variable, grouped_titles, by collapsing levels in CurrentJobTitleSelect
    mutate(grouped_titles = fct_collapse(CurrentJobTitleSelect, 
        "Computer Scientist" = c("Programmer", "Software Developer/Software Engineer"), 
        "Researcher" = "Scientist/Researcher", 
        "Data Analyst/Scientist/Engineer" = c("DBA/Database Engineer", "Data Scientist", 
                                              "Business Analyst", "Data Analyst", 
                                              "Data Miner", "Predictive Modeler"))) %>%
    # Turn every title that isn't now one of the grouped_titles into "Other"
    mutate(grouped_titles = fct_other(grouped_titles, 
                             keep = c("Computer Scientist", 
                                     "Researcher", 
                                     "Data Analyst/Scientist/Engineer"))) %>% 
    # Get a count of the grouped titles
    count(grouped_titles)
## # A tibble: 5 x 2
##   grouped_titles                      n
##   <fct>                           <int>
## 1 Data Analyst/Scientist/Engineer  4928
## 2 Computer Scientist               2556
## 3 Researcher                       1597
## 4 Other                            2749
## 5 <NA>                             4886
multiple_choice_responses %>%
  # remove NAs of MLMethodNextYearSelect
  filter(!is.na(MLMethodNextYearSelect)) %>%
  # create ml_method, which lumps all those with less than 5% of people into "Other"
  mutate(ml_method = fct_lump(MLMethodNextYearSelect, prop=0.05)) %>%
  # print the frequency of your new variable in descending order
  count(ml_method, sort=TRUE)
## # A tibble: 4 x 2
##   ml_method                n
##   <fct>                <int>
## 1 Other                 4405
## 2 Deep learning         4362
## 3 Neural Nets           1386
## 4 Time Series Analysis   680
multiple_choice_responses %>%
  # remove NAs 
  filter(!is.na(MLMethodNextYearSelect)) %>%
  # create ml_method, retaining the 5 most common methods and renaming others "other method" 
  mutate(ml_method = fct_lump(MLMethodNextYearSelect, 5, other_level="other method")) %>%
  # print the frequency of your new variable in descending order
  count(ml_method, sort=TRUE)
## # A tibble: 6 x 2
##   ml_method                n
##   <fct>                <int>
## 1 Deep learning         4362
## 2 other method          3401
## 3 Neural Nets           1386
## 4 Time Series Analysis   680
## 5 Bayesian Methods       511
## 6 Text Mining            493

Chapter 3 - Creating Factor Variables

Examining common themed variables:

  • Tidy data has each row as an observation and each column as a variable (generally, moving from wide to long)
    • multipleChoiceResponses %>% select(contains(“WorkChallengeFrequency”)) %>% gather(work_challenge, frequency)
    • work_challenges <- multipleChoiceResponses %>% select(contains(“WorkChallengeFrequency”)) %>% gather(work_challenge, frequency) %>%
    • mutate(work_challenge = str_remove(work_challenge, “WorkChallengeFrequency”)) # will remove the string “WorkChallengeFrequency” from column work_challenge
  • Can also convert the variables to 0/1 and then use for statistical summaries
    • work_challenges %>% filter(!is.na(frequency)) %>% mutate(frequency = if_else( frequency %in% c(“Most of the time”, “Often”), 1, 0) ) %>%
    • group_by(work_challenge) %>% summarise(perc_problem = mean(frequency))

Tricks of ggplot2:

  • Initial plots may not look so good, for example
    • ggplot(job_titles_by_perc, aes(x = CurrentJobTitleSelect,, y = perc_w_title)) + geom_point()
  • Can angle the tick axes for better readability
    • ggplot(job_titles_by_perc, aes(x = CurrentJobTitleSelect, y = perc_w_title)) + geom_point() + theme(axis.text.x = element_text(angle = 90, hjust = 1))
  • Can reorder by oreder of popularity using fct_reorder
    • ggplot(job_titles_by_perc, aes(x = fct_reorder(CurrentJobTitleSelect, perc_w_title), y = perc_w_title)) + geom_point() + theme(axis.text.x = element_text(angle = 90, hjust = 1))
    • ggplot(job_titles_by_perc, aes(x = fct_rev(fct_reorder(CurrentJobTitleSelect, perc_w_title)), y = perc_w_title)) + geom_point() + theme(axis.text.x = element_text(angle = 90, hjust = 1))
  • Can add axis labels and titles using labs()
    • g <- ggplot(job_titles_by_perc, aes(x = fct_rev(fct_reorder(CurrentJobTitleSelect, perc_w_title)), y = perc_w_title)) + geom_point() + theme(axis.text.x = element_text(angle = 90, hjust = 1))
    • g <- g + labs(x = “Job Title”, y = “Percent with title”)
  • Can change the y-axis ticks to be explicit percentages
    • g + scale_y_continuous(labels = scales::percent_format())

Changing and creating variables with dplyr::case_when():

  • Suppose that there is a simple vector to be recoded using simple business rules
    • x <- 1:20
    • case_when(x %% 15 == 0 ~ “fizz buzz”, x %% 3 == 0 ~ “fizz”, x %% 5 == 0 ~ “buzz”, TRUE ~ as.character(x) ) # TRUE is the all others
  • Conditions evaluate from first to last, and the first matching condition is acted on for that value
    • moods %>% mutate(action = case_when( mood == “happy” & status == “know it” ~ “clap your hands”, mood == “happy” & status == “do not know it” ~ “stomp your feet”, mood == “sad” ~ “look at puppies”, TRUE ~ “jump around”)

Example code includes:

learning_platform_usefulness <- multiple_choice_responses %>%
  # select columns with LearningPlatformUsefulness in title
  select(contains("LearningPlatformUsefulness")) %>%
  # change data from wide to long
  gather(learning_platform, usefulness) %>%
  # remove rows where usefulness is NA
  filter(!is.na(usefulness)) %>%
  # remove "LearningPlatformUsefulness" from each string in `learning_platform 
  mutate(learning_platform = str_remove(learning_platform, "LearningPlatformUsefulness"))


learning_platform_usefulness %>%
  # change dataset to one row per learning_platform usefulness pair with number of entries for each
  count(learning_platform, usefulness) %>%
  # use add_count to create column with total number of answers for that learning_platform
  add_count(learning_platform, wt=n) %>%
  # create a line graph for each question with usefulness on x-axis and percentage of responses on y
  ggplot(aes(x = usefulness, y = n/nn, group = learning_platform)) + 
  geom_line() + 
  facet_wrap(~ learning_platform)

avg_usefulness <- learning_platform_usefulness %>%
    # If usefulness is "Not Useful", make 0, else 1 
    mutate(usefulness = ifelse(usefulness=="Not Useful", 0, 1)) %>%
    # Get the average usefulness by learning platform 
    group_by(learning_platform) %>%
    summarize(avg_usefulness = mean(usefulness))

# Make a scatter plot of average usefulness by learning platform 
ggplot(avg_usefulness, aes(x=learning_platform, y=avg_usefulness)) + 
    geom_point()

ggplot(avg_usefulness, aes(x = learning_platform, y = avg_usefulness)) + 
    geom_point() + 
    # rotate x-axis text by 90 degrees
    theme(axis.text.x = element_text(angle = 90, hjust = 1)) + 
    # rename y and x axis labels
    labs(x="Learning Platform", y="Percent finding at least somewhat useful") + 
    # change y axis scale to percentage
    scale_y_continuous(labels = scales::percent)

ggplot(avg_usefulness, 
       aes(x = fct_rev(fct_reorder(learning_platform, avg_usefulness)), y = avg_usefulness)
       ) + 
    geom_point() + 
    theme(axis.text.x = element_text(angle = 90, hjust = 1)) + 
    labs(x = "Learning Platform", y = "Percent finding at least somewhat useful") + 
    scale_y_continuous(labels = scales::percent)

# Check the min age
min(multiple_choice_responses$Age, na.rm=TRUE)
## [1] 0
# Check the max age
max(multiple_choice_responses$Age, na.rm=TRUE)
## [1] 100
sum(is.na(multiple_choice_responses$Age))
## [1] 331
multiple_choice_responses %>%
    # Eliminate any ages below 10 and above 90
    filter(between(Age, 10, 90)) %>%
    # Create the generation variable based on age
    mutate(generation=case_when(
      between(Age, 10, 22) ~ "Gen Z", 
      between(Age, 23, 37) ~ "Gen Y", 
      between(Age, 38, 52) ~ "Gen X", 
      between(Age, 53, 71) ~ "Baby Boomer", 
      between(Age, 72, 90) ~ "Silent"
    )) %>%
    # Get a count of how many answers in each generation
    count(generation)
## # A tibble: 5 x 2
##   generation      n
##   <chr>       <int>
## 1 Baby Boomer   832
## 2 Gen X        3162
## 3 Gen Y       10281
## 4 Gen Z        2037
## 5 Silent         37
multiple_choice_responses %>%
    # Filter out people who selected Data Scientist as their Job Title
    filter(!is.na(CurrentJobTitleSelect) & CurrentJobTitleSelect != "Data Scientist")  %>%
    # Create a new variable, job_identity
    mutate(job_identity = case_when(
        CurrentJobTitleSelect == "Data Analyst" & DataScienceIdentitySelect == "Yes" ~ "DS analysts", 
        CurrentJobTitleSelect == "Data Analyst" & DataScienceIdentitySelect %in% c("No", "Sort of (Explain more)") ~ "NDS analyst", 
        CurrentJobTitleSelect != "Data Analyst" & DataScienceIdentitySelect == "Yes" ~ "DS non-analysts", 
        TRUE ~ "NDS non analysts")
        ) %>%
    mutate(JobSat=case_when(
        is.na(JobSatisfaction) ~ NA_integer_,
        JobSatisfaction == "I prefer not to share" | JobSatisfaction == "NA" ~ NA_integer_, 
        JobSatisfaction == "1 - Highly Dissatisfied" ~ 1L, 
        JobSatisfaction == "10 - Highly Satisfied" ~ 10L, 
        TRUE ~ as.integer(JobSatisfaction))) %>%
    # Get the average job satisfaction by job_identity, removing NAs
    group_by(job_identity) %>%
    summarize(avg_js = mean(JobSat, na.rm=TRUE))
## Warning in eval_bare(f[[3]], env): NAs introduced by coercion
## # A tibble: 4 x 2
##   job_identity     avg_js
##   <chr>             <dbl>
## 1 DS analysts        6.44
## 2 DS non-analysts    6.93
## 3 NDS analyst        6.14
## 4 NDS non analysts   6.43

Chapter 4 - Case Study on Flight Etiquette

Case study introduction:

  • Recreation of 538 dataset on flying etiquette
  • Need to begin by converting variable types and tidying the data and selecting key columns
    • wide_data %>% mutate_if(is.character, as.factor)
    • wide_data %>% gather(column, value)
    • wide_data %>% select(contains(“favorite”))

Data preparation and regex:

  • Names will need to be changed to something more succinct for plotting
    • gathered_data %>% distinct(response_var)
  • Regular expressions can be used in any computing language to find instances of general patterns
    • str_detect(“happy”, “.”) # the . Will match anything
    • str_detect(“happy”, “h.”) # TRUE
    • str_detect(“happy”, “y.”) # FALSE, since nothing follows the y
    • str_remove(string, “.*the “) # will remove everything up to and including the followed by a space

Recreating the plot:

  • The labs() command allows for both a caption and a subtitle
    • ggplot(mtcars, aes(disp, mpg)) + geom_point() + labs(x = “x axis label”, y = “y axis label”, title = “My title”, subtitle = “and a subtitle”, caption = “even a caption!”)
  • The geom_text() layer allows for adding the specific numbers to the plot
    • initial_plot + geom_text(aes(label = round(mean_mpg)))
    • initial_plot + geom_text(aes(label = round(mean_mpg), y = mean_mpg + 2)) # fix the issue where the text is on top of the tip of the bar
  • Can use the theme layer to modify the non-data layers of the plot
    • initial_plot + geom_text(aes(label = round(mean_mpg), y = mean_mpg + 2)) + theme(axis.text.x = element_blank(), axis.ticks.x = element_blank()) # get rid of x and y ticks

End of course recap:

  • Basic forcats functions
  • Tidyverse functions
  • ggplot2 tricks
  • Recreating the 538 plot for airplane rudeness behaviors

Example code includes:

flying_etiquette <- read.csv("./RInputFiles/flying-etiquette.csv", stringsAsFactors = FALSE)
names(flying_etiquette) <- 
    stringr::str_replace_all(stringr::str_replace_all(names(flying_etiquette), "\\.", " "), "  ", " ")
names(flying_etiquette) <- stringr::str_trim(names(flying_etiquette))
names(flying_etiquette)[2:22] <- paste0(names(flying_etiquette)[2:22], "?")
names(flying_etiquette) <- stringr::str_replace_all(names(flying_etiquette), "itrude", "it rude")
glimpse(flying_etiquette)
## Observations: 1,040
## Variables: 27
## $ RespondentID                                                                                                                              <dbl> ...
## $ `How often do you travel by plane?`                                                                                                       <chr> ...
## $ `Do you ever recline your seat when you fly?`                                                                                             <chr> ...
## $ `How tall are you?`                                                                                                                       <chr> ...
## $ `Do you have any children under 18?`                                                                                                      <chr> ...
## $ `In a row of three seats who should get to use the two arm rests?`                                                                        <chr> ...
## $ `In a row of two seats who should get to use the middle arm rest?`                                                                        <chr> ...
## $ `Who should have control over the window shade?`                                                                                          <chr> ...
## $ `Is it rude to move to an unsold seat on a plane?`                                                                                        <chr> ...
## $ `Generally speaking is it rude to say more than a few words tothe stranger sitting next to you on a plane?`                               <chr> ...
## $ `On a 6 hour flight from NYC to LA how many times is it acceptable to get up if you re not in an aisle seat?`                             <chr> ...
## $ `Under normal circumstances does a person who reclines their seat during a flight have any obligation to the person sitting behind them?` <chr> ...
## $ `Is it rude to recline your seat on a plane?`                                                                                             <chr> ...
## $ `Given the opportunity would you eliminate the possibility of reclining seats on planes entirely?`                                        <chr> ...
## $ `Is it rude to ask someone to switch seats with you in order to be closer to friends?`                                                    <chr> ...
## $ `Is it rude to ask someone to switch seats with you in order to be closer to family?`                                                     <chr> ...
## $ `Is it rude to wake a passenger up if you are trying to go to the bathroom?`                                                              <chr> ...
## $ `Is it rude to wake a passenger up if you are trying to walk around?`                                                                     <chr> ...
## $ `In general is it rude to bring a baby on a plane?`                                                                                       <chr> ...
## $ `In general is it rude to knowingly bring unruly children on a plane?`                                                                    <chr> ...
## $ `Have you ever used personal electronics during take off or landing in violation of a flight attendant s direction?`                      <chr> ...
## $ `Have you ever smoked a cigarette in an airplane bathroom when it was against the rules?`                                                 <chr> ...
## $ Gender                                                                                                                                    <chr> ...
## $ Age                                                                                                                                       <chr> ...
## $ `Household Income`                                                                                                                        <chr> ...
## $ Education                                                                                                                                 <chr> ...
## $ `Location Census Region`                                                                                                                  <chr> ...
gathered_data <- flying_etiquette %>%
    mutate_if(is.character, as.factor) %>%
    filter(`How often do you travel by plane?` != "Never") %>%
    # Select columns containing "rude"
    select(contains("rude")) %>%
    # Change format from wide to long
    gather(response_var, value)
## Warning: attributes are not identical across measure variables;
## they will be dropped
rude_behaviors <- gathered_data %>%
    mutate(response_var = str_replace(response_var, '.*rude to ', '')) %>%
    mutate(response_var = str_replace(response_var, 'on a plane', '')) %>%
    mutate(rude = if_else(value %in% c("No, not rude at all", "No, not at all rude"), 0, 1)) %>%
    # Create perc_rude, the percent considering each behavior rude
    group_by(response_var) %>%
    summarize(perc_rude=mean(rude))

rude_behaviors
## # A tibble: 9 x 2
##   response_var                                                   perc_rude
##   <chr>                                                              <dbl>
## 1 ask someone to switch seats with you in order to be closer to~     0.193
## 2 ask someone to switch seats with you in order to be closer to~     0.278
## 3 bring a baby ?                                                     0.323
## 4 knowingly bring unruly children ?                                  0.832
## 5 move to an unsold seat ?                                           0.211
## 6 recline your seat ?                                                0.426
## 7 say more than a few words tothe stranger sitting next to you ?     0.228
## 8 wake a passenger up if you are trying to go to the bathroom?       0.388
## 9 wake a passenger up if you are trying to walk around?              0.741
# Create an ordered by plot of behavior by percentage considering it rude
initial_plot <- ggplot(rude_behaviors, aes(x=fct_reorder(response_var, perc_rude), y=perc_rude)) +
geom_col()

# View your plot
initial_plot

titled_plot <- initial_plot + 
    # Add the title, subtitle, and caption
    labs(title = "Hell Is Other People In A Pressurized Metal Tube",
         subtitle = "Percentage of 874 air-passenger respondents who said action is very or somewhat rude",
         caption = "Source: SurveyMonkey Audience", 
         # Remove the x- and y-axis labels
         x="",
         y=""
         ) 

titled_plot

flipped_plot <- titled_plot + 
    # Flip the axes
    coord_flip() + 
    # Remove the x-axis ticks and labels
    theme(axis.ticks.x = element_blank(), 
        axis.text.x = element_blank())

flipped_plot + 
    # Add labels above the bar with the perc value
    geom_text(aes(label = paste0(round(100*perc_rude), "%"), y = perc_rude + .03), 
              position = position_dodge(0.9), vjust = 1)


Bayesian Modeling with RJAGS

Chapter 1 - Introduction to Bayesian Modeling

Prior model:

  • Goals include foundational Bayesian models such as Beta-Binomial, Normal-Normal, and Bayesian regression
    • Define, compile, simulate using RJAGS
    • Conduct Bayesian posterior inference using RJAGS
  • Example of election poll - there is some uncertainty around the polling figures that have been released
    • An additional poll might tend to update the prior model that was built using the previous elections data
    • Bayesian posterior models are a powerful means of combining priors and data
  • The prior model depends on some specific assumptions and notations
    • Suppose that p is the percentage of people who support you - assumed to be a random variable between 0 and 1
    • The prior model for p is p ~ Beta(45, 55)
    • The beta model can be tuned from pessimism Beta(1, 5) to complete uncertainty Beta(1, 1)

Data and likelihood:

  • Suppose that a candidate running for election does a small poll and finds 6 of 10 plan to vote for them
    • Can integrate even a small data sample like this with assumptions and priors
    • Assumptions might include that voters are independent and p is a global probability that any given voter supports you
    • Then, X ~ Bin(n, p) which is to say that X can be defined as the number of n polled voters that support you (assuming per above global probability p)
  • There is a dependence between X, n, and p, thus the data can help to assess how likely each of the values of p may be given that you observed X in n
    • The likelihood function is the likelihood of observing X given that p takes on a specific value

Posterior model:

  • The prior and the likelihood can be integrated to form the posterior
    • The prior is knowledge that exists before data and the likelihood is what exists based on the data
    • Multiply prior and likelihood and then scale so probabilities add to 1
  • The RJAGS package combines R with JAGS (Just Another Gibbs Sampler) - requires downloading JAGS and then loading rjags
  • Can define the model within RJAGS, for example
    • vote_model <- “model{
    • # Likelihood model for X
    • X ~ dbin(p, n) # order of n and p are reversed (known difference for RJAGS)
    • # Prior model for p
    • p ~ dbeta(a, b)
    • }"
    • vote_jags_A <- jags.model(textConnection(vote_model), data = list(a = 45, b = 55, X = 6, n = 10), inits = list(.RNG.name = “base::Wichmann-Hill”, .RNG.seed = 100))
    • vote_sim <- coda.samples(model = vote_jags, variable.names = c(“p”), n.iter = 10000) # variable.names is the variable of interest, which is p in this case
    • plot(vote_sim, trace = FALSE)

Example code includes:

# Make sure you have installed JAGS-4.x.y.exe (for any x >=0, y>=0) from http://www.sourceforge.net/projects/mcmc-jags/files

# Sample 10000 draws from Beta(45,55) prior
prior_A <- rbeta(n = 10000, shape1 = 45, shape2 = 55)

# Store the results in a data frame
prior_sim <- data.frame(prior_A)

# Construct a density plot of the prior sample
ggplot(prior_sim, aes(x = prior_A)) + 
    geom_density()    


# Sample 10000 draws from the Beta(1,1) prior
prior_B <- rbeta(n = 10000, shape1 = 1, shape2 = 1)    

# Sample 10000 draws from the Beta(100,100) prior
prior_C <- rbeta(n = 10000, shape1 = 100, shape2 = 100)

# Combine the results in a single data frame
prior_sim <- data.frame(samples = c(prior_A, prior_B, prior_C),
        priors = rep(c("A","B","C"), each = 10000))

# Plot the 3 priors
ggplot(prior_sim, aes(x = samples, fill = priors)) + 
    geom_density(alpha = 0.5)


# Define a vector of 1000 p values    
p_grid <- seq(0, 1, length.out=1000)

# Simulate 1 poll result for each p in p_grid   
poll_result <- rbinom(1000, 10, prob=p_grid)

# Create likelihood_sim data frame
likelihood_sim <- data.frame(p_grid, poll_result)    

# Density plots of p_grid grouped by poll_result
ggplot(likelihood_sim, aes(x = p_grid, y = poll_result, group = poll_result)) + 
    ggridges::geom_density_ridges()


# Density plots of p_grid grouped by poll_result
ggplot(likelihood_sim, aes(x = p_grid, y = poll_result, group = poll_result, fill = poll_result==6)) + 
    ggridges::geom_density_ridges()

# Keep the polls with X = 6    
likelihood_sim_6 <- likelihood_sim %>%     
    filter(poll_result==6)    

# Construct a density plot of the remaining p_grid values
ggplot(likelihood_sim_6, aes(x = p_grid)) + 
    geom_density() + 
    lims(x = c(0,1))


# DEFINE the model
vote_model <- "model{
    # Likelihood model for X
    X ~ dbin(p, n)
    
    # Prior model for p
    p ~ dbeta(a, b)
}"

# COMPILE the model    
vote_jags <- jags.model(textConnection(vote_model), 
    data = list(a = 45, b = 55, X = 6, n = 10),
    inits = list(.RNG.name = "base::Wichmann-Hill", .RNG.seed = 100))

# SIMULATE the posterior
vote_sim <- coda.samples(model = vote_jags, variable.names = c("p"), n.iter = 10000)

# PLOT the posterior
plot(vote_sim, trace = FALSE)


# COMPILE the model    
vote_jags <- jags.model(textConnection(vote_model), 
    data = list(a = 1, b = 1, X = 6, n = 10),
    inits = list(.RNG.name = "base::Wichmann-Hill", .RNG.seed = 100))

# SIMULATE the posterior
vote_sim <- coda.samples(model = vote_jags, variable.names = c("p"), n.iter = 10000)

# PLOT the posterior
plot(vote_sim, trace = FALSE, xlim = c(0,1), ylim = c(0,18))


# COMPILE the model    
vote_jags <- jags.model(textConnection(vote_model), 
    data = list(a = 1, b = 1, X = 220, n = 400),
    inits = list(.RNG.name = "base::Wichmann-Hill", .RNG.seed = 100))

# SIMULATE the posterior
vote_sim <- coda.samples(model = vote_jags, variable.names = c("p"), n.iter = 10000)

# PLOT the posterior
plot(vote_sim, trace = FALSE, xlim = c(0,1), ylim = c(0,18))


# COMPILE the model    
vote_jags <- jags.model(textConnection(vote_model), 
    data = list(a = 45, b = 55, X = 220, n = 400),
    inits = list(.RNG.name = "base::Wichmann-Hill", .RNG.seed = 100))

# SIMULATE the posterior
vote_sim <- coda.samples(model = vote_jags, variable.names = c("p"), n.iter = 10000)

# PLOT the posterior
plot(vote_sim, trace = FALSE, xlim = c(0,1), ylim = c(0,18))

Chapter 2 - Bayesian Models and Markov Chains

Normal-Normal Model:

  • Example of reaction times in a sleep deprivation study
    • Y(i) ~ N(m, s2) meaning change in reaction time for subject I, assumed to be normally distributed as N(m, s2)
    • Prior information is that normal reaction time is 250 and is expected to increase by 0-150 after sleep deprivation (scale of the prior)
    • The prior for the mean might then be defined as 50 ms increase in reaction time with a standard deviation of 25
    • The prior for the standard deviation might then be uniform on 0-200
  • Overall formulation of the sleep study model includes
    • Y(i) ~ N(m, s**2)
    • m ~ N(50, 25**2)
    • s ~ Unif(0, 200)

Simulating Normal-Normal in RJAGS:

  • Posterior insights are based on the product of the prior and the data, which can be simulated using RJAGS
    • sleep_model <- “model{
    • # Likelihood model for Y[i]
    • for(i in 1:length(Y)) {
    •   Y[i] ~ dnorm(m, s^(-2))  # requires precision which can be defined as the inverse of sigma-squared  
    • }
    • # Prior models for m and s
    • m ~ dnorm(50, 25^(-2)) # requires precision which can be defined as the inverse of sigma-squared
    • s ~ dunif(0, 200)
    • }"
    • sleep_jags <- jags.model(textConnection(sleep_model), data = list(Y = sleep_study$diff_3), inits = list(.RNG.name = “base::Wichmann-Hill”, .RNG.seed = 1989))
    • sleep_sim <- coda.samples(model = sleep_jags, variable.names = c(“m”, “s”), n.iter = 10000)

Markov chains:

  • The RJAGS approach is approximating parameters based on Monte Carlo Markov Chains (MCMC)
    • The goal of RJAGS is to use Markov chains to estimate (approximate) posteriors that would otherwise be too complicated to model
  • Each iteration of a Markov chain depends on the previous iteration (the iterations are not entirely random or independent)
    • Over time, the Markov chain explores the sample space, but the exploration is often over a smaller range for smaller intervals (there are auto-corelations)
    • The overall distribution of the Markov chain mimics a random sampling drawn from the posterior distribution

Markov chain diagnostics and reproducibility:

  • The trace plots indicate the longitudinal behavior of the chain while the density plots indicate the distribution of the chain
  • Questions about what makes for a good chain (convergence, trials needed, etc.)
    • Stability is good - long-run trends should be stabilized
    • Multiple parallel chains should return very similar results with similar features (should not be overly dependent on RNG/seed)
    • summary(sleep_sim) # provides key Markov chain diagnostics
  • Generally, problems with Markov chains can be addressed with longer chains (more iterations)
  • Helpful to set the seed and RNG in the model for reproducibility
    • inits = list(.RNG.name = “base::Wichmann-Hill”, .RNG.seed = 1989) # example inside jags.model()

Example code includes:

# Take 10000 samples from the m prior
prior_m <- rnorm(10000, 50, 25)

# Take 10000 samples from the s prior    
prior_s <- runif(10000, 0, 200)

# Store samples in a data frame
samples <- data.frame(prior_m, prior_s)

# Density plots of the prior_m & prior_s samples    
ggplot(samples, aes(x = prior_m)) + 
    geom_density()
ggplot(samples, aes(x = prior_s)) + 
    geom_density()


# Check out the first 6 rows of sleep_study
head(sleep_study)

# Define diff_3
sleep_study <- sleep_study %>%
  mutate(diff_3=day_3-day_0)

# Histogram of diff_3    
ggplot(sleep_study, aes(x = diff_3)) + 
    geom_histogram(binwidth = 20, color = "white")

# Mean and standard deviation of diff_3    
sleep_study %>%
  summarize(mean(diff_3), sd(diff_3))


# DEFINE the model    
sleep_model <- "model{
    # Likelihood model for Y[i]
    for(i in 1:length(Y)) {
        Y[i] ~ dnorm(m, s^(-2))
    }

    # Prior models for m and s
    m ~ dnorm(50, 25^(-2))
    s ~ dunif(0, 200)
}"    

# COMPILE the model
sleep_jags <- jags.model(textConnection(sleep_model), data = list(Y = sleep_study$diff_3),
    inits = list(.RNG.name = "base::Wichmann-Hill", .RNG.seed = 1989))    

# SIMULATE the posterior    
sleep_sim <- coda.samples(model = sleep_jags, variable.names = c("m", "s"), n.iter = 10000)

# PLOT the posterior    
plot(sleep_sim, trace = FALSE)    


# Let m be the average change in reaction time after 3 days of sleep deprivation
# In a previous exercise, you obtained an approximate sample of 10,000 draws from the posterior model of m
# You stored the resulting mcmc.list object as sleep_sim which is loaded in your workspace:
# In fact, the sample of m values in sleep_sim is a dependent Markov chain, the distribution of which converges to the posterior
# You will examine the contents of sleep_sim and, to have finer control over your analysis, store the contents in a data frame

# Check out the head of sleep_sim
head(sleep_sim)

# Store the chains in a data frame
sleep_chains <- data.frame(sleep_sim[[1]], iter = 1:10000)

# Check out the head of sleep_chains
head(sleep_chains)


# NOTE: The 10,000 recorded Iterations start after a "burn-in" period in which samples are discarded
# Thus the Iterations count doesn't start at 1!

# Use plot() to construct trace plots of the m and s chains
plot(sleep_sim, density=FALSE)

# Use ggplot() to construct a trace plot of the m chain
ggplot(sleep_chains, aes(x = iter, y = m)) + 
    geom_line()

# Trace plot the first 100 iterations of the m chain
ggplot(dplyr::filter(sleep_chains, iter<=100), aes(x = iter, y = m)) + geom_line()

# Note that the longitudinal behavior of the chain appears quite random and that the trend remains relatively constant
# This is a good thing - it indicates that the Markov chain (likely) converges quickly to the posterior distribution of m


# Use plot() to construct density plots of the m and s chains
plot(sleep_sim, trace=FALSE)

# Use ggplot() to construct a density plot of the m chain
ggplot(sleep_chains, aes(x = m)) + 
    geom_density()

# Density plot of the first 100 values in the m chain
ggplot(dplyr::filter(sleep_chains, iter<=100), aes(x = m)) + 
    geom_density()


# COMPILE the model
sleep_jags_multi <- jags.model(textConnection(sleep_model), data = list(Y = sleep_study$diff_3), n.chains=4)   

# SIMULATE the posterior    
sleep_sim_multi <- coda.samples(model = sleep_jags_multi, variable.names = c("m", "s"), n.iter = 1000)

# Check out the head of sleep_sim_multi
head(sleep_sim_multi)

# Construct trace plots of the m and s chains
plot(sleep_sim_multi, density=FALSE)


# The mean of the m Markov chain provides an estimate of the posterior mean of m
# The naive standard error provides a measure of the estimate's accuracy.

# Suppose your goal is to estimate the posterior mean of m within a standard error of 0.1 ms
# If the observed naive standard error exceeds this target, no problem!
# You can simply run a longer chain


# SIMULATE the posterior    
sleep_sim_1 <- coda.samples(model = sleep_jags, variable.names = c("m", "s"), n.iter = 1000)

# Summarize the m and s chains of sleep_sim_1
summary(sleep_sim_1)

# RE-SIMULATE the posterior    
sleep_sim_2 <- coda.samples(model = sleep_jags, variable.names = c("m", "s"), n.iter = 10000)

# Summarize the m and s chains of sleep_sim_2
summary(sleep_sim_2)


# COMPILE the model
sleep_jags <- jags.model(textConnection(sleep_model), data = list(Y = sleep_study$diff_3), inits = list(.RNG.name = "base::Wichmann-Hill", .RNG.seed = 1989)) 

# SIMULATE the posterior    
sleep_sim <- coda.samples(model = sleep_jags, variable.names = c("m", "s"), n.iter = 10000)

# Summarize the m and s chains of sleep_sim
summary(sleep_sim)

Chapter 3 - Bayesian Inference and Prediction

Simple Bayesian Regression Model:

  • The simple Bayesian regression lays the ground work for more complicated modeling built on it
  • Suppose that the goal is to model human weights, and that they are N(m, s**2)
    • Y(i) ~ N(m(i), s**2) # m(i) is an average weight that depends on height
    • m(i) = a + b*X(i) where X(i) is the height of individual i
  • Can specify Bayesian model with priors
    • a = intercept ~ N(0, 200**2)
    • b = slope (expected to be positive) ~ N(1, 0.5**2)
    • s = residual standard deviation ~ Unif(0, 20)

Bayesian Regression in RJAGS:

  • The basic lm() regression will give the parameters based on linear regression
  • Can instead define the Bayesian linear regression for RJAGS
    • Within RJAGS, [i] means that it varies for each subject, i
    • Within RJAGS, <- means there is an exact mathematical formula that does not need to be estimated
    • weight_model <- “model{
    • # Likelihood model for Y[i]
    • for(i in 1:length(Y)) {
    •   Y[i] ~ dnorm(m[i], s^(-2))  
    •   m[i] <- a + b * X[i]  
    • }
    • # Prior models for a, b, s
    • a ~ dnorm(0, 200^(-2))
    • b ~ dnorm(1, 0.5^(-2))
    • s ~ dunif(0, 20)
    • }"
    • weight_jags <- jags.model(textConnection(weight_model), data = list(X = bdims\(hgt, Y = bdims\)wgt), inits = list(.RNG.name = “base::Wichmann-Hill”, .RNG.seed = 2018))
    • weight_sim <- coda.samples(model = weight_jags, variable.names = c(“a”, “b”, “s”), n.iter = 10000)
  • Options for addressing the Markov chain instability include
    • Standardize the height predictor
    • Increase the chain length

Posterior estimation and inference:

  • Bayesian regression using RJAGS provided estimates for the slope and intercept parameters
  • The posterior densities can be summarized for better communication - for example, point estimates based on means
  • Can also plot the lines corresponding to each pair of slope, intercepts - can further create “credible intervals”
    • The 95% credible intervals are the middle 95% of the densities for each of the parameters (slope and intercept)
  • Can also assess frequencies of exceedence for parameters
    • table(weight_chains$b > 1.1)

Posterior prediction:

  • Based on simulations, the posterior mean trend was estimated
    • Can use the final coefficients to make estimates about the population
    • Could instead model the regression based on each set of coefficients included in the chain, including calculating the credible interval
  • Rather than using the regression to find means, the goal may be to predict an individual
    • Plug in the data as per finding the mean
    • The residual standard deviation (s) can then be used inside chain, using all of the a, b, s, data

Example code includes:

# Note the 3 parameters in the model of weight by height: intercept a, slope b, & standard deviation s
# In the first step of your Bayesian analysis, you will simulate the following prior models for these parameters: a ~ N(0, 200^2), b ~ N(1, 0.5^2), and s ~ Unif(0, 20)

# Take 10000 samples from the a, b, & s priors
prior_a <- rnorm(10000, 0, 200)
prior_b <- rnorm(10000, 1, 0.5)
prior_s <- runif(10000, 0, 20)

# Store samples in a data frame
samples <- data.frame(prior_a, prior_b, prior_s, set=1:10000)

# Construct density plots of the prior samples    
ggplot(samples, aes(x = prior_a)) + 
    geom_density()
ggplot(samples, aes(x = prior_b)) + 
    geom_density()
ggplot(samples, aes(x = prior_s)) + 
    geom_density()


# Replicate the first 12 parameter sets 50 times each
prior_scenarios_rep <- bind_rows(replicate(n = 50, expr = samples[1:12, ], simplify = FALSE)) 

# Simulate 50 height & weight data points for each parameter set
prior_simulation <- prior_scenarios_rep %>% 
    mutate(height = rnorm(600, 170, 10)) %>% 
    mutate(weight = rnorm(600, prior_a + prior_b*height, prior_s))

# Plot the simulated data & regression model for each parameter set
ggplot(prior_simulation, aes(x = height, y = weight)) + 
    geom_point() + 
    geom_smooth(method = "lm", se = FALSE, size = 0.75) + 
    facet_wrap(~ set)


# The bdims data set from the openintro package is loaded in your workspace
# bdims contains physical measurements on a sample of 507 individuals, including their weight in kg (wgt) and height in cm (hgt)

# Construct a scatterplot of wgt vs hgt
ggplot(bdims, aes(x = hgt, y = wgt)) + 
    geom_point()

# Add a model smooth
ggplot(bdims, aes(x = hgt, y = wgt)) + 
    geom_point() + 
    geom_smooth(method = "lm", se = FALSE)
    
# Obtain the sample regression model
wt_model <- lm(wgt ~ hgt, data = bdims)

# Summarize the model
summary(wt_model)


# DEFINE the model    
weight_model <- "model{
    # Likelihood model for Y[i]
    for(i in 1:length(Y)) {
        Y[i] ~ dnorm(m[i], s^(-2))
        m[i] <- a + b * X[i]
    }

    # Prior models for a, b, s
    a ~ dnorm(0, 200^(-2))
    b ~ dnorm(1, 0.5^(-2))
    s ~ dunif(0, 20)
}"

# COMPILE the model
weight_jags <- jags.model(textConnection(weight_model), data = list(X=bdims$hgt, Y=bdims$wgt), 
                  inits = list(.RNG.name = "base::Wichmann-Hill", .RNG.seed = 1989))

# COMPILE the model
weight_jags <- jags.model(textConnection(weight_model), data = list(Y = bdims$wgt, X = bdims$hgt), 
                          inits = list(.RNG.name = "base::Wichmann-Hill", .RNG.seed = 1989))

# SIMULATE the posterior    
weight_sim <- coda.samples(model = weight_jags, variable.names = c("a", "b", "s"), n.iter = 1000)

# PLOT the posterior    
plot(weight_sim)


# A 100,000 iteration RJAGS simulation of the posterior, weight_sim_big, is in your workspace along with a data frame of the Markov chain output:
head(weight_chains, 2)

# The posterior means of the intercept & slope parameters, a & b, reflect the posterior mean trend in the relationship between weight & height
# In contrast, the full posteriors of a & b reflect the range of plausible parameters, thus posterior uncertainty in the trend
# You will examine the trend and uncertainty in this trend below
# The bdims data are in your workspace

# Summarize the posterior Markov chains
summary(weight_sim_big)

# Calculate the estimated posterior mean of b
mean(weight_chains$b)

# Plot the posterior mean regression model
ggplot(bdims, aes(x=hgt, y=wgt)) + 
    geom_point() + 
    geom_abline(intercept = mean(weight_chains$a), slope = mean(weight_chains$b), color = "red")

# Visualize the range of 20 posterior regression models
ggplot(bdims, aes(x=hgt, y=wgt)) + 
    geom_point() + 
    geom_abline(intercept = weight_chains$a[1:20], slope = weight_chains$b[1:20], color = "gray", size = 0.25)


# Summarize the posterior Markov chains
summary(weight_sim_big)

# Calculate the 95% posterior credible interval for b
quantile(weight_chains$b, c(0.025, 0.975))

# Calculate the 90% posterior credible interval for b
quantile(weight_chains$b, c(0.05, 0.95))

# Mark the 90% credible interval 
ggplot(weight_chains, aes(x = b)) + 
    geom_density() + 
    geom_vline(xintercept = quantile(weight_chains$b, c(0.05, 0.95)), color = "red")


# Mark 1.1 on a posterior density plot for b
ggplot(weight_chains, aes(x=b)) + 
    geom_density() + 
    geom_vline(xintercept = 1.1, color = "red")

# Summarize the number of b chain values that exceed 1.1
table(weight_chains$b > 1.1)

# Calculate the proportion of b chain values that exceed 1.1 
mean(weight_chains$b > 1.1)


# Calculate the trend under each Markov chain parameter set
weight_chains <- weight_chains %>% 
    mutate(m_180 = a + b*180)

# Construct a posterior density plot of the trend
ggplot(weight_chains, aes(x = m_180)) + 
    geom_density() 

# Calculate the average trend
mean(weight_chains$m_180)

# Construct a posterior credible interval for the trend
quantile(weight_chains$m_180, c(0.025, 0.975))


# Simulate 1 prediction under the first parameter set
rnorm(1, mean=weight_chains$m_180[1], sd=weight_chains$s[1])

# Simulate 1 prediction under the second parameter set
rnorm(1, mean=weight_chains$m_180[2], sd=weight_chains$s[2])

# Simulate & store 1 prediction under each parameter set
weight_chains <- weight_chains  %>% 
    mutate(Y_180=rnorm(nrow(weight_chains), mean=m_180, sd=s))

# Print the first 6 parameter sets & predictions
head(weight_chains)


# Construct a density plot of the posterior predictions
ggplot(weight_chains, aes(x=Y_180)) + 
    geom_density() + 
    geom_vline(xintercept = quantile(weight_chains$Y_180, c(0.025, 0.975)), color = "red")

# Construct a posterior credible interval for the prediction
quantile(weight_chains$Y_180, c(0.025, 0.975))

# Visualize the credible on a scatterplot of the data
ggplot(bdims, aes(x=hgt, y=wgt)) + 
    geom_point() + 
    geom_abline(intercept = mean(weight_chains$a), slope = mean(weight_chains$b), color = "red") + 
    geom_segment(x = 180, xend = 180, y = quantile(weight_chains$Y_180, c(0.025)), yend = quantile(weight_chains$Y_180, c(0.975)), color = "red")

Chapter 4 - Multivariate and Generalized Linear Models

Bayesian regression with categorical predictor:

  • Can incorporate categorical predictors in to the Bayesian regressions
  • Example of usage of a rail-trail in MA
    • Y[i] ~ N(m[i], s**2) where [i] is the day - assumed to have varying means but constant standard deviations
    • X[i] is a 1/0 variable where 1 is for weekdays and 0 is for weekends
    • m[i] = a + b*X[i], meaning that a is the typical weekend volume and a+b is the typical weekday volume
    • The prior will be a ~ N(400, 1002) and b ~ N(0, 2002) and s ~ Unif(0, 200)
  • Can then define the model using RJAGS
    • rail_model_1 <- “model{
    • # Likelihood model for Y[i]
    • for(i in 1:length(Y)) {
    •   Y[i] ~ dnorm(m[i], s^(-2))  
    •   m[i] <- a + b[X[i]]  
    • }
    • # Prior models for a, b, s
    • a ~ dnorm(400, 100^(-2))
    • s ~ dunif(0, 200)
    • b[1] <- 0
    • b[2] ~ dnorm(0, 200^(-2))
    • }"
    • Note that b[1] <- 0 is because we want m[i] = a for the reference level; b[2], the second level, is what we want to model

Multivariate Bayesian regression:

  • Bayesian models can be generalized to multivariate models, for example
    • Y[i] ~ N(m[i], s**2) where [i] is the day - assumed to have varying means but constant standard deviations
    • X[i] is a 1/0 variable where 1 is for weekdays and 0 is for weekends
    • Z[i] is the high temperatue on day [i] in degrees F
    • m[i] = a + bX[i] + cZ[i]
    • a ~ N(0, 2002), b ~ N(0, 2002), c ~ N(0, 20**2), s ~ Unif(0, 200)
  • Can then define and simulate this model using RJAGS
    • rail_model_2 <- “model{
    • # Likelihood model for Y[i]
    • for(i in 1:length(Y)) {
    •   Y[i] ~ dnorm(m[i], s^(-2))  
    •   m[i] <- a + b[X[i]] + c * Z[i]  
    • }
    • # Prior models for a, b, c, s
    • a ~ dnorm(0, 200^(-2))
    • b[1] <- 0
    • b[2] ~ dnorm(0, 200^(-2))
    • c ~ dnorm(0, 20^(-2))
    • s ~ dunif(0, 200)
    • }"

Bayesian Poisson regression:

  • Can generalize regression techniques to non-normalized settings, such as Poisson regressions
  • Bicycle riders per day might better be modeled as a Poisson - should be discrete and non-negative, for example
    • Y ~ Pois(lambda[i])
    • log(lambda[i]) = a + b * X[i] + c * Z[i]
    • a ~ N(0, 200**2)
    • b ~ N(0, 2**2)
    • c ~ N(0, 2**2)
  • Can then define the model within RJAGS
    • poisson_model <- “model{
    • # Likelihood model for Y[i]
    • for(i in 1:length(Y)) {
    •   Y[i] ~ dpois(l[i])  
    •   log(l[i]) <- a + b[X[i]] + c*Z[i]  
    • }
    • # Prior models for a, b, c
    • a ~ dnorm(0, 200^(-2))
    • b[1] <- 0
    • b[2] ~ dnorm(0, 2^(-2))
    • c ~ dnorm(0, 2^(-2))
    • }"
  • Caveat for the Poisson is the mean and variance should be roughly equal; might accept some imperfections of dispersions

Wrap up:

  • Bayesian modeling has grown in popularity along with computing resources
  • RJAGS allows for defining, compiling, and simulating Bayesian models
  • Intutive posterior inference, including credible intervals
  • Generalizing from normal models to Poisson models

Example code includes:

# Confirm that weekday is a factor variable
is.factor(RailTrail$weekday)

# Construct a density plot of volume by weekday
ggplot(RailTrail, aes(x = volume, fill = weekday)) + 
    geom_density(alpha = 0.5)

# Calculate the mean volume on weekdays vs weekends
RailTrail %>%
  group_by(weekday) %>%
  summarize(mean(volume))


# DEFINE the model    
rail_model_1 <- "model{
    # Likelihood model for Y[i]
    for(i in 1:length(Y)) {
      Y[i] ~ dnorm(m[i], s^(-2))
      m[i] <- a + b[X[i]]
    }
    
    # Prior models for a, b, s
    a ~ dnorm(400, 100^(-2))
    b[1] <- 0
    b[2] ~ dnorm(0, 200^(-2))
    s ~ dunif(0, 200)
}"

# COMPILE the model
rail_jags_1 <- jags.model(textConnection(rail_model_1), 
    data = list(Y=RailTrail$volume, X=RailTrail$weekday),
    inits = list(.RNG.name = "base::Wichmann-Hill", .RNG.seed = 10)
    )  

# COMPILE the model
rail_jags_1 <- jags.model(textConnection(rail_model_1), data = list(Y = RailTrail$volume, X = RailTrail$weekday), 
    inits = list(.RNG.name = "base::Wichmann-Hill", .RNG.seed = 10))

# SIMULATE the posterior    
rail_sim_1 <- coda.samples(model = rail_jags_1, variable.names = c("a", "b", "s"), n.iter = 10000)

# Store the chains in a data frame
rail_chains_1 <- data.frame(rail_sim_1[[1]])

# PLOT the posterior    
plot(rail_sim_1)


# Posterior probability that typical volume is lower on weekdays
mean(rail_chains_1$'b.2.' < 0)

# Construct a chain of values for the typical weekday volume
rail_chains_1 <- rail_chains_1 %>% 
    mutate(weekday_mean = a + b.2.)

# Construct a density plot of the weekday chain
ggplot(rail_chains_1, aes(x=weekday_mean)) +
  geom_density()

# 95% credible interval for typical weekday volume
quantile(rail_chains_1$weekday_mean, c(0.025, 0.975))


# Construct a plot of volume by hightemp & weekday
ggplot(RailTrail, aes(x=hightemp, y=volume, color=weekday)) + 
    geom_point()

# Construct a sample model
rail_lm <- lm(volume ~ weekday + hightemp, data=RailTrail)

# Summarize the model
summary(rail_lm)

# Superimpose sample estimates of the model lines
ggplot(RailTrail, aes(x=hightemp, y=volume, color=weekday)) + 
    geom_point() + 
    geom_abline(intercept = coef(rail_lm)["(Intercept)"], slope = coef(rail_lm)["hightemp"], color = "red") +
    geom_abline(intercept = sum(coef(rail_lm)[c("(Intercept)", "weekdayTRUE")]), slope = coef(rail_lm)["hightemp"], color = "turquoise3")


# DEFINE the model    
rail_model_2 <- "model{
  # Likelihood model for Y[i]
  for(i in 1:length(Y)){
    Y[i] ~ dnorm(m[i], s^(-2))
    m[i] <- a + b[X[i]] + c * Z[i]
  }
    
  # Prior models for a, b, c, s
  a ~ dnorm(0, 200^(-2))
  b[1] <- 0
  b[2] ~ dnorm(0, 200^(-2))
  c ~ dnorm(0, 20^(-2))
  s ~ dunif(0, 200)
}"

# COMPILE the model
rail_jags_2 <- jags.model(textConnection(rail_model_2), 
                          data = list(Y=RailTrail$volume, X=RailTrail$weekday, Z=RailTrail$hightemp),
                          inits = list(.RNG.name = "base::Wichmann-Hill", .RNG.seed = 10)
                          )

# SIMULATE the posterior    
rail_sim_2 <- coda.samples(model = rail_jags_2, variable.names = c("a", "b", "c", "s"), n.iter = 10000)

# Store the chains in a data frame
rail_chains_2 <- data.frame(rail_sim_2[[1]])

# PLOT the posterior    
plot(rail_sim_2)


# Summarize the posterior Markov chains
summary(rail_sim_2)

# Plot the posterior mean regression models
ggplot(RailTrail, aes(x=hightemp, y=volume, color=weekday)) + 
    geom_point() + 
    geom_abline(intercept = mean(rail_chains_2[, "a"]), slope = mean(rail_chains_2[, "c"]), color = "red") + 
    geom_abline(intercept = mean(rail_chains_2[, "a"]) + mean(rail_chains_2[, "b.2."]), slope = mean(rail_chains_2[, "c"]), color = "turquoise3")
  
# Posterior probability that typical volume is lower on weekdays
mean(rail_chains_2$'b.2.' < 0)


# DEFINE the model    
poisson_model <- "model{
    # Likelihood model for Y[i]
    for(i in 1:length(Y)) {
        Y[i] ~ dpois(l[i])
        log(l[i]) <- a + b[X[i]] + c * Z[i]
    }

    # Prior models for a, b, c
    a ~ dnorm(0, 200^(-2))
    b[1] <- 0
    b[2] ~ dnorm(0, 2^(-2))
    c ~ dnorm(0, 2^(-2))
}" 

# COMPILE the model
poisson_jags <- jags.model(textConnection(poisson_model), 
                           data = list(Y=RailTrail$volume, X=RailTrail$weekday, Z=RailTrail$hightemp),
                           inits = list(.RNG.name = "base::Wichmann-Hill", .RNG.seed = 10)
                           )

# SIMULATE the posterior    
poisson_sim <- coda.samples(model = poisson_jags, variable.names = c("a", "b", "c"), n.iter = 10000)

# Store the chains in a data frame
poisson_chains <- data.frame(poisson_sim[[1]])

# PLOT the posterior    
plot(poisson_sim)


# Summarize the posterior Markov chains
summary(poisson_sim)

# Plot the posterior mean regression models
ggplot(RailTrail, aes(x = hightemp, y = volume, color = weekday)) + 
    geom_point() + 
    stat_function(fun = function(x){exp(5.01352 + 0.01426 * x)}, color = "red") + 
    stat_function(fun = function(x){exp(5.01352 - 0.12800 + 0.01426 * x)}, color = "turquoise3")


# Calculate the typical volume on 80 degree weekends & 80 degree weekdays
poisson_chains <- poisson_chains %>% 
    mutate(l_weekend=exp(a + c*80)) %>% 
    mutate(l_weekday=exp(a + b.2. + c*80))

# Construct a 95% CI for typical volume on 80 degree weekend
quantile(poisson_chains$l_weekend, c(0.025, 0.975))

# Construct a 95% CI for typical volume on 80 degree weekday
quantile(poisson_chains$l_weekday, c(0.025, 0.975))


# Simulate weekend & weekday predictions under each parameter set
poisson_chains <- poisson_chains %>% 
    mutate(Y_weekend=rpois(nrow(poisson_chains), l_weekend)) %>% 
    mutate(Y_weekday=rpois(nrow(poisson_chains), l_weekday))
    
# Print the first 6 sets of parameter values & predictions
head(poisson_chains)

# Construct a density plot of the posterior weekday predictions
ggplot(poisson_chains, aes(x=Y_weekday)) +
  geom_density()

# Posterior probability that weekday volume is less 400
mean(poisson_chains$Y_weekday < 400)

Parallel Programming in R

Chapter 1 - Can I run my application in parallel?

Partitioning problems in to independent pieces:

  • Course contents include
    • Methods of parallel programming and R packages for support
    • The parallel package in R
    • Packages foreach and future.apply
    • Random numbers and reproducibility
  • Programs can be partitioned either by tasks (e.g., birth model, death model, migration model) or by data (chunks of data passed to a routine, such as rowSums to a matrix)
    • Many independent tasks are referred to as “embarassingly parallel”, and this is common to statistical simulations

Models of parallel computing:

  • Available hardware drives the ability to split components - # CPU, Memory (including shared memory or distributed memory)
    • Message passing software runs on distributed memory and allows for fully independent processes
    • Shared memory allows for easier passing of data
  • Programming paradigms include master-worker and map-reduce (Hadoop or Scala or the like)
  • This course will cover the master-worker model
    • The master process creates processes for the workers and then compiles the results that the workers return

R packages for parallel computing:

  • The R core package parallel allows for code to be independent of other packages
  • Can instead work with iotools and sparklyr for working with the map-reduce process
    • Further, pbdR allows for many parallel approaches within R
  • The master-worker paradigms can be implemented using foreach, future.apply, snow, snowFT, snowfall, future (currently under active development, more modern)
  • The parallel package can be used for basic parallel tasks
    • ncores <- parallel::detectCores(logical = FALSE)
    • cl <- parallel::makeCluster(ncores)
    • parallel::clusterApply(cl, x = ncores:1, fun = rnorm) # x is passed to the workers in order, so worker 1 will get ronorn(ncores)
    • parallel::stopCluster(cl)

Example code includes:

extract_words <- function(book_name) {
    # extract the text of the book
    text <- subset(austen_books(), book == book_name)$text
    # extract words from the text and convert to lowercase
    str_extract_all(text, boundary("word")) %>% unlist %>% tolower
}

janeausten_words <- function() {
    # Names of the six books contained in janeaustenr
    books <- austen_books()$book %>% unique %>% as.character
    # Vector of words from all six books
    words <- sapply(books, extract_words) %>% unlist
    words
}

austen_books <- function () 
{
    books <- list('Sense & Sensibility' = janeaustenr::sensesensibility, 
                  'Pride & Prejudice' = janeaustenr::prideprejudice, 
                  'Mansfield Park' = janeaustenr::mansfieldpark, 
                  'Emma' = janeaustenr::emma, 
                  'Northanger Abbey' = janeaustenr::northangerabbey, 
                  'Persuasion' = janeaustenr::persuasion
                  )
    ret <- data.frame(text = unlist(books, use.names = FALSE), stringsAsFactors = FALSE)
    ret$book <- factor(rep(names(books), sapply(books, length)))
    ret$book <- factor(ret$book, levels = unique(ret$book))
    structure(ret, class = c("tbl_df", "tbl", "data.frame"))
}

max_frequency <- function(letter, words, min_length = 1) {
    w <- select_words(letter, words = words, min_length = min_length)
    frequency <- table(w)    
    frequency[which.max(frequency)]
}

select_words <- function(letter, words, min_length = 1) {
    min_length_words <- words[nchar(words) >= min_length]
    grep(paste0("^", letter), min_length_words, value = TRUE)
}

# Vector of words from all six books
words <- janeausten_words()

# Most frequent "a"-word that is at least 5 chars long
max_frequency(letter = "a", words = words, min_length = 5)
## again 
##  1001
# Partitioning
result <- lapply(letters, FUN=max_frequency,
                 words = words, min_length = 5) %>% unlist()

# barplot of result
barplot(result, las = 2)

replicates <- 50
sample_size <- 10000

# Function that computes mean of normal random numbers
myfunc <- function(n, ...) mean(rnorm(n, ...))

# Init result, set seed & repeat the task sequentially
result <- rep(NA, replicates)
set.seed(123)
for(iter in 1:replicates) result[iter] <- myfunc(sample_size)

# View result
hist(result)

# Use sapply() with different distribution parameters
hist(sapply(rep(sample_size, replicates), FUN=myfunc, mean = 10, sd = 5))

# We'll now introduce a demographic model to be used throughout the course. It projects net migration rates via an AR(1) model, rate(t+1) - µ = ?(rate(t) -µ) + error with variance s2
# An MCMC estimation for the USA resulted in 1000 samples of parameters µ, ? and s
# The task is to project the future distribution of migration rates

ar1_trajectory <- function(est, rate0, len = 15) {
    trajectory <- rep(NA, len)
    rate <- rate0
    for (time in seq_len(len)) {
        trajectory[time] <- ar1(est, r = rate)
        rate <- trajectory[time]
    }
    trajectory
}

ar1 <- function(est, r) {
    est['mu'] + est['phi'] * (r - est['mu']) + 
        rnorm(1, sd = est['sigma'])
}

ar1_block <- function(id, rate0 = 0.015, traj_len = 15, block_size = 10) {
    trajectories <- matrix(NA, nrow = block_size, ncol = traj_len)
    for (i in seq_len(block_size)) 
        trajectories[i,] <- ar1_trajectory(unlist(ar1est[id, ]), rate0 = rate0, len = traj_len)
    trajectories
}

show_migration <- function(trajs) {
    df <- data.frame(time = seq(2020, by = 5, len = ncol(trajs)),
                     migration_rate = apply(trajs, 2, median),
                     lower = apply(trajs, 2, quantile, 0.1),
                     upper = apply(trajs, 2, quantile, 0.9)
                    )
    g <- ggplot(df, aes(x = time, y = migration_rate)) + 
        geom_ribbon(aes(ymin = lower, ymax = upper), fill = "grey70") + 
        geom_line()
    print(g)
}


# Simulate from multiple rows of the estimation dataset
ar1_multblocks <- function(ids, ...) {
    trajectories <- NULL
    for (i in seq_along(ids)) {
        trajectories <- rbind(trajectories, ar1_block(ids[i], ...))
    }
    trajectories
}

ar1est <- data.frame(mu=c(0.0105, 0.0185, 0.022, 0.0113, 0.0144, 0.0175, -9e-04, 0.0093, 0.0111, -9e-04, -0.0024, 0.0086, 0.012, 0.0161, 0.0043, 0.0175, 0.0118, 0.0019, 0.0116, 0.0048, 0.0154, 0.0137, 0.0168, 0.0191, 0.0108, -0.0037, 0.0135, 0.0203, -0.0042, 0.0097, 0.0209, 0.0034, 0.0113, 0.0102, 0.0094, -0.0012, 0.008, 0.0082, 0.0123, 0.0175, 0.0054, -0.0087, 0.0161, 0.0155, 0.0126, 0.0181, 0.014, -0.0135, -0.0095, 0.0142, 0.011, 0.0194, 0.0149, 0.0115, 0.0129, -0.0124, 0.0116, 0.0136, 0.0161, 0.005, 0.0165, -0.0079, 0.0129, -0.0016, -7e-04, 0.0243, 0.0193, -0.004, 0.0145, 0.0078, 0.0156, 0.001, 0.0032, 0.0069, 0.0146, 0.0164, 0.0113, 0.0116, 0.0182, 0.0167, -0.0031, 0.0168, 0.0137, 0.012, -0.0212, -0.0092, 0.019, 0.0167, -0.0021, 0.0156, 0.0173, 0.0148, -0.0036, 0.0168, 0.0179, 0.0086, 0.0131, 0.015, 0.0106, 0.0132, 0.0119, 0.0156, 0.0159, 0.0256, 0.0071, 0.0163, 0.0107, 0.0139, 0.0228, 0.0139, 0.0117, 0.0133, 0.0127, -0.0162, 0.0115, 0.0095, 0.0183, 0.0183, -6e-04, 0.0177, 0.0145, 0.0041, 0.0143, 0.0135, -0.0078, 0.0036, 0.015, 0.018, 0.0158, 0.0054, -0.0204, 0.0193, 0.0051, 0.0144, 0.0129, 0.0134, 0.0116, 0.0102, 0.0203, 0.0154, 0.0106, 0.0184, 0.0096, -0.0032, 0.0143, 0.0158, 0.0093, 0.0159, 0.0112, 0.0106, 0.0075, 0.0133, 0.0171, 0.0133, 0.0139, 0.0167, 0.0131, -0.0078, 0.0135, 0.0145, 0.0104, 8e-04, 0.0205, 0.0046, 0.011, 0.0148, 0.0202, 8e-04, 0.0211, 0.0135, -8e-04, -0.0104, -0.0027, 0.0094, 0.0179, -0.0101, 0.0156, 0.0155, 0.014, 0.0149, 0.0165, 0.0168, 0.0155, 0.0136, 0.0156, 0.0149, 0.0191, 0.0176, 0.0094, -0.0076, 0.0162, 0.0143, 0.0182, 0.0102, 0.015, -0.0292, 0.0063, -0.0028, 0.0163, 0.015), 
                     sigma=c(0.0081, 0.0053, 0.0069, 0.0075, 0.0082, 0.006, 0.0101, 0.011, 0.0064, 0.0066, 0.0095, 0.0057, 0.0078, 0.005, 0.0076, 0.0064, 0.0067, 0.0049, 0.0086, 0.0067, 0.0063, 0.0054, 0.0063, 0.0077, 0.0072, 0.0074, 0.0067, 0.0047, 0.0125, 0.0069, 0.0052, 0.0073, 0.0063, 0.0072, 0.0086, 0.0079, 0.009, 0.006, 0.0077, 0.0061, 0.0082, 0.0072, 0.0054, 0.0056, 0.0072, 0.0085, 0.0064, 0.0058, 0.0064, 0.0084, 0.0075, 0.006, 0.0048, 0.0068, 0.0065, 0.0082, 0.0072, 0.0056, 0.0056, 0.0055, 0.0054, 0.0059, 0.0064, 0.0069, 0.0073, 0.0071, 0.0057, 0.0062, 0.0086, 0.0062, 0.0054, 0.0052, 0.0066, 0.0076, 0.0046, 0.0056, 0.0066, 0.0077, 0.0074, 0.0061, 0.0056, 0.0065, 0.0069, 0.0084, 0.0058, 0.007, 0.0074, 0.0077, 0.0081, 0.0083, 0.0054, 0.0057, 0.0076, 0.0119, 0.0056, 0.0078, 0.005, 0.0073, 0.0075, 0.0054, 0.0085, 0.011, 0.0063, 0.0056, 0.009, 0.0069, 0.008, 0.0063, 0.007, 0.0059, 0.0064, 0.006, 0.0103, 0.0085, 0.006, 0.0076, 0.0054, 0.0066, 0.0056, 0.0071, 0.0079, 0.007, 0.0085, 0.0075, 0.007, 0.0085, 0.006, 0.0067, 0.006, 0.0074, 0.0098, 0.0066, 0.0058, 0.0075, 0.0064, 0.0059, 0.0103, 0.0055, 0.0053, 0.0068, 0.0057, 0.009, 0.0118, 0.0096, 0.0085, 0.0075, 0.0078, 0.0041, 0.0056, 0.008, 0.0071, 0.006, 0.0046, 0.0061, 0.007, 0.0061, 0.0066, 0.0075, 0.0094, 0.0072, 0.008, 0.0064, 0.0079, 0.0068, 0.0069, 0.0058, 0.0056, 0.0057, 0.0065, 0.006, 0.0073, 0.0067, 0.0068, 0.0071, 0.0048, 0.0071, 0.0063, 0.0051, 0.0079, 0.0042, 0.0048, 0.0066, 0.0072, 0.0058, 0.0057, 0.0083, 0.0063, 0.0057, 0.0103, 0.0096, 0.0067, 0.0051, 0.0075, 0.0064, 0.0069, 0.007, 0.007, 0.0074, 0.0056, 0.006), 
                     phi=c(0.42, 0.3509, 0.8197, 0.5304, 0.1491, 0.3675, 0.9687, 0.7877, 0.7114, 0.9435, 0.9634, 0.9189, 0.4758, 0.5738, 0.8016, 0.0509, 0.8281, 0.8168, 0.7442, 0.9347, 0.1699, 0.3566, 0.8388, 0.7724, 0.7474, 0.7834, 0.6661, 0.5162, 0.9025, 0.5306, 0.6912, 0.7625, 0.8289, 0.6985, 0.9188, 0.9639, 0.3178, 0.7288, 0.4129, 0.2196, 0.9304, 0.9697, 0.193, 0.1474, 0.3111, 0.8844, 0.7386, 0.9674, 0.9983, 0.4863, 0.9338, 0.7999, 0.4696, 0.5078, 0.5141, 0.9958, 0.6404, 0.2886, 0.4171, 0.9856, 0.3261, 0.9713, 0.682, 0.7686, 0.8577, 0.9481, 0.6057, 0.934, 0.3161, 0.9414, 0.8349, 0.8325, 0.8913, 0.7726, 0.7327, 0.1403, 0.8144, 0.7506, 0.225, 0.4884, 0.9052, 0.2891, 0.1652, 0.7612, 0.9403, 0.9865, 0.4107, 0.6518, 0.893, 0.4981, 0.72, 0.3366, 0.8437, 0.2551, 0.7753, 0.5, 0.7857, 0.7107, 0.5643, 0.2887, 0.9621, 0.2384, 0.414, 0.86, 0.6917, 0.4946, 0.2325, 0.3419, 0.9219, 0.2706, 0.717, 0.2327, 0.7541, 0.9692, 0.5838, 0.9346, 0.4739, 0.3219, 0.9634, 0.3046, 0.9913, 0.8485, 0.3071, 0.0373, 0.9183, 0.7935, 0.0039, 0.5968, 0.3654, 0.595, 0.9712, 0.2745, 0.6027, 0.7441, 0.7641, 0.3582, 0.3397, 0.7748, 0.8188, 0.0604, 0.5076, 0.2856, 0.6859, 0.6705, 0.0326, 0.8749, 0.2596, 0.1138, 0.6072, 0.4, 0.9241, 0.612, 0.2375, 0.2495, 0.0661, 0.3234, 0.7651, 0.8581, 0.4818, 0.7303, 0.7458, 0.8925, 0.2861, 0.982, 0.0791, 0.2474, 0.4326, 0.8757, 0.5288, 0.6476, 0.8473, 0.9098, 0.9562, 0.8464, 0.5444, 0.9738, 0.706, 0.0795, 0.391, 0.3167, 0.3311, 0.5681, 0.27, 0.9046, 0.2299, 0.2299, 0.085, 0.4002, 0.7443, 0.9865, 0.7028, 0.9016, 0.6092, 0.2367, 0.5402, 0.9401, 0.8013, 0.993, 0.2473, 0.6414)
                     )
str(ar1est)
## 'data.frame':    200 obs. of  3 variables:
##  $ mu   : num  0.0105 0.0185 0.022 0.0113 0.0144 0.0175 -0.0009 0.0093 0.0111 -0.0009 ...
##  $ sigma: num  0.0081 0.0053 0.0069 0.0075 0.0082 0.006 0.0101 0.011 0.0064 0.0066 ...
##  $ phi  : num  0.42 0.351 0.82 0.53 0.149 ...
# Generate trajectories for all rows of the estimation dataset
trajs <- ar1_multblocks(seq_along(nrow(ar1est)), rate0 = 0.015,  block_size = 10, traj_len = 15)

# Show results
show_migration(trajs)

# Load package
library(parallel)

# How many physical cores are available?
ncores <- detectCores(logical = FALSE)

# Create a cluster
cl <- makeCluster(ncores)

# Process rnorm in parallel
clusterApply(cl, 1:ncores, fun = rnorm, mean = 10, sd = 2)
## [[1]]
## [1] 10.46206
## 
## [[2]]
## [1] 10.28796 13.19824
# Evaluate partial sums in parallel
part_sums <- clusterApply(cl, x = c(1, 51), fun = function(x) sum(x:(x + 49)))

# Total sum
total <- sum(unlist(part_sums))

# Check for correctness
total == sum(1:100)
## [1] TRUE
# Stop the cluster
stopCluster(cl)


# Create a cluster and set parameters
cl <- makeCluster(2)
replicates <- 50
sample_size <- 10000

# Parallel evaluation
means <- clusterApply(cl, x = rep(sample_size, replicates), fun = myfunc)
                
# View results as histogram
hist(unlist(means))


Chapter 2 - The parallel package

Cluster basics:

  • The parallel package consists of two parts - snow (Tuerney) and multicore (Urbanek)
    • The snow can work on any operating system
    • The multicore works on most systems but not on Windows
  • Supported backends for snow are managed automatically by the parallel package
    • cl <- makeCluster(ncores, type = “PSOCK”) # default socket communication, works on all OS, all clusters start with a completely empty environment
    • cl <- makeCluster(ncores, type = “FORK”) # all OS except Windows, all workers are complete copies of the master environment
    • cl <- makeCluster(ncores, type = “MPI”) # interface provided by Rmpi and may be more efficient on machines where MPI is enabled

Core of parallel:

  • The main processing functions are clusterApply and clusterApplyLB (“load balanced”)
  • The wrapper functions include parApply, parLapply, parSapply, parRapply (rows of a matrix), parCapply (columns of a matrix)
    • Further, parLapplyLB, parSapplyLB are wrappers on the clusterApplyLB data
  • Example of using clusterApply for work on a pre-defined cluster cl
    • clusterApply(cl, x = arg.sequence, fun = myfunc) # each element of x is passed to myfunc (length of x is the total number of tasks)
  • There are several overheads involved in creating parallel processing - starting/stopping clusters, messages sent between nodes/masters, size of messages
    • Communications between master and workers is expensive, so long worker times are preferred in general
    • The overheads may sometimes be so significant as to make parallel processing more time-consuming than serial processing

Initialization of nodes:

  • Cluster nodes typically start with a clean, empty environment (default for sockets)
  • Repeated communications with the workers is expensive
    • clusterApply(cl, rep(1000, n), rnorm, sd = 1:1000) # master needs to send the vector to all the clusters (big overhead)
  • Good practice is to initialize workers at the beginning with everything that stays constant and/or is time consuming
    • Sending static data or datasets, loading libraries, evaluating global functions, etc.
  • The clusterCall() will call the same function with the same arguments on all the nodes
    • cl <- makeCluster(2)
    • clusterCall(cl, function() library(janeaustenr)) # will be loaded in all the clusters
    • clusterCall(cl, function(i) emma[i], 20) # will call the 20th element of emma from janeausten
  • The clusterEvalQ() will evaluate a literal expression on all nodes
    • cl <- makeCluster(2)
    • clusterEvalQ(cl, { library(janeaustenr) ; library(stringr) ; get_books <- function() austen_books()$book %>% unique %>% as.character }) # all books in the package
    • clusterCall(cl, function(i) get_books()[i], 1:3) # function get_books is available in the environment due to the above
  • The clusterExport() will export objects from master to the workers
    • books <- get_books()
    • cl <- makeCluster(2)
    • clusterExport(cl, “books”) # The books object is passed quoted
    • clusterCall(cl, function() print(books)) # books will be available since it was passed by clusterExport()

Subsetting data:

  • Each task is applied to a different data chunk; these can be made available to the worker in various ways
    • Random numbers on the fly
    • Arguments
    • Chunking on the workers side
  • Example of random numbers being created on the fly by the workers (reproducibility covered in later chapters)
    • myfunc <- function(n, …) mean(rnorm(n, …))
    • clusterApply(cl, rep(1000, 20), myfunc, sd = 6)
  • Example of chunking the data on the master side and then passing the data to workers as an argument
    • Incorporated in to parApply() by default
    • cl <- makeCluster(4)
    • mat <- matrix(rnorm(12), ncol=4)
    • parCapply(cl, mat, sum) # splits the matrix by column and passes to worker
    • unlist(clusterApply(cl, as.data.frame(mat), sum)) # needs to be converted to data.frame first for clusterApply()
  • Example of chunking data on the worker side (each pre-populated with the full data, chunking on the worker side) - saves communication time
    • n <- 100
    • M <- matrix(rnorm(n * n), ncol = n)
    • clusterExport(cl, “M”)
    • mult_row <- function(id) apply(M, 2, function(col) sum(M[id,] * col))
    • clusterApply(cl, 1:n, mult_row) %>% do.call(rbind, .)

Example code includes:

# Load parallel and create a cluster
library(parallel)
cl <- makeCluster(4)

# Investigate the cl object and its elements
typeof(cl)
## [1] "list"
length(cl)
## [1] 4
typeof(cl[[3]])
## [1] "list"
cl[[3]]$rank
## [1] 3
# What is the process ID of the workers
clusterCall(cl, Sys.getpid)
## [[1]]
## [1] 31748
## 
## [[2]]
## [1] 27860
## 
## [[3]]
## [1] 35192
## 
## [[4]]
## [1] 35420
# Stop the cluster
stopCluster(cl)


# Define ncores and a print function
ncores <- 2
print_ncores <- function() print(ncores)

# Create a socket and a fork clusters
# cl_sock <- makeCluster(ncores, type = "PSOCK")
# cl_fork <- makeCluster(ncores, type = "FORK")  # this is possible only on OS other than Windows

# Evaluate the print function on each cluster
# clusterCall(cl_sock, print_ncores)  # this will fail since the socket has no knowledge of the main environment
# clusterCall(cl_fork, print_ncores)

# Change ncores and evaluate again
# ncores <- 4
# clusterCall(cl_fork, print_ncores)  # the fork is only of the original environment, so these clusters will still think the answer is 2


# In this exercise, you will take the simple embarrassingly parallel application for computing mean of random numbers (myfunc()) from the first chapter, and implement two functions:
# One that runs the application sequentially, mean_seq(), and one that runs it in parallel, mean_par()
# Both functions have three arguments, n (sample size), repl (number of replicates) and ... (passed to myfunc())
# Function mean_par() assumes a cluster object cl to be present in the global environment

# Function to run repeatedly
myfunc <- function(n, ...) mean(rnorm(n, ...))

# Sequential solution
mean_seq <- function(n, repl, ...) {
    res <- rep(NA, repl)
    for (it in 1:repl) res[it] <- myfunc(n, ...)
    res
}

# Parallel solution
mean_par <- function(n, repl, ...) {
    res <- clusterApply(cl, x = rep(n, repl), fun = myfunc, ...)
    unlist(res)
}


# Load packages 
library(parallel)
library(microbenchmark)

# Create a cluster
cl <- makeCluster(2)

# Compare run times
microbenchmark(mean_seq(3000000, repl = 4), 
               mean_par(3000000, repl = 4),
               mean_seq(100, repl = 100), 
               mean_par(100, repl = 100),
               times = 1, unit = "s")
## Unit: seconds
##                       expr         min          lq        mean      median
##  mean_seq(3e+06, repl = 4) 1.577937986 1.577937986 1.577937986 1.577937986
##  mean_par(3e+06, repl = 4) 0.923813138 0.923813138 0.923813138 0.923813138
##  mean_seq(100, repl = 100) 0.003337635 0.003337635 0.003337635 0.003337635
##  mean_par(100, repl = 100) 0.182669413 0.182669413 0.182669413 0.182669413
##           uq         max neval
##  1.577937986 1.577937986     1
##  0.923813138 0.923813138     1
##  0.003337635 0.003337635     1
##  0.182669413 0.182669413     1
# Stop cluster               
stopCluster(cl)


# Load extraDistr on master
library(extraDistr)
## 
## Attaching package: 'extraDistr'
## The following object is masked from 'package:purrr':
## 
##     rdunif
# Define myrdnorm 
myrdnorm <- function(n, mean = 0, sd = 1) 
    rdnorm(n, mean = mean, sd = sd)

# Run myrdnorm in parallel - should fail
# res <- clusterApply(cl, rep(1000, 20), myrdnorm, sd = 6)   # will error out


# Load extraDistr on all workers
cl <- makeCluster(2)
clusterEvalQ(cl, library(extraDistr))
## [[1]]
## [1] "extraDistr" "stats"      "graphics"   "grDevices"  "utils"     
## [6] "datasets"   "methods"    "base"      
## 
## [[2]]
## [1] "extraDistr" "stats"      "graphics"   "grDevices"  "utils"     
## [6] "datasets"   "methods"    "base"
# Run myrdnorm in parallel again and show results
res <- clusterApply(cl, rep(1000, 20), myrdnorm, sd = 6)
hist(unlist(res))

# myrdnorm that uses global variables
myrdnorm <- function(n) rdnorm(n, mean = mean, sd = sd)

# Initialize workers 
clusterEvalQ(cl, {
    library(extraDistr)
    mean=10
    sd=5
    })
## [[1]]
## [1] 5
## 
## [[2]]
## [1] 5
# Run myrdnorm in parallel and show results
res <- clusterApply(cl, rep(1000, 100), myrdnorm)

# View results
hist(unlist(res))

# Set global objects on master
mean <- 20
sd <- 10

# Export global objects to workers
clusterExport(cl, c("mean", "sd"))

# Load extraDistr on workers
clusterEvalQ(cl, library(extraDistr))
## [[1]]
## [1] "extraDistr" "stats"      "graphics"   "grDevices"  "utils"     
## [6] "datasets"   "methods"    "base"      
## 
## [[2]]
## [1] "extraDistr" "stats"      "graphics"   "grDevices"  "utils"     
## [6] "datasets"   "methods"    "base"
# Run myrdnorm in parallel and show results
res <- clusterApply(cl, rep(1000, 100), myrdnorm)
hist(unlist(res))

select_words <- function(letter, words, min_length = 1) {
    min_length_words <- words[nchar(words) >= min_length]
    grep(paste0("^", letter), min_length_words, value = TRUE)
}

# Export "select_words" to workers
clusterExport(cl, "select_words")

# Split indices for two chunks
ind <- splitIndices(length(words), 2)

# Find unique words in parallel
result <- clusterApply(cl, x = list(words[ind[[1]]], words[ind[[2]]]),  
            function(w, ...) unique(select_words("v", w, ...)), 
            min_length = 10)
            
# Show vectorized unique results
unique(unlist(result))
##  [1] "voluntarily"    "variations"     "vindication"    "violoncello"   
##  [5] "vouchsafed"     "veneration"     "volatility"     "volubility"    
##  [9] "vigorously"     "villainous"     "vindicating"    "vulnerable"    
## [13] "vicissitudes"   "vegetation"     "vulgarisms"     "valetudinarian"
## [17] "vindicated"     "vouchsafing"    "voluminous"     "vehemently"    
## [21] "valancourt"     "venerating"     "viscountess"    "vanquished"
# Earlier you defined a function ar1_multblocks() that takes a vector of row identifiers as argument and generates migration trajectories using the corresponding rows of the parameter set ar1est
# ar1_multblocks() depends on ar1_block() which in turns depends on ar1_trajectory()
# These functions along with the cluster object cl of size 4, function show_migration(), the dataset ar1est (reduced to 200 rows) and packages parallel and ggplot2 are available in your workspace

ar1_block <- function(id, rate0 = 0.015, traj_len = 15, block_size = 10) {
    trajectories <- matrix(NA, nrow = block_size, ncol=traj_len)
    for (i in seq_len(block_size)) 
        trajectories[i,] <- ar1_trajectory(unlist(ar1est[id, ]), rate0 = rate0, len = traj_len)
    trajectories
}

ar1_trajectory <- function(est, rate0, len = 15) {
    ar1 <- function(est, r) {
        # simulate one AR(1) value
        est['mu'] + est['phi'] * (r - est['mu']) + 
        rnorm(1, sd = est['sigma'])
    }
    trajectory <- rep(NA, len)
    rate <- rate0
    for (time in seq_len(len)) {
        trajectory[time] <- ar1(est, r = rate)
        rate <- trajectory[time]
    }
    trajectory
}

ar1_multblocks <- function(ids, ...) {
    trajectories <- NULL
    for (i in seq_along(ids))
        trajectories <- rbind(trajectories, ar1_block(ids[i], ...))
    trajectories
}

# Export data and functions
clusterExport(cl, c("ar1est", "ar1_block", "ar1_trajectory"))

# Process ar1_multblocks in parallel
res <- clusterApply(cl, 1:nrow(ar1est), ar1_multblocks)

# Combine results into a matrix and show results
trajs <- do.call(rbind, res)
show_migration(trajs)

# The object res returned by clusterApply() in the previous exercise is also in your workspace, now called res_prev
res_prev <- res

# Split task into 5 chunks
ind <- splitIndices(nrow(ar1est), 5)

# Process ar1_multblocks in parallel
res <- clusterApply(cl, ind, ar1_multblocks)

# Dimensions of results 
(res_dim <- c(length(res), nrow(res[[1]])))
## [1]   5 400
(res_prev_dim <- c(length(res_prev), nrow(res_prev[[1]])))
## [1] 200  10
stopCluster(cl)

Chapter 3 - foreach, future.apply, and Load Balancing

foreach:

  • The looping construct can be applied using the foreach package (Calaway and Weston), similar to previous examples
  • The foreach makes it possible to run parallel processing for loops - code can be written the same way for both sequential and parallel applications
  • The basic syntax is foreach(.) %do% .
    • library(foreach)
    • foreach(n = rep(5, 3)) %do% rnorm(n)
    • foreach(n = rep(5, 3), m = 10^(0:2)) %do% rnorm(n, mean = m) # can pass arguments
    • The foreach() call will return a value - in the example above, this would be a list
  • Can combine results using post-processing arguments - the .combine argument
    • foreach(n = rep(5, 3), .combine = rbind) %do% rnorm(n) # rbind of the three lists
    • foreach(n = rep(5, 3), .combine = ‘+’) %do% rnorm(n) # sum across the three lists
  • Can also use list comprehensions with the foreach() function - using the %:% operator
    • foreach(x = sample(1:1000, 10), .combine = c) %:% when(x %% 3 == 0 || x %% 5 == 0) %do% x

foreach and parallel backends:

  • The most popular backend is the doParallel() call for parallel foreach() processing
    • Other backends include doFuture() using the future package and doSEQ() which allows switching between parallel and sequential
  • The doParallel package by Calaway et al is an interface between foreach and parallel, and requires initialization with registerDoParallel()
    • library(doParallel)
    • registerDoParallel(cores = 3) # uses multicore for Unix and snow for Windows
    • cl <- makeCluster(3) # can make your own clusters and pass them also
    • registerDoParallel(cl) # passing the cl object rather than cores (will default to snow since that is makeCluster() default
  • Examples of converting a sequential loop to a parallel loop
    • library(foreach)
    • foreach(n = rep(5, 3)) %do% rnorm(n)
    • library(doParallel)
    • cl <- makeCluster(3)
    • registerDoParallel(cl)
    • foreach(n = rep(5, 3)) %dopar% rnorm(n) # note the conversion to %dopar% which is what engages the parallel processing
  • The doFuture package (Bengtsson) is built on top of the future package
    • The central idea is that there is a future plan for how foreach should work behind the scenes - sequential, cluster, multicore, multiprocess, etc.
    • Other packages are available from future.batchtools
    • library(doFuture)
    • registerDoFuture()
    • plan(cluster, workers = 3) # using the cluster plan
    • foreach(n = rep(5, 3)) %dopar% rnorm(n) # same use of foreach, with the cluster plan applied
    • plan(multicore) # using the multicore plan
    • foreach(n = rep(5, 3)) %dopar% rnorm(n)

future and future.apply - packages that are continually under development:

  • The future package intends to have a uniform API for sequential and parallel processing
  • The future construct is for an expression that may be used in the future
    • Example in plain R - x <- mean(rnorm(n, 0, 1)) ; y <- mean(rnorm(n, 10, 5)) ; print(c(x, y))
    • Example in implicit futures - x %<-% mean(rnorm(n, 0, 1)) ; y %<-% mean(rnorm(n, 10, 5)) ; print(c(x, y))
    • Example in explicit futures - x <- future(mean(rnorm(n, 0, 1))) ; y <- future(mean(rnorm(n, 10, 5))) ; print(c(value(x), value(y)))
    • Values can be managed asynchronously, meaning that the next line can start running while the current line is still in process
  • The same code can then be run either in parallel or sequentially - sequential example
    • plan(sequential)
    • x %<-% mean(rnorm(n, 0, 1))
    • y %<-% mean(rnorm(n, 10, 5))
    • print(c(x, y))
  • The same code can then be run either in parallel or sequentially - parallel example
    • plan(multicore)
    • x %<-% mean(rnorm(n, 0, 1))
    • y %<-% mean(rnorm(n, 10, 5))
    • print(c(x, y))
  • The package future.apply is a higher level API for all the apply packages in R using futures
    • Sibling to foreach
    • functions include future_lapply(), future_sapply(), future_apply()
  • Example of using future.apply()
    • lapply(1:10, rnorm) # base R
    • plan(sequential)
    • future_lapply(1:10, rnorm) # future.apply implementation of base R above
    • plan(cluster, workers=4)
    • future_lapply(1:10, rnorm) # future.apply implementation of base R above, now run in parallel
  • Separating the plan from the processing allows for processing across many systems
    • Single CPU uses sequential, cluster plan for many cores, etc.

Load balancing and scheduling:

  • There can be significant node waiting times if the master waits for all workers to finish before assigning new tasks
    • The clusterApplyLB() is designed to speed up processing by sending new tasks to workers as soon as they finish their old tasks
  • Communication overhead can also be a big problem when the tasks are small
    • Can instead give the workers many tasks at once, and have them communicate with the master only at the start and the finish
    • Drawback is that idle workers will not be available to help busy workers
  • Can chunk in parallel using the splitIndices() function
    • splitIndices(10, 2)
    • clusterApply(cl, x = splitIndices(10, 2), fun = sapply, “*“, 100) # multiply all numbers by 100
    • Can also use parApply with the chunk.size option in R 3.5+
    • foreach(s = isplitVector(1:10, chunks = 2)) %dopar% sapply(s, “*“, 100) # itertools functions to implement in foreach
    • future_sapply(1:10, *, 100, future.scheduling = 1) # 1 chunk per worker
    • future_sapply(1:10, *, 100, future.scheduling = FALSE) # 1 chunk per task

Example code includes:

# Recall the first chapter where you found the most frequent words from the janeaustenr package that are of certain minimum length
result <- lapply(letters, max_frequency, words = words, min_length = 5) %>% 
    unlist
# In this exercise, you will implement the foreach construct to solve the same problem
# The janeaustenr package, a vector of all words from the included books, words, and a function max_frequency() for finding the results based on a given starting letter are all available in your workspace

# Load the package
library(foreach)
## 
## Attaching package: 'foreach'
## The following objects are masked from 'package:purrr':
## 
##     accumulate, when
# foreach construct
result <- foreach(l = letters, .combine=c) %do% max_frequency(l, words=words, min_length=5)
                
# Plot results 
barplot(result, las = 2)

# Specifically, your job is to modify the code so that the maximum frequency for the first half of the alphabet is obtained for words that are two and more characters long, while the frequency corresponding to the second half of the alphabet is derived from words that are six and more characters long
# Note that we are using an alphabet of 26 characters

# foreach construct and combine into vector
result <- foreach(l = letters, n = rep(c(2, 6), each=13), .combine = c) %do% 
    max_frequency(l, words=words, min_length=n)
          
# Plot results
barplot(result, las = 2)

# Register doParallel with 2 cores
doParallel::registerDoParallel(cores=2)

# Parallel foreach loop
res <- foreach(r = rep(1000, 100), .combine = rbind, 
            .packages = "extraDistr") %dopar% myrdnorm(r)
            
# Dimensions of res
dim_res <- dim(res)


# So far you learned how to search for the most frequent word in a text sequentially using foreach()
# In the course of the next two exercises, you will implement the same task using doParallel and doFuture for parallel processing and benchmark it against the sequential version
# The sequential solution is implemented in function freq_seq() (type freq_seq in your console to see it)
# It iterates over a global character vector chars and calls the function max_frequency() which searches within a vector of words, while filtering for minimum word length
# All these objects are preloaded, as is the doParallel package
# Your job now is to write a function freq_doPar() that runs the same code in parallel via doParallel

freq_seq <- function(min_length = 5)
    foreach(l = letters, .combine = c) %do% 
        max_frequency(l, words = words, min_length = min_length)

# Function for doParallel foreach
freq_doPar <- function(cores, min_length = 5) {
    # Register a cluster of size cores
    doParallel::registerDoParallel(cores=cores)
    
    # foreach loop
    foreach(l=letters, .combine=c, 
            .export = c("max_frequency", "select_words", "words"),
            .packages = c("janeaustenr", "stringr")) %dopar%
        max_frequency(l, words=words, min_length=min_length)
}

# Run on 2 cores
freq_doPar(cores=2)
##     again     being     could     darcy     every     first     great 
##      1001      1445      3613       373      1456       972       981 
##   herself    indeed  jennings knightley    little     might     never 
##      1360       664       199       356      1295      1369      1362 
##     other     place     quite    really    should     there     under 
##      1084       503       870       504      1541      2209       293 
##     visit     would     xviii     young   zealous 
##       294      3238         4       766         5
# Now your job is to create a function freq_doFut() that accomplishes the same task as freq_doPar() but with the doFuture backend
# Note that when using doFuture, arguments .packages and .export in foreach() are not necessary, as the package deals with the exports automatically
# You will then benchmark these two functions, together with the sequential freq_seq()
# All the functions from the last exercise are available in your workspace
# In addition, the packages doFuture and microbenchmark are also preloaded
# To keep the computation time low, the global chars vector is set to the first six letters of the alphabet only

cores <- 2
min_length <- 5

# Error in tweak.function(strategy, ..., penvir = penvir) : 
# Trying to use non-future function 'survival::cluster': function (x)  { ... }
# For solution see https://github.com/HenrikBengtsson/future/issues/152

# Function for doFuture foreach
freq_doFut <- function(cores, min_length = 5) {
    # Register and set plan
    doFuture::registerDoFuture()
    future::plan(future::cluster, workers=cores)

    # foreach loop
    foreach(l = letters, .combine = c) %dopar%
        max_frequency(l, words = words, min_length = min_length)
}

# Benchmark
microbenchmark(freq_seq(min_length),
               freq_doPar(cores, min_length),
               freq_doFut(cores, min_length),
               times = 1)
## Unit: seconds
##                           expr      min       lq     mean   median
##           freq_seq(min_length) 13.50132 13.50132 13.50132 13.50132
##  freq_doPar(cores, min_length) 11.39758 11.39758 11.39758 11.39758
##  freq_doFut(cores, min_length) 13.92868 13.92868 13.92868 13.92868
##        uq      max neval
##  13.50132 13.50132     1
##  11.39758 11.39758     1
##  13.92868 13.92868     1
# It is straight forward to swap parallel backends with foreach
# In this small example, you might not see any time advantage in running it in parallel
# In addition, doFuture is usually somewhat slower than doParallel
# This is because doFuture has a higher computation overhead
# We encourage you to test these frameworks on more time-consuming applications where an overhead become negligible relative to the overall processing time

extract_words_from_text <- function(text) {
    str_extract_all(text, boundary("word")) %>% 
        unlist %>% 
        tolower
}

# Main function
freq_fapply <- function(words, chars=letters, min_length=5) {
    unlist(future.apply::future_lapply(chars, FUN=max_frequency, words = words, min_length = min_length))
}

obama <- readLines("./RInputFiles/obama.txt")
obama_speech <- paste(obama[obama != ""], collapse=" ")

# Extract words and call freq_fapply
words <- extract_words_from_text(obama_speech)
res <- freq_fapply(words)

# Plot results
barplot(res, las = 2)

# Now imagine you are a user of the fictional package from the previous exercise
# At home you have a two-CPU Mac computer, and at work you use a Linux cluster with two 16-CPU computers, called "oisin" and "oscar"
# Your job is to write a function for each of the hardware that calls freq_fapply() while taking advantage of all available CPUs
# For the cluster, you set workers to a vector of computer names corresponding to the number of CPUs, i.e. 16 x "oisin" and 16 x "oscar"
# For a one-CPU environment, we have created a function fapply_seq()

# fapply_seq <- function(...) {
#     future::plan(strategy="sequential") 
#     freq_fapply(words, letters, ...)
# }

# multicore function
# fapply_mc <- function(cores=2, ...) {
#     plan(strategy="multicore", workers=cores)
#     freq_fapply(words, letters, ...)
# }

# cluster function
# fapply_cl <- function(cores=NULL, ...) {
#     # set default value for cores
#     if(is.null(cores))
#         cores <- rep(c("oisin", "oscar"), each = 16)
#         
#     # parallel processing
#     plan(strategy="cluster", workers=cores)
#     freq_fapply(words, letters, ...)
# }


# Note: Multicore does not work on Windows. We recommend using the 'multiprocess' or 'cluster' plan on Windows computers.

# Microbenchmark
# microbenchmark(fapply_seq = fapply_seq(),
#                fapply_mc_2 = fapply_mc(cores=2), 
#                fapply_mc_10 = fapply_mc(cores=10),
#                fapply_cl = fapply_cl(cores=2), 
#                times = 1)

# Which is the slowest?
# slowest1 <- "fapply_cl"


# This is because for a small number of tasks a sequential code can run faster than a parallel version due to the parallel overhead
# The cluster plan has usually the largest overhead and thus, should be used only for larger number of tasks
# The multicore may be more efficient when the number of workers is equal to the number of cores
# It uses shared memory, and thus is faster than cluster


# In your workspace there is a vector tasktime containing simulated processing times of 30 tasks (generated using runif())
# There is also a cluster object cl with two nodes
# Your job is to apply the function Sys.sleep() to tasktime in parallel using clusterApply() and clusterApplyLB() and benchmark them
# The parallel and microbenchmark packages are loaded
# We also provided functions for plotting cluster usage plots called plot_cluster_apply() and plot_cluster_applyLB()
# Both functions use functionality from the snow package

tasktime <- c(0.1328, 0.1861, 0.2865, 0.4541, 0.1009, 0.4492, 0.4723, 0.3304, 0.3146, 0.031, 0.1031, 0.0884, 0.3435, 0.1921, 0.3849, 0.2489, 0.3588, 0.496, 0.1901, 0.3887, 0.4674, 0.1062, 0.3259, 0.0629, 0.1337, 0.1931, 0.0068, 0.1913, 0.4349, 0.1702)

# plot_cluster_apply <- function(cl, x, fun) 
#     plot(snow::snow.time(snow::clusterApply(cl, x, fun)),
#             title = "Cluster usage of clusterApply")

# plot_cluster_applyLB <- function(cl, x, fun) 
#     plot(snow::snow.time(snow::clusterApplyLB(cl, x, fun)),
#             title = "Cluster usage of clusterApplyLB")

# Benchmark clusterApply and clusterApplyLB
# microbenchmark(
#     clusterApply(cl, tasktime, Sys.sleep),
#     clusterApplyLB(cl, tasktime, Sys.sleep),
#     times = 1
# )

# Plot cluster usage
# plot_cluster_apply(cl, tasktime, Sys.sleep)
# plot_cluster_applyLB(cl, tasktime, Sys.sleep)


# Now we compare the results from the previous exercise with ones generated using parSapply(), which represents here an implementation that groups tasks into as many chunks as there are workers available
# You first explore its cluster usage plot, using the function plot_parSapply() we defined for you
# We generated a version of the tasktime vector, called bias_tasktime that generates very uneven load
# Your job is to compare the run times of parSapply() with clusterApplyLB() applied to bias_tasktime

# plot_parSapply <- function(cl, x, fun) 
#     plot(snow::snow.time(snow::parSapply(cl, x, fun)),
#             title = "Cluster usage of parSapply")

# bias_tasktime <- c(1, 1, 1, 0.1, 0.1, 0.1, 1e-04, 1e-04, 1e-04, 0.001, 1)

# Plot cluster usage for parSapply
# plot_parSapply(cl, tasktime, Sys.sleep)

# Microbenchmark
# microbenchmark(
#     clusterApplyLB(cl, bias_tasktime, Sys.sleep),
#     parSapply(cl, bias_tasktime, Sys.sleep),
#     times = 1
# )

# Plot cluster usage for parSapply and clusterApplyLB
# plot_cluster_applyLB(cl, bias_tasktime, Sys.sleep)
# plot_parSapply(cl, bias_tasktime, Sys.sleep)

Chapter 4 - Random Numbers and Reproducibility

Are results reproducible?

  • Many statistical numbers require the use of random numbers - MCMC, boot, simulation, sample, rnorm, etc.
    • Typically, would use a set.seed() to initialize the RNG to a known state
  • Setting the seed typically does not guarantee reproducibility of parallel processing
    • library(parallel)
    • cl <- makeCluster(2)
    • set.seed(1234)
    • clusterApply(cl, rep(3, 2), rnorm)
    • set.seed(1234) # only sets the RNG in the master node; thus not sent to the workers
    • clusterApply(cl, rep(3, 2), rnorm) # will get different sets of results
  • Can instead set the RNG for each of the workers
    • clusterEvalQ(cl, set.seed(1234))
    • clusterApply(cl, rep(3, 2), rnorm) # both clusters will give the identicla results
  • There is another common and not recommended method of generating random numbers in parallel code - gives statistical properties that are not desirable
    • for (i in 1:2) {
    • set.seed(1234)
    • clusterApply(cl, sample(1:10000000, 2), set.seed)
    • print(clusterApply(cl, rep(3, 2), rnorm))
    • }

Parallel random number generators:

  • A good RNG should comply with certain parameters - long period > 2**100, good structural properties in high dimensions, reproducible
    • These parameters should hold in a distributed environment also
  • RNG streams with period 2291 and seeds 2127 steps apart is available based on research by L’Ecuyer
    • Allows for each part of a parallel process to have reproducible streams with the proper properties
    • Available in R through rlecuyer and rstream
    • Also available in R Code using RNGkind(“L’Ecuyer-CMRG”)
  • The L’Ecuyer generator is the default when using parallel but needs to be initialized with a seed for cluster cl
    • clusterSetRNGStream(cl, iseed = 1234) # initializes a reproducible and independent seed for each of the workers
  • Reproducibility in parallel depends on the task flow - certain conditions need to apply
    • Runs on clusters of the same size (different number of workers means different random numbers)
    • Cannot use load balancing (balancing loads means non-deterministic scheduling and assignment)

Reproducibility in foreach and future.apply:

  • Can achieve reproducibility in foreach using doRNG - one stream per task
    • library(doRNG)
    • library(doParallel)
    • registerDoParallel(cores = 3)
    • set.seed(1)
    • res1 <- foreach(n = rep(2, 5), .combine = rbind) %dorng% rnorm(n)
    • set.seed(1)
    • res2 <- foreach(n = rep(2, 5), .combine = rbind) %dorng% rnorm(n)
    • identical(res1, res2) # TRUE
  • Can also use doRNG by way of %dopar%
    • library(doRNG)
    • library(doParallel)
    • registerDoParallel(cores = 3)
    • registerDoRNG(1) # 1 is the seed
    • res3 <- foreach(n = rep(2, 5), .combine = rbind) %dopar% rnorm(n)
    • set.seed(1)
    • res4 <- foreach(n = rep(2, 5), .combine = rbind) %dopar% rnorm(n)
    • c(identical(res1, res3), identical(res2, res4)) # TRUE TRUE
  • Can also use independent streams in future.apply
    • library(future.apply)
    • plan(sequential)
    • res5 <- future_lapply(1:5, FUN = rnorm, future.seed = 1234)
    • plan(multiprocess)
    • res6 <- future_lapply(1:5, FUN = rnorm, future.seed = 1234)
    • identical(res5, res6) # TRUE

Next steps:

  • The parallel package is the baseline for many other packages
    • Often not reproducible
  • The foreach package with doParallel and doFuture can be reproducible using doRNG
  • The future.apply package has an inutitive apply-like syntax and is always reproducible if future.seed is set
  • General best practices include
    • Minimize overhead and master-worker communication frequencies
    • Use scheduling and load balancing through effective use of chunking
    • Be careful that parallel overhead can actually make tasks longer if the tasks are all small and the communication takes more time than the calculations

Example code includes:

# In addition to the code in the previous exercise, we also created a FORK cluster for you.

# cl.fork <- makeCluster(2, type = "FORK")

# Your job is to register the two cluster objects with the preloaded doParallel package and compare results obtained with parallel foreach
# How do the results differ in terms of reproducibility?

library(doParallel)
## Loading required package: iterators
cl.sock <- makeCluster(2, type = "PSOCK")
registerDoParallel(cl.sock)
set.seed(100)
foreach (i = 1:2) %dopar% rnorm(3)
## [[1]]
## [1] -0.4163519  0.1258266 -0.2227707
## 
## [[2]]
## [1] 1.0367715 0.2904989 1.9457856
# Register and use cl.sock
registerDoParallel(cl.sock)
replicate(2, {
    set.seed(100)
    foreach(i = 1:2, .combine = rbind) %dopar% rnorm(3)
    }, simplify = FALSE
)
## [[1]]
##                [,1]      [,2]       [,3]
## result.1  0.6829501  1.703590 -0.3582526
## result.2 -0.1670437 -1.980469 -0.6278870
## 
## [[2]]
##                [,1]       [,2]      [,3]
## result.1  0.8907005 -0.2986688  1.174523
## result.2 -1.2057704  1.1466829 -1.162030
# Register and use cl.fork
# registerDoParallel(cl.fork)
# replicate(2, {
#     set.seed(100)
#     foreach(i = 1:2, .combine = rbind) %dopar% rnorm(3)
#     }, simplify = FALSE
# )


# Create a cluster
cl <- makeCluster(2)

# Check RNGkind on workers
clusterCall(cl, RNGkind)
## [[1]]
## [1] "Mersenne-Twister" "Inversion"       
## 
## [[2]]
## [1] "Mersenne-Twister" "Inversion"
# Set the RNG seed on workers
clusterSetRNGStream(cl, iseed=100)

# Check RNGkind on workers
clusterCall(cl, RNGkind)
## [[1]]
## [1] "L'Ecuyer-CMRG" "Inversion"    
## 
## [[2]]
## [1] "L'Ecuyer-CMRG" "Inversion"
# Now you are ready to make your results reproducible
# You will use the simple embarrassingly parallel application for computing a mean of random numbers (myfunc) which we parallelized in the second chapter using clusterApply()
# The parallel package, myfunc() , n (sample size, set to 1000) and repl (number of replicates, set to 5) are available in your workspace
# You will now call clusterApply() repeatedly to check if results can be reproduced, without and with initializing the RNG

n <- 1000
repl <- 5

# Create a cluster of size 2
cl <- makeCluster(2)

# Call clusterApply three times
for(i in 1:3)
    print(unlist(clusterApply(cl, rep(n, repl), myfunc)))
## [1] -0.005497216  0.007828904 -0.075494224  0.010825828  0.051691211
## [1]  0.007477904 -0.002292326  0.038991010  0.012453354  0.020435740
## [1] -0.017656994 -0.036756447 -0.045668481  0.013225036  0.001755495
# Create a seed object
seed <- 1234

# Repeatedly set the cluster seed and call clusterApply()
for(i in 1:3) {
    clusterSetRNGStream(cl, iseed = seed)
    print(unlist(clusterApply(cl, rep(n, repl), myfunc)))
}
## [1] -0.008597904 -0.006089337 -0.013980519 -0.066293388  0.004297755
## [1] -0.008597904 -0.006089337 -0.013980519 -0.066293388  0.004297755
## [1] -0.008597904 -0.006089337 -0.013980519 -0.066293388  0.004297755
# Create two cluster objects, of size 2 and 4
cl2 <- makeCluster(2)
cl4 <- makeCluster(4)

# Set seed on cl2 and call clusterApply
clusterSetRNGStream(cl2, iseed = seed)
unlist(clusterApply(cl2, rep(n, repl), myfunc))
## [1] -0.008597904 -0.006089337 -0.013980519 -0.066293388  0.004297755
# Set seed on cl4 and call clusterApply
clusterSetRNGStream(cl4, iseed = seed)
unlist(clusterApply(cl4, rep(n, repl), myfunc))
## [1] -0.008597904 -0.006089337  0.077876985 -0.072012937 -0.013980519
# Register doParallel and doRNG
library(doRNG)
## Loading required package: rngtools
## Loading required package: pkgmaker
## Loading required package: registry
## 
## Attaching package: 'pkgmaker'
## The following object is masked from 'package:base':
## 
##     isFALSE
registerDoParallel(cores = 2)
doRNG::registerDoRNG(seed)

# Call ar1_block via foreach
mpar <- foreach(r=1:5) %dopar% ar1_block(r)

# Register sequential backend, set seed and run foreach
registerDoSEQ()
set.seed(seed)
mseq <- foreach(r=1:5) %dorng% ar1_block(r)

# Check if results identical
identical(mpar, mseq)
## [1] TRUE
# You are able to reproduce sequential and parallel applications! Remember to always use %dorng% if you use the doSEQ backend
# Also note that by default on the Linux DataCamp server, registerDoParallel() creates a FORK cluster if a number of cores is passed to it
# As a result, there was no need to export any functions to workers, as they were copied from the master
# On a different platform, the .export option may be needed


# Set multiprocess plan 
future::plan(strategy="multiprocess", workers = 2)

# Call ar1_block via future_lapply
mfpar <- future.apply::future_lapply(1:5, FUN=ar1_block, future.seed=seed)

# Set sequential plan and repeat future_lapply
future::plan(strategy="sequential")
mfseq <- future.apply::future_lapply(1:5, FUN=ar1_block, future.seed=seed)

# Check if results are identical
identical(mfpar, mfseq)
## [1] TRUE
rm(mean)
rm(sd)

Marketing Analytics in R: Choice Modeling

Chapter 1 - Quickstart Guide

Why choice?

  • Choice modeling (and conjoint) is a common and popular tool used in marketing
    • Linear regression is about predicting a number based on features
    • Frequently, though, we want to make a choose from a selection of objects (picking a show, purchasing a car, etc.)
  • Multinomial logit (logistic regressions) work well with choice data
  • Choice models can be helpful for feature selection, pricing, trade-offs between quality/cost, etc.

Inspecting choice data:

  • Choice data does not fit in to normal predictive modeling formats
    • For regression, data are typically one row per observation
    • For choice datasets, data are typically stacked in to a few rows, where each row describes an alternative (rather than an observation), with a flag for which option was chosen
  • May want to count up the number of choices made (total or proportions)
    • xtabs(choice ~ price, data=sportscar)

Fitting and interpreting a choice model:

  • Fitting choice models is similar to fitting linear models
    • my_model <- lm(y ~ x1 + x2 + x3, data=lm_data)
    • library(mlogit) # multinomial logit is needed rather than GLM
    • mymodel <- mlogit(choice ~ feature1 + feature2 + feature3, data = choice_data) # data must be choice data, including both ques, alt, and choice columns
    • summary(mymodel)
  • Coefficients of magnitude greater than 1 are of very high impact in the decisions (rule of thumb)

Using choice models to make decisions:

  • Can use the choice models to predict market shares
    • predict_mnl(model, products) # for mlogit models - written by instructor

Example code includes:

# Unload conflicting namespaces
unloadNamespace("rms")
unloadNamespace("quantreg")
unloadNamespace("MatrixModels")

unloadNamespace("lmerTest")
unloadNamespace("semPlot")
unloadNamespace("rockchalk")
unloadNamespace("qgraph")
unloadNamespace("sem")
unloadNamespace("mi")
unloadNamespace("arm")
unloadNamespace("mice")
unloadNamespace("mitml")
unloadNamespace("jomo")
unloadNamespace("arm")
unloadNamespace("jomo")
unloadNamespace("lme4")


# load the mlogit library 
library(mlogit)


scLong <- read.csv("./RInputFiles/sportscar_choice_long.csv")
scWide <- read.csv("./RInputFiles/sportscar_choice_wide.csv")
sportscar <- scLong
sportscar$alt <- as.factor(sportscar$alt)
sportscar$seat <- as.factor(sportscar$seat)
sportscar$price <- as.factor(sportscar$price)
sportscar$choice <- as.logical(sportscar$choice)
sportscar <- sportscar %>% rename(resp.id=resp_id)
sportscar$key <- rep(1:2000, each=3)
row.names(sportscar) <- paste(sportscar$key, sportscar$alt, sep=".")
sportscar <- mlogit.data(sportscar, shape="long", choice="choice", alt.var="alt")
str(sportscar)

# Create a table of chosen sportscars by transmission type
chosen_by_trans <- xtabs(choice ~ trans, data = sportscar)

# Print the chosen_by_trans table to the console
chosen_by_trans

# Plot the chosen_by_price object
barplot(chosen_by_trans)


# Crashes out due to issue with class "family" in MatrixModels and lme4
m1 <- mlogit(choice ~ seat + trans + convert + price, data=sportscar, seed=10)

# fit a choice model using mlogit() and assign the output to m1
# m1 <- mlogit::mlogit(choice ~ seat + trans + convert + price, 
#                      data=sportscar, 
#                      chid.var="key", 
#                      alt.var="alt", 
#                      choice="choice", 
#                      seed=10
#                      )

# summarize the m1 object to see the output of the choice model
summary(m1)


predict_mnl <- function(model, products) {
  # model: mlogit object returned by mlogit()
  # data: a data frame containing the set of designs for which you want to 
  #       predict shares.  Same format at the data used to estimate model. 
  data.model <- model.matrix(update(model$formula, 0 ~ .), data = products)[,-1]
  utility <- data.model%*%model$coef
  share <- exp(utility)/sum(exp(utility))
  cbind(share, products)
}

# inspect products
products <- data.frame(seat=factor("2", levels=c("2", "4", "5")), 
                       trans=factor(rep(c("manual", "auto"), each=2), levels=c("auto", "manual")), 
                       convert=factor(rep(c("no", "yes"), times=2), levels=c("no", "yes")), 
                       price=factor("35", levels=c("30", "35", "40"))
                       )
str(products)

# use predict_mnl to predict share for products
shares <- predict_mnl(m1, products)

# print the shares to the console
shares


barplot(shares$share, ylab="Predicted Market Share", 
        names.arg=c("Our Car", "Comp 1", "Comp 2", "Comp 3"))

Chapter 2 - Managing and Summarizing Choice Data

Assembling choice data:

  • Choices made in the wild (revealed preference data) can be analyzed using the transaction record and product set available
  • Can instead run a survey with hypothetical decision making (conjoint)
  • Sometimes, data are provided in wide format, with sets of columns describing the choices

Converting from wide to long:

  • Often helpful to convert the wide format data to long format instead
    • sportscar <- reshape(sportscar_wide, direction=“long”, varying = list(seat=5:7, trans=8:10, convert=11:13, price=14:16), v.names = c(“seat”, “trans”, “convert”, “price”), timevar=“alt”) # column labels are given in v.names; timevar=“alt” means make an alt column
    • new_order <- order(sportscar\(resp_id, sportscar\)ques, sportscar$alt)
    • sportscar <- sportscar[new_order,] # ordered by question
    • sportscar\(choice <- sportscar\)choice == sportscar$alt # make a boolean rather than an integer

Choice data in two files:

  • Can receive choice data from two separate files - alternatives and choices
    • sportscar <- merge(sportscar_choices, sportscar_alts, by=c(“resp_id”, “ques”))

Visualizing choce data:

  • Data in long format can be summarized and visualized
    • xtabs(~ trans, data = sportscar) # just get the totals by transmission
    • xtabs(~ trans + choice, data = sportscar) # COUNT of transmission by choice
    • xtabs(choice ~ trans, data=sportscar) # SUM of choice by trans
    • plot(xtabs(~ trans + choice, data=sportscar)) # mosaic plot
    • plot(xtabs(~ trans + segment + choice, data=sportscar)) # mosaic plot split primarily by trans, then with segment and choice

Designing a conjoint survey:

  • Conjoint surveys are popular for product design - can include any number of features
    • Begin picking attributes of interest (commonly 8-10) and levels of interest (commonly 2-5 per level)
  • Need to decide which product profiles to show to which users and which questions
  • Can create a random design in R
    • attribs <- list(Type=c(“Milk”, “Dark”, “White”), Brand=c(“Cadbury”, “Toblerone”, “Kinder”), Price=5:30/10)
    • all_comb <- expand.grid(attribs)
    • for (i in 1:100) {
    • rand_rows <- sample(1:nrow(all_comb), size=12*3)
    • rand_alts <- all_comb[rand_rows, ]
    • choc_survey[choc_survey$Subject==i, 4:6] <- rand_alts
    • }
  • Can code the survey in html or use a platform like Google or Survey Monkey
    • Can also use a firm like Qualtrics

Example code includes:

chLong <- read.csv("./RInputFiles/chocolate_choice_long.csv")
chWide <- read.csv("./RInputFiles/chocolate_choice_wide.csv")
chocolate_wide <- chWide

# Look at the head() of chocolate_wide
head(chocolate_wide)
##   Subject Trial    Brand1 Brand2      Brand3 Price1 Price2 Price3
## 1    2401     1      Dove Godiva        Dove    0.6    0.7    3.6
## 2    2401     2    Godiva Godiva   Hershey's    2.7    3.9    0.7
## 3    2401     3 Hershey's Godiva   Hershey's    1.7    3.7    3.0
## 4    2401     4     Lindt  Lindt Ghirardelli    1.0    3.6    0.5
## 5    2401     5 Hershey's Godiva   Hershey's    0.8    1.5    3.3
## 6    2401     6     Lindt   Dove      Godiva    3.1    2.5    2.6
##          Type1        Type2        Type3 Selection Response_Time
## 1         Milk         Dark        White         1          5210
## 2 Milk w/ Nuts         Dark Milk w/ Nuts         2          7480
## 3 Dark w/ Nuts         Dark         Dark         2          7704
## 4         Milk Milk w/ Nuts Dark w/ Nuts         1          5774
## 5 Milk w/ Nuts         Dark        White         2          5238
## 6         Milk        White         Dark         3          3423
# Use summary() to see which brands and types are in chocolate_wide
summary(chocolate_wide)
##     Subject         Trial            Brand1           Brand2  
##  Min.   :2401   Min.   : 1   Dove       :60   Dove       :85  
##  1st Qu.:2405   1st Qu.: 7   Ghirardelli:58   Ghirardelli:67  
##  Median :2410   Median :13   Godiva     :83   Godiva     :74  
##  Mean   :2409   Mean   :13   Hershey's  :63   Hershey's  :66  
##  3rd Qu.:2413   3rd Qu.:19   Lindt      :86   Lindt      :58  
##  Max.   :2417   Max.   :25                                    
##          Brand3       Price1          Price2          Price3     
##  Dove       :69   Min.   :0.500   Min.   :0.500   Min.   :0.500  
##  Ghirardelli:61   1st Qu.:1.100   1st Qu.:1.300   1st Qu.:1.300  
##  Godiva     :78   Median :2.200   Median :2.400   Median :2.200  
##  Hershey's  :78   Mean   :2.144   Mean   :2.255   Mean   :2.233  
##  Lindt      :64   3rd Qu.:3.100   3rd Qu.:3.200   3rd Qu.:3.100  
##                   Max.   :4.000   Max.   :4.000   Max.   :4.000  
##           Type1             Type2             Type3      Selection    
##  Dark        :63   Dark        :95   Dark        :75   Min.   :1.000  
##  Dark w/ Nuts:70   Dark w/ Nuts:68   Dark w/ Nuts:75   1st Qu.:1.000  
##  Milk        :75   Milk        :55   Milk        :60   Median :2.000  
##  Milk w/ Nuts:83   Milk w/ Nuts:55   Milk w/ Nuts:67   Mean   :1.926  
##  White       :59   White       :77   White       :73   3rd Qu.:3.000  
##                                                        Max.   :3.000  
##  Response_Time  
##  Min.   : 1021  
##  1st Qu.: 2750  
##  Median : 3878  
##  Mean   : 4713  
##  3rd Qu.: 5766  
##  Max.   :24462
# use reshape() to change the data from long to wide 
chocolate <- reshape(data= chocolate_wide , direction="long", 
                     varying = list(Brand=3:5, Price=6:8, Type=9:11), 
                     v.names=c("Brand", "Price", "Type"), timevar="Alt")
                     
# use head() to confirm that the data has been properly transformed
head(chocolate)
##     Subject Trial Selection Response_Time Alt     Brand Price         Type
## 1.1    2401     1         1          5210   1      Dove   0.6         Milk
## 2.1    2401     2         2          7480   1    Godiva   2.7 Milk w/ Nuts
## 3.1    2401     3         2          7704   1 Hershey's   1.7 Dark w/ Nuts
## 4.1    2401     4         1          5774   1     Lindt   1.0         Milk
## 5.1    2401     5         2          5238   1 Hershey's   0.8 Milk w/ Nuts
## 6.1    2401     6         3          3423   1     Lindt   3.1         Milk
##     id
## 1.1  1
## 2.1  2
## 3.1  3
## 4.1  4
## 5.1  5
## 6.1  6
# Create the new order for the chocolate data frame
new_order <- order(chocolate$Subject, chocolate$Trial, chocolate$Alt)

# Reorder the chocolate data frame to the new_order
chocolate <- chocolate[new_order,]

# Look at the head() of chocolate to see how it has been reordered
head(chocolate)
##     Subject Trial Selection Response_Time Alt     Brand Price         Type
## 1.1    2401     1         1          5210   1      Dove   0.6         Milk
## 1.2    2401     1         1          5210   2    Godiva   0.7         Dark
## 1.3    2401     1         1          5210   3      Dove   3.6        White
## 2.1    2401     2         2          7480   1    Godiva   2.7 Milk w/ Nuts
## 2.2    2401     2         2          7480   2    Godiva   3.9         Dark
## 2.3    2401     2         2          7480   3 Hershey's   0.7 Milk w/ Nuts
##     id
## 1.1  1
## 1.2  1
## 1.3  1
## 2.1  2
## 2.2  2
## 2.3  2
# Use head(chocolate) and look at the Selection variable. 
head(chocolate)
##     Subject Trial Selection Response_Time Alt     Brand Price         Type
## 1.1    2401     1         1          5210   1      Dove   0.6         Milk
## 1.2    2401     1         1          5210   2    Godiva   0.7         Dark
## 1.3    2401     1         1          5210   3      Dove   3.6        White
## 2.1    2401     2         2          7480   1    Godiva   2.7 Milk w/ Nuts
## 2.2    2401     2         2          7480   2    Godiva   3.9         Dark
## 2.3    2401     2         2          7480   3 Hershey's   0.7 Milk w/ Nuts
##     id
## 1.1  1
## 1.2  1
## 1.3  1
## 2.1  2
## 2.2  2
## 2.3  2
# Transform the Selection variable to a logical indicator
chocolate$Selection <- chocolate$Alt == chocolate$Selection

# Use head(chocolate) to see how the Selection variable has changed. Now it is logical.
head(chocolate)
##     Subject Trial Selection Response_Time Alt     Brand Price         Type
## 1.1    2401     1      TRUE          5210   1      Dove   0.6         Milk
## 1.2    2401     1     FALSE          5210   2    Godiva   0.7         Dark
## 1.3    2401     1     FALSE          5210   3      Dove   3.6        White
## 2.1    2401     2     FALSE          7480   1    Godiva   2.7 Milk w/ Nuts
## 2.2    2401     2      TRUE          7480   2    Godiva   3.9         Dark
## 2.3    2401     2     FALSE          7480   3 Hershey's   0.7 Milk w/ Nuts
##     id
## 1.1  1
## 1.2  1
## 1.3  1
## 2.1  2
## 2.2  2
## 2.3  2
choc_choice <- chocolate %>%
    filter(Selection==TRUE) %>%
    mutate(Selection=Alt) %>%
    select(Subject, Trial, Response_Time, Selection)
choc_alts <- chocolate %>%
    select(Subject, Trial, Alt, Brand, Price, Type)

str(choc_choice)
## 'data.frame':    350 obs. of  4 variables:
##  $ Subject      : int  2401 2401 2401 2401 2401 2401 2401 2401 2401 2401 ...
##  $ Trial        : int  1 2 3 4 5 6 7 8 9 10 ...
##  $ Response_Time: int  5210 7480 7704 5774 5238 3423 4691 3268 6719 3542 ...
##  $ Selection    : int  1 2 2 1 2 3 3 3 2 2 ...
str(choc_alts)
## 'data.frame':    1050 obs. of  6 variables:
##  $ Subject: int  2401 2401 2401 2401 2401 2401 2401 2401 2401 2401 ...
##  $ Trial  : int  1 1 1 2 2 2 3 3 3 4 ...
##  $ Alt    : int  1 2 3 1 2 3 1 2 3 1 ...
##  $ Brand  : Factor w/ 5 levels "Dove","Ghirardelli",..: 1 3 1 3 3 4 4 3 4 5 ...
##  $ Price  : num  0.6 0.7 3.6 2.7 3.9 0.7 1.7 3.7 3 1 ...
##  $ Type   : Factor w/ 5 levels "Dark","Dark w/ Nuts",..: 3 1 5 4 1 4 2 1 1 3 ...
##  - attr(*, "reshapeLong")=List of 4
##   ..$ varying:List of 3
##   .. ..$ Brand: chr  "Brand1" "Brand2" "Brand3"
##   .. ..$ Price: chr  "Price1" "Price2" "Price3"
##   .. ..$ Type : chr  "Type1" "Type2" "Type3"
##   ..$ v.names: chr  "Brand" "Price" "Type"
##   ..$ idvar  : chr "id"
##   ..$ timevar: chr "Alt"
# Merge choc_choice and choc_alts
choc_merge <- merge(choc_choice, choc_alts, by=c("Subject", "Trial"))

# Convert Selection to a logical variable
choc_merge$Selection <- choc_merge$Selection == choc_merge$Alt

# Inspect chocolate_merge using head
head(choc_merge)
##   Subject Trial Response_Time Selection Alt     Brand Price         Type
## 1    2401     1          5210      TRUE   1      Dove   0.6         Milk
## 2    2401     1          5210     FALSE   2    Godiva   0.7         Dark
## 3    2401     1          5210     FALSE   3      Dove   3.6        White
## 4    2401    10          3542     FALSE   1     Lindt   0.6 Milk w/ Nuts
## 5    2401    10          3542      TRUE   2    Godiva   0.8 Milk w/ Nuts
## 6    2401    10          3542     FALSE   3 Hershey's   3.7         Dark
# Use xtabs to count up how often each Type is chosen
counts <- xtabs(~ Type + Selection, data=chocolate)

# Plot the counts
plot(counts, cex = 1.5)

# Modify this code to count up how many times each **Brand** is chosen
counts <- xtabs(~ Brand + Selection, data=chocolate)

# Plot the counts
plot(counts, cex = 1.5)

# Use xtabs to count up how often each Price is chosen
counts <- xtabs(~ Price + Selection, data=chocolate)

# Plot the counts
plot(counts, cex=0.6)


Chapter 3 - Building Choice Models

Choice models - under the hood:

  • The multimonial logit model begins with a linear equation for utility which drives probabilities
    • v1 <- alpha * 4 + beta * 100 # value
    • v2 <- alpha * 5 + beta * 150
    • v2 <- alpha * 2 + beta * 175
    • u1 <- v1 + error1 # utility
    • u2 <- v2 + error2
    • u3 <- v3 + error3
    • choice <- which.max(c(u1, u2, u3))
    • p1 <- exp(v1) / ( exp(v1) + exp(v2) + exp(v3) )
    • p2 <- exp(v2) / ( exp(v1) + exp(v2) + exp(v3) )
    • p3 <- exp(v3) / ( exp(v1) + exp(v2) + exp(v3) )
  • We want to estimate the parameters that best calculate the v
    • m1 <- mlogit(choice ~ 0 + seat + price, data=sportscar, print.level=3) # find parameters that maximize likelihood, print all iterations as per print.level=3
    • summary(m1)
  • The mlogit requires a specific data format
    • sportscar <- mlogit.data(sportscar.df, shape=“long”, choice=“choice”, varying=5:8, alt.var=“alt”) # what was chose, what attributes vary, and what is the alternative number column

Interpreting choice model parameters:

  • Coefficients for each attribute are multiplied by the level of that attribute to create the v1/v2/v3
  • Factor variables are converted to numbers in the model.matrix process - need to understand what is the zero level
    • head(model.matrix(m2))
    • head(sportscar)
  • May want to convert to factors even if the data are numeric
    • sportscar\(seat <- as.factor(sportscar\)seat)
    • m3 <- mlogit(choice ~ 0 + seat + trans + convert + price, data=sportscar)
    • summary(m3)
  • Can make price response non-linear (factor) or keep linear and assume Willingness to Pay
    • coef(m3)
    • coef(m3)/-coef(m3)[5] # assumes that price is the 5th element of the coef vector

Intercepts and interactions:

  • There is no intercept in the v1, v2, v3, since adding the same constant to each of them cancels out once the exponentials are taken
    • The intercept is not identified, and so fixing the intercept using ~ 0 + is preferred (model will just pick a random one otherwise)
  • An interaction term is based on the multiplication of several terms from the original dataset
    • m4 <- mlogit(choice ~ 0 + seat + trans + convert + price + trans:price, data=sportscar) # interaction between transmission and price
    • m4 <- mlogit(choice ~ 0 + seat + trans*convert + price, data=sportscar) # same command as above, less typing
  • Interpreting the standard errors along with the z-values and p-values is similar to any other regression
  • Can also add segments, as long as they interact with at least one of the attributes
    • m5 <- mlogit(choice ~ 0 + seat + convert + trans + price:segment, data=sportscar)

Predicting shares:

  • Share predictions can be a good way to communicate preferences
  • Begin by creating vectors of attributes of interest
    • price <- c(35, 30)
    • seat <- factor(c(2, 2), levels=c(2,4,5))
    • trans <- factor(c(“manual”, “auto”), levels=c(“auto”, “manual”))
    • convert <- factor(c(“no”, “no”), levels=c(“no”, “yes”))
    • segment <- factor(c(“basic”, “basic”), levels=c(“basic”, “fun”, “racer”))
    • prod <- data.frame(seat, trans, convert, price, segment)
  • Use a model prediction to make the share predictions
    • m5 <- mlogit(choice ~ 0 + seat + convert + trans + price:segment, data=sportscar)
    • prod.coded <- model.matrix(update(m5$formula, 0 ~ .), data = prod)[,-1]
    • v <- prod.coded %*% m5$coef
    • p <- exp(u) / sum(exp(u))
    • cbind(p, prod)
    • predict_mnl <- function(model, products) {
    • data.model <- model.matrix(update(model$formula, 0 ~ .), data = products)[,-1]
    • utility <- data.model%*%model$coef
    • share <- exp(utility)/sum(exp(utility))
    • cbind(share, products)
    • }
    • shares <- predict_mnl(m5, products)
    • barplot(shares$share, horiz = TRUE, col=“tomato2”, xlab = “Predicted Market Share”, names.arg = c(“Our Sportscar”, “Competitor 1”))

Example code includes:

# use mlogit.data() to convert chocolate to mlogit.data
chocolate_df <- mlogit.data(chocolate, shape = "long",
                            choice = "Selection", alt.var = "Alt", 
                            varying = 6:8)
                         
# use str() to confirm that chocolate is an mlogit.data object
str(chocolate_df)


# Fit a model with mlogit() and assign it to choc_m1
choc_m1 <- mlogit(Selection ~ Brand + Type + Price, data=chocolate_df, print.level=3)

# Summarize choc_m1 with summary()
summary(choc_m1)


# modify the call to mlogit to exclude the intercept
choc_m2 <- mlogit(Selection ~ 0 + Brand + Type + Price, data = chocolate_df, print.level=3)

# summarize the choc_m2 model
summary(choc_m2)


# compute the wtp by dividing the coefficient vector by the negative of the price coefficient
coef(choc_m2) / -coef(choc_m2)["Price"]


# change the Price variable to a factor in the chocolate data
chocolate$Price <- as.factor(chocolate$Price)

# fit a model with mlogit and assign it to choc_m3
choc_m3 <- mlogit(Selection ~ 0 + Brand + Type + Price, data=chocolate)

# inspect the coefficients
summary(choc_m3)


# likelihood ratio test comparing two models
lrtest(choc_m2, choc_m3)


# add the formula for mlogit
choc_m4 <- mlogit(Selection ~ 0 + Brand + Type + Price + Brand:Type, data=chocolate)

# use summary to see the coefficients
summary(choc_m4)


# add the formula for mlogit
choc_m5 <- mlogit(Selection ~ 0 + Brand + Type + Price + Price:Trial, data=chocolate)

# use summary to see the outputs
summary(choc_m5)


# add the formula for mlogit
choc_m5 <- mlogit(Selection ~ 0 + Brand + Type + Price + Price:Trial, data=chocolate)

# use summary to see the outputs
summary(choc_m5)


predict_mnl <- function(model, products) {
  data.model <- model.matrix(update(model$formula, 0 ~ .), 
                             data = products)[,-1]
  utility <- data.model%*%model$coef
  share <- exp(utility)/sum(exp(utility))
  cbind(share, products)
}

# modify the code below so that the segement is set to "racer" for both alternatives
price <- c(35, 30)
seat <- factor(c(2, 2), levels=c(2,4,5))
trans <- factor(c("manual", "auto"), levels=c("auto", "manual"))
convert <- factor(c("no", "no"), levels=c("no", "yes"))
segment <- factor(c("racer", "racer"), levels=c("basic", "fun", "racer"))
prod <- data.frame(seat, trans, convert, price, segment)

# predict shares for the "racer" segment
predict_mnl(model=m5, products=prod)


# fit the choc_m2 model
choc_m2 <- mlogit(Selection ~ 0 + Brand + Type + Price, data=chocolate)

# create a data frame with the Ghiradelli products
Brand <- factor(rep("Ghirardelli", 5), level = levels(chocolate$Brand))
Type <- levels(chocolate$Type)
Price <- 3   # treated as a number in choc_m2
ghir_choc <- data.frame(Brand, Type, Price)

# predict shares
predict_mnl(model=choc_m2, products=ghir_choc)


# compute and save the share prediction 
shares <- predict_mnl(choc_m2, ghir_choc)

# make a barplot of the shares
barplot(shares$share, 
        horiz = TRUE, col="tomato2",
        xlab = "Predicted Market Share", 
        main = "Shares for Ghiradelli chocolate bars at $3 each", 
        names.arg = levels(chocolate$Type)
        )

Chapter 4 - Hierarchical Choice Models

What is a hierarchical choice model?

  • Hierarchical choice models (random coefficient models) account for differences in preferences across entities (heterogeneity)
  • An assumption is made that each individual is pulled from a distribution
    • for (i in 1:n_resp) {
    • beta[i] <- mvrnorm(1, beta_0, Sigma) # random normal vector
    • for (j in 1:n_task[i]) {
    •   X <- X[X$resp == i & X$task == j, ]  
    •   u <- X %*% beta[i]  
    •   p[i,] <- exp(u) / sum(exp(u))  
    • }
    • }
  • Can fit the hierarchical model using the mlogit() function
    • sportscar <- mlogit.data(sportscar, choice=“choice”, shape=“long”, varying=5:8, alt.var=“alt”, id.var = “resp_id”)
    • m7 <- mlogit(choice ~ 0 + seat + trans + convert + price, data = sportscar, rpar = c(price = “n”), panel = TRUE) # rpar=c(price=“n”) will nornmally distribute price parameter across people
    • summary(m7)
    • plot(m7) # plotting function for mlogit objects

Heterogeneity in preferences for other features:

  • Might have heterogeneity in choices on many other attributes, including factor data
  • A different manner of coding factors can work better for hierarchical models
    • Effects coding has -1, 0, 1 so that the factors are relative to average rather than relative to the first factor
    • contrasts(sportscar\(seat) <- contr.sum(levels(sportscar\)seat)) # stores effects coding with the data frame
    • dimnames(contrasts(sportscar\(seat))[[2]] <- levels(sportscar\)seat)[1:2] # improve readability
  • Can make all of the coefficients heterogeneous
    • my_rpar <- c(“n”, “n”, “n”, “n”, “n”) # make them all normal
    • m3 <- mlogit(choice ~ 0 + seat + trans + convert + price, data=sportscar) # get coefficient names
    • names(my_rpar) <- names(m3$coefficients) # assign them to my_rpar
    • m8 <- mlogit(choice ~ 0 + seat + trans + convert + price, data = sportscar, panel = TRUE, rpar = my_rpar) # fit the model
    • plot(m8, par=c(“seat4”, “seat5”))
    • -sum(m8$coef[1:2]) # can get the 2-seat coefficient since it no longer needs to be 0

Predicting shares with hierarchical models:

  • Can predict shares with a hierarchical model, including those where decision-making preferences may be correlated
    • m10 <- mlogit(choice ~ 0 + seat + trans + convert + price, data = sportscar, rpar = myrpar, panel=TRUE, correlation = TRUE)
    • cor.mlogit(m10)
    • mean <- m10$coef[1:5] # hard coded
    • Sigma <- cov.mlogit(m10)
    • share <- matrix(NA, nrow=1000, ncol=nrow(prod.coded))
    • for (i in 1:1000) {
    • coef <- mvrnorm(1, mu=mean, Sigma=Sigma)
    • utility <- prod.coded %*% coef
    • share[i,] <- exp(utility) / sum(exp(utility))
    • }
    • cbind(colMeans(share), prod)
  • Niche product shares tend to increase when heterogeneity is included - each element of the niche may be a small preference, but correlated with preference for other elements of the niche

Wrap up:

  • Decisions need to be made in building a choice model - attributes, numeric vs. factors, hierarchical, distributions, nesting, etc.
  • Can start with basic models and build out as needed
    • Inspect the data - investigate a few choices to confirm understanding of the data
    • Run the model and inspect the standard errors - if too high, simplify
    • Heterogeneity is a good idea whenever the decisions are being made by humans

Example code includes:

# Determine the number of subjects in chocolate$Subjects
length(levels(chocolate$Subject))


# add id.var input to mlogit.data call
chocolate <- mlogit.data(chocolate, choice = "Selection", shape="long", 
                         varying=6:8, alt.var = "Alt", id.var = "Subject"
                         )
                         
# add rpar and panel inputs to mlogit call
choc_m6 <- mlogit(Selection ~ 0 + Brand + Type + Price, data = chocolate, 
                  rpar = c(Price="n"), panel=TRUE)

# plot the model
plot(choc_m6)


# set the contrasts for Brand to effects code
contrasts(chocolate$Brand) <- contr.sum(levels(chocolate$Brand))
dimnames(contrasts(chocolate$Brand))[[2]] <- levels(chocolate$Brand)[1:4]
contrasts(chocolate$Brand)

# set the contrasts for Type to effects code
contrasts(chocolate$Type) <- contr.sum(levels(chocolate$Type))
dimnames(contrasts(chocolate$Type))[[2]] <- levels(chocolate$Type)[1:4]
contrasts(chocolate$Type)


# create my_rpar vector
choc_m2 <- mlogit(Selection ~ 0 + Brand + Type + Price, data=chocolate)
my_rpar <- rep("n", length(choc_m2$coef))
names(my_rpar) <- names(choc_m2$coef)
my_rpar

# fit model with random coefficients
choc_m7 <- mlogit(Selection ~ 0 + Brand + Type + Price, data=chocolate, rpar=my_rpar, panel=TRUE)


# print the coefficients 
choc_m7$coef[5:8]

# compute the negative sum of those coefficients
-sum(choc_m7$coef[5:8])


# Extract the mean parameters and assign to mean
mean <- choc_m8$coef[1:9]   

# Extract the covariance parameters and assign to Sigma
Sigma <- cov.mlogit(choc_m8) 

# Create storage for individual draws of share
share <- matrix(NA, nrow=1000, ncol=nrow(choc_line_coded))

# For each draw (person)
for (i in 1:1000) { 
  # Draw a coefficient vector
  coef <- mvrnorm(1, mu=mean, Sigma=Sigma)
  # Compute utilities for those coef
  utility <- choc_line_coded %*% coef
  # Compute probabilites according to logit formuila
  share[i,] <- exp(utility) / sum(exp(utility))
}  

# Average the draws of the shares
cbind(colMeans(share), choc_line)

Single-Cell RNA-Seq Workflows in R

Chapter 1 - What Is RNA Single-Cell RNA-Seq?

Background and utility:

  • Can get gene expression data at the cellular level - allows for better resolution of gene expressions
    • Previous methods would get a mix of gener expressions across many cells - better for averages and distributions, but cannot identify a specific observation or cell type
    • Implications are significant for personalized medicine and related areas
  • The data structure from the lab is a matrix - geners are rows and cells are columns
    • ATCG counts by intersection
    • Gene-level covariates
    • Cell-level covariates
  • There are many zeroes - gene not expressed in cell, or dropouts (technical errors)

Typical workflow:

  • There has been an exponential scaling in the ability to extract RNA data from 2009 - 2018
    • Full-range technologies try to capture the full RNA sequence
    • Tide-based (?) technologies try to capture the two ends of an RNA technology
  • Quality control is the process of removing problematic cells - library size and cell coverage metrics
    • Library size is the total number of reads assigned to each cell
    • Coverage is the total number of cells with reads assigned for that gene
  • Workflows then include normalization, dimensionality reduction, clustering, DE analysis (biomarkers with differential expression)

Load, create, and access data:

  • The SingleCellExperiment (SCE) class is an S4 class for storing data from single-cell experiments
    • source(“https://bioconductor.org/biocLite.R”)
    • biocLite(“SingleCellExperiment”)
    • library(SingleCellExperiment)
    • counts <- matrix(rpois(8, lambda = 10), ncol = 2, nrow = 4)
    • rownames(counts) <- c(“Lamp5”, “Fam19a1”, “Cnr1”, “Rorb”)
    • colnames(counts) <- c(“SRR2140028”, “SRR2140022”)
    • counts
  • Can create SCE data using the constructor
    • sce <- SingleCellExperiment(assays = list(counts = counts), rowData = data.frame(gene = rownames(counts)), colData = data.frame(cell = colnames(counts)))
  • Can create SCE data using coercion
    • se <- SummarizedExperiment(assays = list(counts = counts))
    • sce <- as(se, “SingleCellExperiment”)
  • Can apply process to a real dataset
    • library(scRNAseq); data(allen) # subset of mouse visual coretex data

Example code includes:

# head of count matrix
counts[1:3, 1:3]

# count of specific gene and cell
alignedReads <- counts['Cnr1', "SRR2140055"]

# overall percentage of zero counts 
pZero <- mean(counts == 0)

# cell library size
libsize <- colSums(counts)


# find cell coverage
coverage <- colMeans(counts > 0)
cell_info$coverage <- coverage

# load ggplot2
library(ggplot2)

# plot cell coverage
ggplot(cell_info, aes(x = names, y = coverage)) + 
  geom_point() +
  ggtitle('Cell Coverage') + 
  xlab('Cell Name') + 
  ylab('Coverage')


# mean of GC content
gc_mean <- mean(gene_info$gc)

# standard deviation of GC content
gc_sd <- sd(gene_info$gc)

# boxplot of GC content 
boxplot(gene_info$gc, main = 'Boxplot - GC content', ylab = 'GC content')


# batch
batch <- cell_info$batch

# patient
patient <- cell_info$patient

# nesting of batch within patient
batch_patient <- table(batch = batch, patient = patient)

# explore batch_patient
batch_patient


# load SingleCellExperiment
library(SingleCellExperiment)

# create a SingleCellExperiment object
sce <- SingleCellExperiment(assays = list(counts = counts ),
                            rowData = data.frame(gene_names = rownames(counts)),
                            colData = data.frame(cell_names = colnames(counts)))


# create a SummarizedExperiment object from counts
se <- SummarizedExperiment(assays = list(counts = counts))

# create a SingleCellExpression object from se
sce <- as(se, "SingleCellExperiment")


# create SingleCellExperiment object
sce <- as(allen, "SingleCellExperiment")

# cell information
cell_info <- colData(sce)

# size factors
sizeFactors(sce) <- colSums(assay(sce))

Chapter 2 - Quality Control and Normalization

Quality Control:

  • Need to remove low quality cells and genes - identify first
  • Tung dataset includes three replicates
    • sce
    • library(scater)
    • sce <- calculateQCMetrics(sce, feature_controls = list(ERCC = isSpike(sce, “ERCC”))
  • ERCC spiking genes are used for quality control - filter out cells with improper ratios (usually too much due to dead or stressed or the like) of “spiking”
  • Key functions used in the exercises include
    • calculateQCMetrics()
    • counts()
    • rowSums()
    • grepl()
    • isSpike()
    • plot(density(x))
    • abline()

Quality Control (continued):

  • Can filter based on library sizes using
    • threshold <- 20000
    • plot(density(sce$total_counts), main = “Density - total_counts”)
    • abline(v = threshold)
    • keep <- (sce$total_counts > threshold)
    • table(keep)
  • Can look at plots of the data
    • scater::plotPhenoData(sce, aes_string(x = “total_counts”, y = “total_counts_ERCC”, colour = “batch”))
  • Can then filter based on data that do not meet key criteria in the plot
    • keep <- (sce$batch != “NA19098.r2”)
    • table(keep)
    • filter_genes <- apply(counts(sce), 1, function(x) length(x[x >= 2] >= 2) # keep genes with counts of 2+ in at least 2+ cells
    • table(filter_genes)

Normalization:

  • Want to group cells based on their gene expression profiles; target with different drugs, for example
  • Technical artifacts can be introduced in the data
    • Batch effect is a common problem with the data - cells may cluster by batch, even if they are from the same entity
    • Can normalize based on dividing by library size (multiplied if needed to get count per million - CPM)
  • Exercise will use the following functions
    • plotPCA()
    • reducedDim(sce, “PCA”)[, 1:2]
    • computeSumFactors()
    • sizeFactors()
    • assays()
    • normalize()
    • plotRLE()

Example code includes:

# remove genes with only zeros
nonZero <- counts(sce) > 0
keep <- rowSums(nonZero) > 0
sce_2 <- sce[keep, ]

# spike-ins ERCC
isSpike(sce_2, "ERCC") <- grepl("^ERCC-", rownames(sce_2))


# load scater
library(scater)

# calculate QCs
sce <- calculateQCMetrics(sce, feature_controls = list(ERCC = isSpike(sce, "ERCC")))

# explore coldata of sce
colData(sce)


# set threshold
threshold <- 20000

# plot density
plot(density(sce@colData$total_counts), main = 'Density - total_counts')
abline(v = threshold)

# keep cells
keep <- sce@colData$total_counts > threshold

# tabulate kept cells
table(keep)


# set threshold
threshold <- 6000

# plot density
plot(density(sce$total_features), main = 'Density - total_features')
abline(v=threshold)

# keep cells
keep <- sce$total_features > threshold

# tabulate kept cells
table(keep)


#extract cell data into a data frame
cDataFrame <- as.data.frame(colData(sce))

# plot cell data
ggplot(cDataFrame, aes(x = total_counts, y = total_counts_ERCC, col = batch)) + 
  geom_point()

# keep cells
keep <- sce$batch != "NA19098.r2"

# tabulate kept cells
table(keep)


# load SingleCellExperiment
library(SingleCellExperiment)

# filter genes
filter_genes <- apply(counts(sce), 1, function(x){
  length(x[x > 1]) > 1
})

# tabulate the results of filter_genes
table(filter_genes)


# PCA raw counts
plotPCA(sce, exprs_values = "counts",
    colour_by = "batch", shape_by = "individual")

# PCA log counts
plotPCA(sce, exprs_values = "logcounts_raw",
        colour_by = "batch", shape_by = "individual")


#find first 2 PCs
pca <- reducedDim(sce, "PCA")[, 1:2]

#create cdata
cdata <- data.frame(PC1 = pca[, 1],
                    libsize = sce$total_counts,
                    batch = sce$batch)

#plot pc1 versus libsize
ggplot(cdata, aes(x = PC1, y = libsize, col = batch)) +
  geom_point()


# load scran
library(scran)

# find size factors
sce <- computeSumFactors(sce)

# display size factor histogram
hist(sizeFactors(sce))


# view assays
assays(sce)

# normalize sce
normalized_sce <- normalize(sce)

# view new assay for normalized logcounts
assays(normalized_sce)

Chapter 3 - Visualization and Dimensionality Reduction

Mouse Epithelium Dataset:

  • Goal is to reduce the number of dimensions (from number of genes to something much smaller)
  • Mouse olfactory cell dataset - epithelium stem cell differentiation
    • Dimensionlaity reduction makes for smaller data with preservation of signal much more so than noise

Visualization:

  • Can visualize datasets using dimensionality reduction through any of several methods - PCA, tSNE, ZIFA, ZINB-WaVE
    • plotPCA(sce, exprs_values = “logcounts”, shape_by = “Batch”, colour_by = “publishedClusters”) # los help reduce bias towards highly expressed genes
    • plotTSNE(sce, exprs_values = “logcounts”, shape_by = “Batch”, colour_by = “publishedClusters”, perplexity = 5) # perplexity is a guess about the kNN parameter

Dimensionality Reduction:

  • Can find the most variable genes using magrittr
    • library(magrittr)
    • vars <- assay(sce) %>% log1p %>% rowVars
    • names(vars) <- rownames(sce)
    • vars <- sort(vars, decreasing = TRUE)
    • head(vars)
    • sce_sub <- sce[names(vars[1:50]),]
    • sce_sub
  • Can run dimensionality reduction using PCA
    • logcounts <- log1p(assay(sce_sub))
    • pca <- prcomp(t(logcounts))
    • reducedDims(sce_sub) <- SimpleList(PCA = pca$x)
    • sce_sub
    • head(reducedDim(sce_sub, “PCA”)[, 1:2])
  • Can then plot the PCA components
    • pca <- reducedDim(sce_sub, “PCA”)[, 1:2]
    • col <- colData(sce)[, c(“publishedClusters”, “batch”)]
    • df <- cbind(pca, col)
    • ggplot(df, aes(x = PC1, y = PC2, col = publishedClusters, shape = batch)) +
    • geom_point()

Example code includes:

# find dimensions
mydims <- dim(sce)

# extract cell and gene names
cellNames <- colnames(sce)
geneNames <- rownames(sce)


# cell data
cData <- colData(sce)

#print column names
colnames(cData)

# table batch & clusters
cData <- cData[, c('Batch', 'publishedClusters')]

#tabulate cData
table(cData)


# load scater
library(scater)

# plot pc1 and pc2 counts
plotPCA(
    object = sce,
    exprs_values = "counts",
    shape_by = "Batch",
    colour_by = "publishedClusters"
)


# explore initial assays
assays(sce)

# create log counts
logcounts <- log1p(assays(sce)$counts)

# add log counts
assay(sce, 'logcounts') <- logcounts
assays(sce)

# pca log counts
plotPCA(object = sce, exprs_values = "logcounts",
    shape_by = "Batch", colour_by = "publishedClusters")


# default tSNE
plotTSNE(
    sce,
    exprs_values = "counts",
    shape_by = "publishedClusters",
    colour_by = "Batch",
    perplexity = 5
)


# gene variance 
vars <- assay(sce) %>% log1p() %>% rowVars() 

#rename vars
names(vars) <- rownames(sce)

#sort vars
vars_2 <- sort(vars, decreasing = TRUE)
head(vars_2)

# subset sce 
sce_sub <- sce[names(vars[1:50]), ]
sce_sub


# log counts
logcounts <- log1p(assays(sce_sub)$counts)

# transpose
tlogcounts <- t(logcounts)

# perform pca
pca <- prcomp(tlogcounts)

# store pca matrix in sce
reducedDims(sce_sub) <- SimpleList(PCA = pca$x)
head(reducedDim(sce_sub, "PCA")[, 1:2])


# Extract PC1 and PC2 and create a data frame
pca <- reducedDim(sce_sub, "PCA")[, 1:2]
col_shape <- data.frame(publishedClusters = colData(sce)$publishedClusters, Batch = factor(colData(sce)$Batch))
df <- cbind(pca, col_shape)

# plot PC1, PC2
ggplot(df, aes(x = PC1, y = PC2, 
            colour = publishedClusters, 
            shape = Batch)) + 
  geom_point()

Chapter 4 - Cell Clustering and Differential Expression Analysis

Clustering methods for scRNA-Seq:

  • Continuing to use the mouse epithelium dataset - cells color coded by cluster as per previous chapters
  • One of the goals of clustering is to group cells with similar gene expression, allowing for finding patterns in gene expression
    • Hierarchical clustering
    • k-means clustering
  • Challenges include setting the number of clusters, scalability to large datasets, etc.
  • Can begin by creating the Seurat object
    • library(Seurat)
    • library(SingleCellExperiment)
    • seuset <- CreateSeuratObject(
    • raw.data = assay(sce),
    • normalization.method = “LogNormalize”,
    • scale.factor = 10000,
    • meta.data = as.data.frame(colData(sce))
    • )
    • seuset <- ScaleData(object = seuset)
    • seuset
  • Can then perform clustering on the seuset object
    • seuset <- FindClusters( object = seuset, reduction.type = “pca”, dims.use = 1:10, resolution = 1.8, print.output = FALSE )
    • PCAPlot( object = seuset, group.by = “ident”, pt.shape = “publishedClusters” )

Differential expression analysis:

  • Differential expression (DE) analysis is to find differential expression of genes in various cells
    • Methods include SCDE, MAST, edgeR, DESeq2, etc.
  • Can fit a MAST model using function zlm
    • library(MAST)
    • zlm <- zlm(~ celltype + cngeneson, sce)
    • summary <- summary(zlm, doLRT = “celltype9”)
    • summary
    • fit <- summary$datatable
    • fit <- merge(fit[contrast==‘celltype9’ & component==‘H’, .(primerid, Pr(>Chisq))], fit[contrast==‘celltype9’ & component==‘logFC’, .(primerid, coef)], by=‘primerid’)
    • fit[, padjusted:=p.adjust(Pr(>Chisq), ‘fdr’)]
    • res = data.frame(gene = fit\(primerid, pvalue = fit[,'Pr(>Chisq)'], padjusted = fit\)padj, logFC = fit$coef)
    • head(res)

Visualization of DE genes:

  • Visualization is typically the final step of single-cell analysis
  • The volcano plot looks at fold-change and p-values simultaneously
    • ggplot(res, aes(x=logFC, y=-log10(padjusted), color=mostDE)) + geom_point() +
    • ggtitle(“Volcano”) + xlab(“log2 FC”) + ylab(“-log10 adjusted p-value”)
  • Can also look at results of DE using a heatmap
    • library(NMF)
    • norm <- assay(sce[mostDE, ], “logcounts”)
    • norm <- as.matrix(norm)
    • aheatmap(norm, annCol = colData(sce)$publishedClusters)
  • Course covered the typical workflow for analysis of single-cell RNA sequencing data
    • Normalization
    • Dimensionality reduction
    • Clustering
    • Differential expression analysis

Example code includes:

# load Seurat
library(Seurat)

#create seurat object
seuset <- CreateSeuratObject(
    raw.data = assay(sce),
    normalization.method = "LogNormalize", 
    scale.factor = 10000,
    meta.data = as.data.frame(colData(sce))
)

# scale seuset object
scaled_seuset <- ScaleData(object = seuset)


# perform pca
seuset <- RunPCA(
    object = seuset, 
    pc.genes = rownames(seuset@raw.data), 
    do.print = FALSE
)
# plot pca
PCAPlot(object = seuset,
        pt.shape = 'Batch',
        group.by = 'publishedClusters')


# load MAST
library(MAST)

# SingleCellAssay object 
sca

# fit zero-inflated regression 
zlm <- zlm(~ celltype + cngeneson, sca) 

# summary with likelihood test ratio
summary <- summary(zlm, doLRT = "celltype9")


# get summary table
fit <- summary$datatable

# pvalue df
pvalue <- fit[contrast == 'celltype9' & component == 'H', .(primerid, `Pr(>Chisq)`)]
  
# logFC df
logFC <- fit[contrast == 'celltype9' & component == 'logFC', .(primerid, coef)]

# pvalues and logFC
fit <- merge(pvalue, logFC, by = 'primerid')


# adjusted pvalues
fit[, padjusted:=p.adjust(`Pr(>Chisq)`, 'fdr')]

# result table
res <- data.frame(gene = fit$primerid,
                 pvalue = fit[,'Pr(>Chisq)'],
                 padjusted = fit$padj,
                 logFC = fit$coef)


# most DE 
res <- res[order(res$padjusted), ]
mostDE <- res$gene[1:20]
res$mostDE <- res$gene %in% mostDE

# volcano plot
ggplot(res, aes(x=logFC, y=-log10(padjusted), color=mostDE)) +
  geom_point() +
  ggtitle("Volcano plot") +
  xlab("log2 fold change") + 
  ylab("-log10 adjusted p-value")


# load NMF
library(NMF)

# normalize log counts
norm <- assay(sce[mostDE, ], "logcounts")
mat <- as.matrix(norm)

# heatmap
aheatmap(mat, annCol = colData(sce)$publishedClusters)

Differential Expression Analysis in R with limma

Chapter 1 - Differential Expression Analysis

Differential expression analysis:

  • Analysis of data from functional genomics experiments
  • Example of having treated cells with phenotypes A and B
    • The features can be genes or proteins or other molecular features of the cell - proxy for relative abundance (such as RNA)
    • Upregulated - higher expression level
    • Downregulated - lower expression level
  • Objectives are to look for novelty (genes that play an unexpected role), context (interpreting relevance of gene behaviors), systems level understanding (simultaneous allows for looking at pathways)
  • Many caveats to the analysis - study design is very important

Differential expression data:

  • Data will be from the breast cancer data and CLL data - testing for differences in two groups of people within each
    • x - Expression matrix
    • f - Feature data - genes or proteins
    • p - Phenotype data - description of each of the samples
  • Can begin by looking at the boxplot for a single gene
    • boxplot(x[1, ] ~ p[, “er”], main = f[1, “symbol”])

ExpressionSet class:

  • Data management can become precarious, especially when filtering and subsetting
  • Object-oriented programming can help - the class can hold the data, and has methods/functions that work specially on objectes of that class
    • Accessors (getters) get the data
    • Setters modify the stored data
    • source(“https://bioconductor.org/biocLite.R”)
    • biocLite(“Biobase”)
    • library(Biobase)
    • eset <- ExpressionSet(assayData = x, phenoData = AnnotatedDataFrame(p), featureData = AnnotatedDataFrame(f))
  • Can access data from an ExpressionSet object
    • x <- exprs(eset)
    • f <- fData(eset)
    • p <- pData(eset)
    • eset_sub <- eset[1000, 1:10]
    • boxplot(exprs(eset)[1, ] ~ pData(eset)[, “er”], main = fData(eset)[1, “symbol”])

The limma package:

  • Advantages of the limma package include replacing boiler-plate code and improved inference by sharing across genes (do not assume full independene - all from same experiment)
    • Method used is empirical Bayes - convenience and better statistics (especially for smaller data sets)
    • Good functions for pre-processing and post-processing
  • Specifying a linear model - Y = B0 + B1 * X1 + epsilon where Y is the expression level of the gene, B0 is the mean in ER- tumors, and B1 is the mean difference in expression in ER+ tumors
    • model.matrix(~, data = )
    • design <- model.matrix(~er, data = pData(eset))
    • colSums(design)
  • Can then test the design matrix using the standard limma pipeline
    • library(limma)
    • fit <- lmFit(eset, design)
    • fit <- eBayes(fit)
    • results <- decideTests(fit[, “er”])
    • summary(results) # -1 will be downregulated and +1 will be upregulated

Example code includes:

# Create a boxplot of the first gene in the expression matrix
boxplot(x[1, ] ~ p[, "Disease"], main = f[1, "symbol"])


# Load package
library(Biobase)

# Create ExpressionSet object
eset <- ExpressionSet(assayData = x,
                      phenoData = AnnotatedDataFrame(p),
                      featureData = AnnotatedDataFrame(f))

# View the number of features (rows) and samples (columns)
dim(eset)


# Subset to only include the 1000th gene (row) and the first 10 samples
eset_sub <- eset[1000, 1:10]

# Check the dimensions of the subset 
dim(eset_sub)

# Create a boxplot of the first gene in eset_sub
boxplot(exprs(eset_sub)[1, ] ~ pData(eset_sub)[, "Disease"],
        main = fData(eset_sub)[1, "symbol"])


# Create design matrix for leukemia study
design <- model.matrix(~Disease, data = pData(eset))

# Count the number of samples modeled by each coefficient
colSums(design)


# Load package
library(limma)

# Fit the model
fit <- lmFit(eset, design)

# Calculate the t-statistics
fit <- eBayes(fit)

# Summarize results
results <- decideTests(fit[, "Diseasestable"])
summary(results)

Chapter 2 - Flexible Models for Common Study Designs

Flexible linear models:

  • The models can be extended, for example to Y = B0 + B1X1 + B2X2 + eps
    • This model is known as a treatment-contrast model
  • Can instead use a group-means parameterization - Y = B1X1 + B2X2 + eps
    • Can then test whether B1-B2 == 0 since the intercept was exluded
    • design <- model.matrix(~0 + er, data = pData(eset))
    • cm <- limma::makeContrasts(status = erpositive - ernegative, levels = design) # erpositive-ernegative means multiply erpositive by 1 and multiply ernegative by -1
    • fit <- lmFit(eset, design) # per above
    • fit2 <- contrasts.fit(fit, contrasts = cm) # for the contrasts method
    • fit2 <- eBayes(fit2)
    • results <- decideTests(fit2)
    • summary(results)

Studies with more than two groups:

  • Dataset for this example has groups with leukemia types ALL, AML, CML - 20172x36 (12 leukemias of each type)
  • Desire to build a group-means model - Y = B1X1 + B2X2 + B3*X3 + eps
    • design <- model.matrix(~0 + type, data = pData(eset))
    • cm <- limma::makeContrasts(AMLvALL = typeAML - typeALL, CMLvALL = typeCML - typeALL, CMLvAML = typeCML - typeAML, levels = design)
    • fit <- lmFit(eset, design)
    • fit2 <- contrasts.fit(fit, contrasts = cm)
    • fit2 <- eBayes(fit2)
    • results <- decideTests(fit2)
  • Exercises will look at gene expressions of stem cells grown in states of hypoxia

Factorial experimental design:

  • Factorial designs look at every combination of experimental variables - for example, if there is a 2x2, then there would be 4 combinations examined
  • Example of 2x2 study in plants of types col, vte2 for temperatures of high, low - 11871 x 12
  • Can run the group-means model with the zero intercept; need to first create the type-temperature variable using paste
    • group <- with(pData(eset), paste(type, temp, sep = “.”))
    • group <- factor(group) # records the unique levels
    • design <- model.matrix(~0 + group)
    • colnames(design) <- levels(group)
  • May want to assess the interaction effect (difference in impact of temperature by type) as well as the direct effects (impact of temperature on a specific type, impact for same temperature across types)
    • cm <- makeContrasts(type_normal = vte2.normal - col.normal, type_low = vte2.low - col.low, temp_vte2 = vte2.low - vte2.normal, temp_col = col.low - col.normal, interaction = (vte2.low - vte2.normal) - (col.low - col.normal), levels = design)
    • fit <- lmFit(eset, design)
    • fit2 <- contrasts.fit(fit, contrasts = cm)
    • fit2 <- eBayes(fit2)
    • results <- decideTests(fit2)

Example code includes:

# Create design matrix with no intercept
design <- model.matrix(~0 + Disease, data = pData(eset))

# Count the number of samples modeled by each coefficient
colSums(design)


# Load package
library(limma)

# Create a contrasts matrix
cm <- makeContrasts(status = Diseaseprogres. - Diseasestable, levels = design)

# View the contrasts matrix
cm


# Load package
library(limma)

# Fit the model
fit <- lmFit(eset, design)

# Fit the contrasts
fit2 <- contrasts.fit(fit, contrasts = cm)

# Calculate the t-statistics for the contrasts
fit2 <- eBayes(fit2)

# Summarize results
results <- decideTests(fit2)
summary(results)


# Create design matrix with no intercept
design <- model.matrix(~0 + oxygen, data = pData(eset))

# Count the number of samples modeled by each coefficient
colSums(design)


# Load package
library(limma)

# Create a contrasts matrix
cm <- makeContrasts(ox05vox01 = oxygenox05 - oxygenox01,
                    ox21vox01 = oxygenox21 - oxygenox01,
                    ox21vox05 = oxygenox21 - oxygenox05,
                    levels = design)

# View the contrasts matrix
cm


# Load package
library(limma)

# Fit the model
fit <- lmFit(eset, design)

# Fit the contrasts
fit2 <- contrasts.fit(fit, contrasts = cm)

# Calculate the t-statistics for the contrasts
fit2 <- eBayes(fit2)

# Summarize results
results <- decideTests(fit2)
summary(results)


# Create single variable
group <- with(pData(eset), paste(type, water, sep = "."))
group <- factor(group)

# Create design matrix with no intercept
design <- model.matrix(~0 + group)
colnames(design) <- levels(group)

# Count the number of samples modeled by each coefficient
colSums(design)


# Load package
library(limma)

# Create a contrasts matrix
cm <- makeContrasts(type_normal = nm6.normal - dn34.normal,
                    type_drought = nm6.drought - dn34.drought,
                    water_nm6 = nm6.drought - nm6.normal,
                    water_dn34 = dn34.drought - dn34.normal,
                    interaction = (nm6.drought - nm6.normal) - (dn34.drought - dn34.normal),
                    levels = design)

# View the contrasts matrix
cm


# Load package
library(limma)

# Fit the model
fit <- lmFit(eset, design)

# Fit the contrasts
fit2 <- contrasts.fit(fit, contrasts = cm)

# Calculate the t-statistics for the contrasts
fit2 <- eBayes(fit2)

# Summarize results
results <- decideTests(fit2)
summary(results)

Chapter 3 - Pre-processing and post-processing

Normalizing and filtering:

  • Need to convert raw data to analysis-ready data - generic approach for first-pass to new dataset
    • Log transformation
    • Quantile normalization
    • Filtering
  • Can start with visualization of densities using the limma package
    • limma::plotDensities(eset, legend = FALSE)
    • exprs(eset) <- log(exprs(eset)) # log transform
    • limma::plotDensities(eset, legend = FALSE)
  • Want to remove technical artifacts using quantile normalization
    • exprs(eset) <- normalizeBetweenArrays(exprs(eset))
    • limma::plotDensities(eset, legend = FALSE)
    • abline(v = 5) # from visualization, 5 may be a cutoff where the data should be kept
    • keep <- rowMeans(exprs(eset)) > 5
    • eset <- eset[keep, ]
    • plotDensities(eset, legend = FALSE)

Accounting for technical batch effects:

  • Technical batch effects are artifacts arising from differences in experiments - true for all experiment types, including functional genomics
    • Need to balance variables of interest across batches - cannot just take type a from batch a and type b from type b and see if there are differences
    • PCA and other dimension reduction techniques can help identify technical batch effects
    • limma::plotMDS(eset, labels = pData(eset)[, “time”], gene.selection = “common”)
  • Removing batch effects is also possible in limma
    • exprs(eset) <- limma::removeBatchEffect(eset, batch = pData(eset)[, “batch”], covariates = pData(eset)[, “rin”])
    • limma::plotMDS(eset, labels = pData(eset)[, “time”], gene.selection = “common”)
  • For statistical analysis, it is better to include batch as a coefficient for analysis rather than to run the remove batch effect process

Visualizing results:

  • Can inspect the results and visualize using limma
    • results <- decideTests(fit2)
    • topTable(fit2, number = 3)
    • stats <- topTable(fit2, number = nrow(fit2), sort.by = “none”)
  • Under the null hypothesis of no impact, the p-values should be uniformly distributed
    • hist(runif(10000))
    • hist(stats[, “P.Value”]) # should have many values near zero if there is an actual impact
  • Can examine results using a Volcano plot
    • volcanoplot(fit2, highlight = 5, names = fit2$genes[, “symbol”])

Enrichment testing:

  • Can use curated biological databases as a reference point
  • Can use the Fisher’s exact test
    • fisher.test(matrix(c(10, 100, 90, 900), nrow = 2))
  • Can also test for KEGG (reference set) enrichment, which requires a common ID
    • entrez <- fit2$genes[, “entrez”]
    • enrich_kegg <- kegga(fit2, geneid = entrez, species = “Hs”) # Hs is homo sapiens
    • topKEGG(enrich_kegg, number = 3)
  • Can also test for GO (reference set) enrichment
    • enrich_go <- goana(fit2, geneid = entrez, species = “Hs”)
    • topGO(enrich_go, ontology = “BP”, number = 3)

Example code includes:

# Load package
library(limma)

# View the distribution of the raw data
plotDensities(eset, legend = FALSE)

# Log tranform
exprs(eset) <- log(exprs(eset))
plotDensities(eset, legend = FALSE)

# Quantile normalize
exprs(eset) <- normalizeBetweenArrays(exprs(eset))
plotDensities(eset, legend = FALSE)


# Load package
library(limma)

# View the normalized gene expression levels
plotDensities(eset, legend = FALSE); abline(v = 5)

# Determine the genes with mean expression level greater than 5
keep <- rowMeans(exprs(eset)) > 5
sum(keep)

# Filter the genes
eset <- eset[keep, ]
plotDensities(eset, legend = FALSE)


# Load package
library(limma)

# Plot principal components labeled by treatment
plotMDS(eset, labels = pData(eset)[, "treatment"], gene.selection = "common")

# Plot principal components labeled by batch
plotMDS(eset, labels = pData(eset)[, "batch"], gene.selection = "common")


# Load package
library(limma)

# Remove the batch effect
exprs(eset) <- removeBatchEffect(eset, batch = pData(eset)[, "batch"])

# Plot principal components labeled by treatment
plotMDS(eset, labels = pData(eset)[, "treatment"], gene.selection = "common")

# Plot principal components labeled by batch
plotMDS(eset, labels = pData(eset)[, "batch"], gene.selection = "common")


# Obtain the summary statistics for every gene
stats <- topTable(fit2, number = nrow(fit2), sort.by = "none")

# Plot a histogram of the p-values
hist(stats[, "P.Value"])


# Create a volcano plot. Highlight the top 5 genes
volcanoplot(fit2, highlight = 5, names = fit2$genes$symbol)


# Extract the entrez gene IDs
entrez <- fit2$genes[, "entrez"]

# Test for enriched KEGG Pathways
enrich_kegg <- kegga(fit2, geneid = entrez, species = "Hs")

# View the top 20 enriched KEGG pathways
topKEGG(enrich_kegg, number=20)


# Extract the entrez gene IDs
entrez <- fit2$genes[, "entrez"]

# Test for enriched GO categories
enrich_go <- goana(fit2, geneid = entrez, species = "Hs")

# View the top 20 enriched GO Biological Processes
topGO(enrich_go, ontology = "BP", number=20)

Chapter 4 - Case Study: Effect of Doxorubicin Treatment

Pre-process data:

  • Doxorubicin is a commonly-prescribed cancer drug, with a strong side effect of cariotoxicity
  • Hypothesis for the MOA is that top2B is involved, and was tested in mice
    • Wild mice tested against top2b null mice, each given DOX and a placebo
    • The eset data is 29532 x 12 (3 replicates per combination of 2x2 factors)
  • Begin by inspecting and then pre-processing the data
    • plotDensities(eset, group = pData(eset)[, “genotype”], legend = “topright”)
  • Prep-processing steps include log-transform, quantile transform, and filter

Model the data:

  • Can look at the main clusters of mice vs. treatments (top2b null seem to cluster together)
    • plotMDS(eset, labels = pData(eset)[, “genotype”], gene.selection = “common”)
    • plotMDS(eset, labels = pData(eset)[, “treatment”], gene.selection = “common”)
  • Follow the model.matrix process to run a differential expression analysis
    • Contrasts will include wild to dox, top2b to dox, interaction effect of wild vs. top2b to dox
    • Can also run hypothesis tests using the limma pipeline and a Venn diagram

Inspect the results:

  • Initial results seem to support the hypothesis that top2b is the main vector for cardiotoxicity
  • The limma function topTable can be run, with a sepcified contrast
    • coef = “dox_wt”
    • coef = “dox_top2b”
    • coef = “interaction”
  • Can use the volcanoplot for x-axis of log-fold change and y-axis for the log-odds of differential expression
    • kegga and topKEGG functions
    • species = “Mm” # common house mouse

Wrap up:

  • Pre-processing and visualization of gene data
  • Principal components analysis and plotMDS()
  • Fitting a group-means model for more interpretable contrasts
  • Investigation of p-values for uniformity vs. skew for low p-values
  • Use of volcanoplots
  • Testing for enrichment of differentially expressed genes

Example code includes:

# Log transform
exprs(eset) <- log(exprs(eset))
plotDensities(eset,  group = pData(eset)[, "genotype"], legend = "topright")

# Quantile normalize
exprs(eset) <- normalizeBetweenArrays(exprs(eset))
plotDensities(eset,  group = pData(eset)[, "genotype"], legend = "topright")

# Determine the genes with mean expression level greater than 0
keep <- rowMeans(exprs(eset)) > 0
sum(keep)

# Filter the genes
eset <- eset[keep, ]
plotDensities(eset, group = pData(eset)[, "genotype"], legend = "topright")


# Find the row which contains Top2b expression data
top2b <- which(fData(eset)["symbol"] == "Top2b")

# Plot Top2b expression versus genotype
boxplot(exprs(eset)[top2b, ] ~ pData(eset)[, "genotype"], main = fData(eset)[top2b, ])


# Plot principal components labeled by genotype
plotMDS(eset, labels = pData(eset)[, "genotype"], gene.selection = "common")

# Plot principal components labeled by treatment
plotMDS(eset, labels = pData(eset)[, "treatment"], gene.selection = "common")


# Create single variable
group <- with(pData(eset), paste(genotype, treatment, sep = "."))
group <- factor(group)

# Create design matrix with no intercept
design <- model.matrix(~0 + group)
colnames(design) <- levels(group)

# Count the number of samples modeled by each coefficient
colSums(design)


# Create a contrasts matrix
cm <- makeContrasts(dox_wt = wt.dox - wt.pbs,
                    dox_top2b = top2b.dox - top2b.pbs,
                    interaction = (top2b.dox - top2b.pbs) - (wt.dox - wt.pbs),
                    levels = design)

# View the contrasts matrix
cm


# Fit the model
fit <- lmFit(eset, design)

# Fit the contrasts
fit2 <- contrasts.fit(fit, contrasts = cm)

# Calculate the t-statistics for the contrasts
fit2 <- eBayes(fit2)

# Summarize results
results <- decideTests(fit2)
summary(results)

# Create a Venn diagram
vennDiagram(results)


# Obtain the summary statistics for the contrast dox_wt
stats_dox_wt <- topTable(fit2, coef = "dox_wt", number = nrow(fit2), sort.by = "none")
# Obtain the summary statistics for the contrast dox_top2b
stats_dox_top2b <- topTable(fit2, coef = "dox_top2b", number = nrow(fit2), sort.by = "none")
# Obtain the summary statistics for the contrast interaction
stats_interaction <- topTable(fit2, coef = "interaction", number = nrow(fit2), sort.by = "none")

# Create histograms of the p-values for each contrast
hist(stats_dox_wt[, "P.Value"])
hist(stats_dox_top2b[, "P.Value"])
hist(stats_interaction[, "P.Value"])


# Extract the gene symbols
gene_symbols <- fit2$genes[, "symbol"]

# Create a volcano plot for the contrast dox_wt
volcanoplot(fit2, coef = "dox_wt", highlight = 5, names = gene_symbols)

# Create a volcano plot for the contrast dox_top2b
volcanoplot(fit2, coef = "dox_top2b", highlight = 5, names = gene_symbols)

# Create a volcano plot for the contrast interaction
volcanoplot(fit2, coef = "interaction", highlight = 5, names = gene_symbols)


# Extract the entrez gene IDs
entrez <- fit2$genes[, "entrez"]

# Test for enriched KEGG Pathways for contrast dox_wt
enrich_dox_wt <- kegga(fit2, coef = "dox_wt", geneid = entrez, species = "Mm")

# View the top 5 enriched KEGG pathways
topKEGG(enrich_dox_wt, number = 5)

# Test for enriched KEGG Pathways for contrast interaction
enrich_interaction <- kegga(fit2, coef = "interaction", geneid = entrez, species = "Mm")

# View the top 5 enriched KEGG pathways
topKEGG(enrich_interaction, number = 5)

Interactive Data Visualization with bokeh

Chapter 1 - rbokeh Introduction

Getting started with rbokeh:

  • rbokeh is the R interface to the Python Bokeh plot package - interactive and informative for end users
  • Data manipulation and pre-processing are needed, with tidyverse being integral for this course
  • Can run an example using the gapminder dataset
    • library(gapminder)
    • data_2002 <- gapminder %>% filter(year == 2002)
    • gapminder_mod <- gapminder %>% mutate(pop_millions = pop/10^6)

Layers for rbokeh:

  • The rbokeh plot is initialized using figure() with layers added using the pipe operator (note the contrast with the plus used in ggplot2)
    • data_rwanda <- gapminder %>% filter(country == “Rwanda”)
    • figure() %>% ly_lines(x = year, y = lifeExp, data = data_rwanda)
    • figure() %>% ly_lines(x = data_rwanda\(year, y = data_rwanda\)lifeExp) # same output, but with different axis labels
  • Can look at the ggplot2::economics dataset
    • plot_pop <- figure() %>% ly_lines(x = date, y = pop, data = economics)
    • plot_pop

Layers for rbokeh (continued):

  • There are many layers in rbokeh, and they all begin with ly_…()
  • Example for creating a one-layer plot
    • dat_1982 <- gapminder %>% filter(year == 1982)
    • figure() %>% ly_points(x = gdpPercap, y = lifeExp, data = dat_1982)
  • Example for creating a multi-layer plot - note that the data argument can be added to figure, and will inherit to the succeeding ly_() ommands
    • data_oceania <- gapminder %>% filter(continent == “Oceania”)
    • figure(data = data_oceania, legend_location = “bottom_right”) %>% ly_lines(x = year, y = gdpPercap , color = country) %>% ly_points(x = year, y = gdpPercap, color = country)

Example code includes:

## load rbokeh, gapminder and dplyr libraries
library(rbokeh)
library(gapminder)
library(dplyr)


## explore gapminder dataset 
str(gapminder)

## filter gapminder data by year 1982
dat_1982 <- gapminder %>% filter(year == 1982)


## plot life expectancy Vs GDP per Capita using data_1982
figure(legend_location = "bottom_right", title = "Life Expectancy Vs. GDP per Capita in 1982") %>% 
    ly_points(x = gdpPercap, y = lifeExp, data = dat_1982, 
              color = continent, hover = c(continent, country, pop)
              )


## filter the dataset for the continent Africa and and year 1967
data_africa <- gapminder %>% 
  filter(year==1967, continent=="Africa")
  
## view data_africa
data_africa


## plot life expectancy Vs GDP per Capita using data_africa   
figure(legend_location = "bottom_right",
       title = "Life Expectancy Vs. GDP per Capita in Africa - 1967"
       ) %>% 
       ly_points(x = gdpPercap, y = lifeExp, data = data_africa, hover = c(country, pop))


## add a new column with gdp in millions
gapminder_mill <- gapminder %>% 
  mutate(gdp_millions = gdpPercap * pop / 10^6)
  
## view the first 6 entries in gapminder after adding  gdp_millions
head(gapminder_mill)

## extract the entries for "Rwanda"
data_rwanda <- gapminder_mill %>% 
  filter(country=="Rwanda")

## explore data_rwanda
data_rwanda


## plot gdp over time
figure(data = data_rwanda) %>% 
    ly_lines(x = year, y = gdp_millions, width = 2)


## explore the economics dataset
data(economics)
str(economics)

## pass vectors to x & y
figure() %>%
  ly_lines(x = economics$date, y = economics$pce)

## pass columns names and dataframe
figure() %>%
  ly_lines(x = date, y = pce, data = economics)


## plot unemployment rate  versus time and change the default `ylab`
figure(ylab = "unemployment %") %>%
  ly_lines(x=date, y=100*unemploy/pop, data=economics)


dat_1992 <- gapminder %>%
    filter(year==1992)
str(dat_1992)

## plot lifeExp Vs. gdpPercap using rbokeh
plot_1992<- figure(legend_location = "bottom_right") %>%
  ly_points(x=gdpPercap, y=lifeExp, color=continent, data=dat_1992) 

## show the plot            
plot_1992


data_countries <- gapminder %>%
    filter(country %in% c("United Kingdom", "Australia", "Canada", "United States", "New Zealand"))
str(data_countries)

figure(data = data_countries, legend="top_left") %>% 
  ly_lines(x = year, y = gdpPercap , color = country) %>% 
  ly_points(x=year, y=gdpPercap, color=country)


data_countries <- gapminder %>% 
    filter(country %in% c("China", "India"))

## create a line plot with lifeExp vs. year 
fig_countries <- figure(legend="top_left") %>% 
  ly_lines(x=year, y=lifeExp, color=country, data=data_countries)


## View fig_countries
fig_countries

## modify fig_countries by adding a points layer with gdpPercap vs. year 
fig_countries %>% 
  ly_points(x=year, y=lifeExp, color=country, data=data_countries)

Chapter 2 - rbokeh Aesthetic Attributes and Figure Options

Plot and Managed Attributes (Part I):

  • Can use aestehtic to modify areas like color, transparency, line type, shape, and the like
    • figure(legend_location = “bottom_right”, title = “Life Expectancy Vs. GDP per Capita in 1992” ) %>% ly_points(x = gdpPercap, y = lifeExp, data = dat_1992, color = continent)
  • Can use the Human Development Index (HDI) data from UNDP
    • hdi_countries <- hdi_data %>% filter(country %in% c(“Hungary”, “Bulgaria”, “Poland”))
    • fig_col <- figure(data = hdi_countries, legend_location = “bottom_right”) %>% ly_lines(x = year, y = human_development_index, color = country) %>% ly_points(x = year, y = human_development_index, color = country)
  • Can have varying color attributes by function - ly_points() has both fill_color() and line_color() which will both inherit from color
    • Can make the fill_color explicit and set its alpha (default is 0.5) explicitly also
    • fig_col <- figure(data = hdi_countries, legend_location = “bottom_right”) %>% ly_points(x = year, y = human_development_index, fill_color = country, fill_alpha = 1) %>% ly_lines(x = year, y = human_development_index, color = country)
  • Can add a custom color palette also
    • fig_col %>% set_palette(discrete_color = pal_color(c(“#3182bd”, “#31a354”, “#de2d26”)))

Plot and Managed Attributes (Part II):

  • Bechdel dataset - movie data on finances and exclusion of women
    • Bechdel criteria is a movie where two+ women have a discussion that is not about a male character
    • figure() %>% ly_points(x = budget_2013, y = intgross_2013, data = dat_90_13) # has an over-plotting problem and needs a log-transform
    • figure() %>% ly_points(x = log(budget_2013), y = log(intgross_2013), data = dat_90_13) # log transform helps with a lot (but not all) of the over-plotting
    • figure() %>% ly_points(x = log(budget_2013), y = log(intgross_2013), data = dat_90_13, alpha = 0.4, size = 5) # improves readability
  • May want to change the line widths for many countries
    • hdi_countries <- hdi_data %>% filter(country %in% c(“Rwanda”, “Kenya”, “Botswana”))
    • figure(title = “Human Development Index over Time”, legend = “bottom_right”) %>% ly_lines(x = year, y = human_development_index, data = hdi_countries, color = country)
    • Can use the width parameter to control the line width in ly_lines()
    • (WRONG FROM VIDEO) figure(title = “Human Development Index over Time”, legend = “bottom_right”) %>% ly_lines(x = year, y = human_development_index, data = hdi_countries, color = country, size = 3)
    • figure(title = “Human Development Index over Time”, legend = “bottom_right”) %>% ly_lines(x = year, y = human_development_index, data = hdi_countries, color = country, width = 3)

Hover Info and Figure Options:

  • Can combine the HDI and the CPI (corruption perception index)
    • The hover() argument added to the ly_points() can allow for hovering - see below
    • figure(legend_location = “bottom_right”, title = “CPI versus HDI - 2015”) %>% ly_points(x = corruption_perception_index, y = human_development_index, data = hdi_cpi_2015, color = continent, size = 7, hover = c(country, cpi_rank))
  • Can customize the hover commands using hover= where the @ means to place a variable from the frame at that point
    • figure(legend_location = “bottom_right”, title = “CPI versus HDI - 2015”) %>% ly_points(x = corruption_perception_index, y = human_development_index, data = hdi_cpi_2015, color = continent, size = 7, hover = “CPI Rank: @cpi_rank”)
    • Can also use basic html such as and

    • figure(legend_location = “bottom_right”, title = “CPI versus HDI - 2015”) %>% ly_points(x = corruption_perception_index, y = human_development_index, data = hdi_cpi_2015, color = continent, size = 7, hover = “@country
      CPI Rank: @cpi_rank”)
  • Can further add axis limits to the bokeh plots
    • hdi_cpi_scatter <- figure(legend_location = “bottom_right”, title = “CPI versus HDI - 2015”, ylim = c(0, 1), xlab = “CPI”, ylab = “HDI”, theme = bk_ggplot_theme()) %>% ly_points(x = corruption_perception_index_score, y = human_development_index, data = hdi_cpi_data, color = continent, size = 7)

Example code includes:

hdiRaw <- read.csv("./RInputFiles/Human Development Index (HDI).csv", skip=1)
str(hdiRaw)
hdi_data <- hdiRaw %>% 
    gather(key="year", value="human_development_index", -Country, -`HDI.Rank..2017.`) %>%
    mutate(country=str_trim(as.character(Country)), year=as.integer(str_sub(year, 2))) %>%
    filter(year %in% 1990:2105) %>%
    select(country, year, human_development_index)
str(hdi_data)

## extract "Namibia" and "Botswana" entries from hdi_data
hdi_countries <- hdi_data %>% 
    filter(country %in% c("Namibia", "Botswana"))
  
## plot human_development_index versus year
fig_col <- figure(data = hdi_countries, legend_location = "bottom_right") %>% 
    ly_lines(x = year, y = human_development_index, color = country) %>% 
    ly_points(x = year, y = human_development_index, 
              fill_color = "white", fill_alpha = 1,
              line_color = country, line_alpha = 1,
              size = 4
              )

## view plot 
fig_col


## use a custom palette with colors "green", "red"
fig_col %>% 
  set_palette(discrete_color = pal_color(c("green", "red")))

## define custom palette   
custom_pal <- pal_color(c("#c51b8a", "#31a354"))

## use custom_pal yp modify fig_col
fig_col %>% 
    set_palette(discrete_color=custom_pal)


## explore bechdel dataset using str
data(bechdel, package="fivethirtyeight")
str(bechdel)

## extract entries between 1980 - 2013
dat_80_13 <- bechdel %>% 
  filter(between(year, 1980, 2013))

dat_80_13 <- dat_80_13 %>% 
  mutate(roi_total = intgross_2013 / budget_2013) 
  
## plot
figure() %>% 
  ly_points(x=log(budget_2013), y=log(roi_total), data=dat_80_13)

## plot log(roi_total) versus log(budget_2013)
figure() %>% 
  ly_points(x=log(budget_2013), y=log(roi_total), size=5, line_alpha=0, fill_alpha=0.3, data=dat_80_13)


## filter the data by country = Syrian Arab Republic
hdi_countries <- hdi_data %>% 
  filter(country %in% c("Syrian Arab Republic", "Morocco"))

## change the color and line width
figure(title = "Human Development Index over Time", legend = "bottom_right") %>% 
    ly_lines(x=year, y=human_development_index, color=country, width=3, data=hdi_countries)


# explore hdi_cpi_data dataset
# str(hdi_cpi_2015)

## add multiple values as hover info (country, cpi_rank)
# figure(legend_location = "bottom_right") %>% 
#     ly_points(x=corruption_perception_index, y=human_development_index, color=continent, hover=c(country, cpi_rank), size=6, data=hdi_cpi_2015)


## modify the figure theme 
# figure(title = "Corruption Perception Index Vs. Human Development Index 2015",
#        legend_location = "bottom_right", xgrid = FALSE, ygrid = FALSE, 
#        xlab = "CPI", ylab = "HDI", theme=bk_ggplot_theme()) %>% 
#     ly_points(x = corruption_perception_index, y = human_development_index, 
#               data = hdi_cpi_2015, color = continent, size = 6, hover = c(country, cpi_rank)
#               )

Chapter 3 - Data Manipulation for Visualization and More rbokeh Layers

Data Formats:

  • The proper data format for plotting can make rbokeh much easier
  • Frequently need to transform data from long format to wide format for easier plotting - tidyr will help (inverse of the gather function)
    • hdi_cpi_wide <- hdi_cpi_long %>% spread(key = index, value = value)
  • May also want to transform data from wide format to long format, for example if time is a column
    • hdi_data_long <- hdi_data_wide %>% gather(key = year, value = human_development_index, - country) # year will become a new column, -country means leave country as its own column

More rbokeh Layers:

  • Can create a scatter plot with a regression line as an added layer
    • dat_90_13 <- bechdel %>% filter(between(year, 1990, 2013))
    • p_scatter <- figure() %>% ly_points(x = log(budget_2013), y = log(intgross_2013), data = dat_90_13, size = 5, alpha = 0.4)
    • lin_reg <- lm(log(intgross_2013) ~ log(budget_2013), data = dat_90_13)
    • summary(lin_reg)
    • p_scatter %>% ly_abline(lin_reg) # plots with the abline of the regression (the regression line) to the figure

Interaction Tools:

  • Can use the interaction tool to pan, zoom, reset, and the like
    • figure(tools=c(“pan”, “wheel_zoom”, “box_zoom”, “reset”, “save”, “help”), toolbar_location=“right”)
  • Tools can be any of “pan”, “wheel_zoom”, “box_zoom”, “resize”, “crosshair”, “box_select”, “lasso_select”, “reset”, “save”, “help”
    • Location can be any of ‘above’, ‘below’, ‘left’, ‘right’, NULL (remove the toolbar)
  • Example of customizing the available tools
    • figure(tools = c(“pan”, “wheel_zoom”, “box_zoom”), toolbar_location = “above”, legend_location = “bottom_right”, ylim = c(0, 100)) %>% ly_points(x = gdpPercap, y = lifeExp, data = gapminder_2002, color = continent, size = 6, alpha = 0.7)
  • Can create a plot and then use the widget2png tool to convert to PNG
    • plot_scatter <- figure(title = “Life Expectancy Vs. GDP per Capita in 2002”, legend_location = “bottom_right”) %>% ly_points(x = gdpPercap, y = lifeExp, data = gapminder_2002)
    • widget2png(p = plot_scatter, file = “plot_scatter.png”)
  • Can also save as html
    • rbokeh2html(fig = plot_scatter, file = “plot_scatter_interactive.html”)
    • browseURL(“plot_scatter_interactive.html”)

Example code includes:

ctry <- c('Afghanistan', 'Albania', 'Algeria', 'Angola', 'Argentina', 'Australia', 'Austria', 'Bahrain', 'Bangladesh', 'Belgium', 'Benin', 'Bosnia and Herzegovina', 'Botswana', 'Brazil', 'Bulgaria', 'Burkina Faso', 'Burundi', 'Cambodia', 'Cameroon', 'Canada', 'Central African Republic', 'Chad', 'Chile', 'China', 'Colombia', 'Comoros', 'Costa Rica', 'Croatia', 'Cuba', 'Czech Republic', 'Denmark', 'Djibouti', 'Dominican Republic', 'Ecuador', 'Egypt', 'El Salvador', 'Eritrea', 'Ethiopia', 'Finland', 'France', 'Gabon', 'Gambia', 'Germany', 'Ghana', 'Greece', 'Guatemala', 'Guinea', 'Guinea-Bissau', 'Haiti', 'Honduras', 'Hungary', 'Iceland', 'India', 'Indonesia', 'Iraq', 'Ireland', 'Israel', 'Italy', 'Jamaica', 'Japan', 'Jordan', 'Kenya', 'Kuwait', 'Lebanon', 'Lesotho', 'Liberia', 'Libya', 'Madagascar', 'Malawi', 'Malaysia', 'Mali', 'Mauritania', 'Mauritius', 'Mexico', 'Mongolia', 'Montenegro', 'Morocco', 'Mozambique', 'Myanmar', 'Namibia', 'Nepal', 'Netherlands', 'New Zealand', 'Nicaragua', 'Niger', 'Nigeria', 'Norway', 'Oman', 'Pakistan', 'Panama', 'Paraguay', 'Peru', 'Philippines', 'Poland', 'Portugal', 'Romania', 'Rwanda', 'Sao Tome and Principe', 'Saudi Arabia', 'Senegal', 'Serbia', 'Sierra Leone', 'Singapore', 'Slovenia', 'South Africa', 'Spain', 'Sri Lanka', 'Sudan', 'Sweden', 'Switzerland', 'Thailand', 'Togo', 'Trinidad and Tobago', 'Tunisia', 'Turkey', 'Uganda', 'United Kingdom', 'United States', 'Uruguay', 'Zambia', 'Zimbabwe', 'Afghanistan', 'Albania', 'Algeria', 'Angola', 'Argentina', 'Australia', 'Austria', 'Bahrain', 'Bangladesh', 'Belgium', 'Benin', 'Bosnia and Herzegovina', 'Botswana', 'Brazil', 'Bulgaria', 'Burkina Faso', 'Burundi', 'Cambodia', 'Cameroon', 'Canada', 'Central African Republic', 'Chad', 'Chile', 'China', 'Colombia', 'Comoros', 'Costa Rica', 'Croatia', 'Cuba', 'Czech Republic', 'Denmark', 'Djibouti', 'Dominican Republic', 'Ecuador', 'Egypt', 'El Salvador', 'Eritrea', 'Ethiopia', 'Finland', 'France', 'Gabon', 'Gambia', 'Germany', 'Ghana', 'Greece', 'Guatemala', 'Guinea', 'Guinea-Bissau', 'Haiti', 'Honduras', 'Hungary', 'Iceland', 'India', 'Indonesia', 'Iraq', 'Ireland', 'Israel', 'Italy', 'Jamaica', 'Japan', 'Jordan', 'Kenya', 'Kuwait', 'Lebanon', 'Lesotho', 'Liberia', 'Libya', 'Madagascar', 'Malawi', 'Malaysia', 'Mali', 'Mauritania', 'Mauritius', 'Mexico', 'Mongolia', 'Montenegro', 'Morocco', 'Mozambique', 'Myanmar', 'Namibia', 'Nepal', 'Netherlands', 'New Zealand', 'Nicaragua', 'Niger', 'Nigeria', 'Norway', 'Oman', 'Pakistan', 'Panama', 'Paraguay', 'Peru', 'Philippines', 'Poland', 'Portugal', 'Romania', 'Rwanda', 'Sao Tome and Principe', 'Saudi Arabia', 'Senegal', 'Serbia', 'Sierra Leone', 'Singapore', 'Slovenia', 'South Africa', 'Spain', 'Sri Lanka', 'Sudan', 'Sweden', 'Switzerland', 'Thailand', 'Togo', 'Trinidad and Tobago', 'Tunisia', 'Turkey', 'Uganda', 'United Kingdom', 'United States', 'Uruguay', 'Zambia', 'Zimbabwe')
ctryCode <- c('AFG', 'ALB', 'DZA', 'AGO', 'ARG', 'AUS', 'AUT', 'BHR', 'BGD', 'BEL', 'BEN', 'BIH', 'BWA', 'BRA', 'BGR', 'BFA', 'BDI', 'KHM', 'CMR', 'CAN', 'CAF', 'TCD', 'CHL', 'CHN', 'COL', 'COM', 'CRI', 'HRV', 'CUB', 'CZE', 'DNK', 'DJI', 'DOM', 'ECU', 'EGY', 'SLV', 'ERI', 'ETH', 'FIN', 'FRA', 'GAB', 'GMB', 'DEU', 'GHA', 'GRC', 'GTM', 'GIN', 'GNB', 'HTI', 'HND', 'HUN', 'ISL', 'IND', 'IDN', 'IRQ', 'IRL', 'ISR', 'ITA', 'JAM', 'JPN', 'JOR', 'KEN', 'KWT', 'LBN', 'LSO', 'LBR', 'LBY', 'MDG', 'MWI', 'MYS', 'MLI', 'MRT', 'MUS', 'MEX', 'MNG', 'MON', 'MAR', 'MOZ', 'MMR', 'NAM', 'NPL', 'NLD', 'NZL', 'NIC', 'NER', 'NGA', 'NOR', 'OMN', 'PAK', 'PAN', 'PRY', 'PER', 'PHL', 'POL', 'PRT', 'ROM', 'RWA', 'STP', 'SAU', 'SEN', 'SCG', 'SLE', 'SGP', 'SVN', 'ZAF', 'ESP', 'LKA', 'SDN', 'SWE', 'CHE', 'THA', 'TGO', 'TTO', 'TUN', 'TUR', 'UGA', 'GBR', 'USA', 'URY', 'ZMB', 'ZWE', 'AFG', 'ALB', 'DZA', 'AGO', 'ARG', 'AUS', 'AUT', 'BHR', 'BGD', 'BEL', 'BEN', 'BIH', 'BWA', 'BRA', 'BGR', 'BFA', 'BDI', 'KHM', 'CMR', 'CAN', 'CAF', 'TCD', 'CHL', 'CHN', 'COL', 'COM', 'CRI', 'HRV', 'CUB', 'CZE', 'DNK', 'DJI', 'DOM', 'ECU', 'EGY', 'SLV', 'ERI', 'ETH', 'FIN', 'FRA', 'GAB', 'GMB', 'DEU', 'GHA', 'GRC', 'GTM', 'GIN', 'GNB', 'HTI', 'HND', 'HUN', 'ISL', 'IND', 'IDN', 'IRQ', 'IRL', 'ISR', 'ITA', 'JAM', 'JPN', 'JOR', 'KEN', 'KWT', 'LBN', 'LSO', 'LBR', 'LBY', 'MDG', 'MWI', 'MYS', 'MLI', 'MRT', 'MUS', 'MEX', 'MNG', 'MON', 'MAR', 'MOZ', 'MMR', 'NAM', 'NPL', 'NLD', 'NZL', 'NIC', 'NER', 'NGA', 'NOR', 'OMN', 'PAK', 'PAN', 'PRY', 'PER', 'PHL', 'POL', 'PRT', 'ROM', 'RWA', 'STP', 'SAU', 'SEN', 'SCG', 'SLE', 'SGP', 'SVN', 'ZAF', 'ESP', 'LKA', 'SDN', 'SWE', 'CHE', 'THA', 'TGO', 'TTO', 'TUN', 'TUR', 'UGA', 'GBR', 'USA', 'URY', 'ZMB', 'ZWE')
regn <- c('AP', 'ECA', 'MENA', 'SSA', 'AME', 'AP', 'WE/EU', 'MENA', 'AP', 'WE/EU', 'SSA', 'ECA', 'SSA', 'AME', 'WE/EU', 'SSA', 'SSA', 'AP', 'SSA', 'AME', 'SSA', 'SSA', 'AME', 'AP', 'AME', 'SSA', 'AME', 'WE/EU', 'AME', 'WE/EU', 'WE/EU', 'SSA', 'AME', 'AME', 'MENA', 'AME', 'SSA', 'SSA', 'WE/EU', 'WE/EU', 'SSA', 'SSA', 'WE/EU', 'SSA', 'WE/EU', 'AME', 'SSA', 'SSA', 'AME', 'AME', 'WE/EU', 'WE/EU', 'AP', 'AP', 'MENA', 'WE/EU', 'MENA', 'WE/EU', 'AME', 'AP', 'MENA', 'SSA', 'MENA', 'MENA', 'SSA', 'SSA', 'MENA', 'SSA', 'SSA', 'AP', 'SSA', 'SSA', 'SSA', 'AME', 'AP', 'ECA', 'MENA', 'SSA', 'AP', 'SSA', 'AP', 'WE/EU', 'AP', 'AME', 'SSA', 'SSA', 'WE/EU', 'MENA', 'AP', 'AME', 'AME', 'AME', 'AP', 'WE/EU', 'WE/EU', 'WE/EU', 'SSA', 'SSA', 'MENA', 'SSA', 'ECA', 'SSA', 'AP', 'WE/EU', 'SSA', 'WE/EU', 'AP', 'MENA', 'WE/EU', 'WE/EU', 'AP', 'SSA', 'AME', 'MENA', 'ECA', 'SSA', 'WE/EU', 'AME', 'AME', 'SSA', 'SSA', 'AP', 'ECA', 'MENA', 'SSA', 'AME', 'AP', 'WE/EU', 'MENA', 'AP', 'WE/EU', 'SSA', 'ECA', 'SSA', 'AME', 'WE/EU', 'SSA', 'SSA', 'AP', 'SSA', 'AME', 'SSA', 'SSA', 'AME', 'AP', 'AME', 'SSA', 'AME', 'WE/EU', 'AME', 'WE/EU', 'WE/EU', 'SSA', 'AME', 'AME', 'MENA', 'AME', 'SSA', 'SSA', 'WE/EU', 'WE/EU', 'SSA', 'SSA', 'WE/EU', 'SSA', 'WE/EU', 'AME', 'SSA', 'SSA', 'AME', 'AME', 'WE/EU', 'WE/EU', 'AP', 'AP', 'MENA', 'WE/EU', 'MENA', 'WE/EU', 'AME', 'AP', 'MENA', 'SSA', 'MENA', 'MENA', 'SSA', 'SSA', 'MENA', 'SSA', 'SSA', 'AP', 'SSA', 'SSA', 'SSA', 'AME', 'AP', 'ECA', 'MENA', 'SSA', 'AP', 'SSA', 'AP', 'WE/EU', 'AP', 'AME', 'SSA', 'SSA', 'WE/EU', 'MENA', 'AP', 'AME', 'AME', 'AME', 'AP', 'WE/EU', 'WE/EU', 'WE/EU', 'SSA', 'SSA', 'MENA', 'SSA', 'ECA', 'SSA', 'AP', 'WE/EU', 'SSA', 'WE/EU', 'AP', 'MENA', 'WE/EU', 'WE/EU', 'AP', 'SSA', 'AME', 'MENA', 'ECA', 'SSA', 'WE/EU', 'AME', 'AME', 'SSA', 'SSA')
cnt <- c('Asia', 'Europe', 'Africa', 'Africa', 'Americas', 'Oceania', 'Europe', 'Asia', 'Asia', 'Europe', 'Africa', 'Europe', 'Africa', 'Americas', 'Europe', 'Africa', 'Africa', 'Asia', 'Africa', 'Americas', 'Africa', 'Africa', 'Americas', 'Asia', 'Americas', 'Africa', 'Americas', 'Europe', 'Americas', 'Europe', 'Europe', 'Africa', 'Americas', 'Americas', 'Africa', 'Americas', 'Africa', 'Africa', 'Europe', 'Europe', 'Africa', 'Africa', 'Europe', 'Africa', 'Europe', 'Americas', 'Africa', 'Africa', 'Americas', 'Americas', 'Europe', 'Europe', 'Asia', 'Asia', 'Asia', 'Europe', 'Asia', 'Europe', 'Americas', 'Asia', 'Asia', 'Africa', 'Asia', 'Asia', 'Africa', 'Africa', 'Africa', 'Africa', 'Africa', 'Asia', 'Africa', 'Africa', 'Africa', 'Americas', 'Asia', 'Europe', 'Africa', 'Africa', 'Asia', 'Africa', 'Asia', 'Europe', 'Oceania', 'Americas', 'Africa', 'Africa', 'Europe', 'Asia', 'Asia', 'Americas', 'Americas', 'Americas', 'Asia', 'Europe', 'Europe', 'Europe', 'Africa', 'Africa', 'Asia', 'Africa', 'Europe', 'Africa', 'Asia', 'Europe', 'Africa', 'Europe', 'Asia', 'Africa', 'Europe', 'Europe', 'Asia', 'Africa', 'Americas', 'Africa', 'Europe', 'Africa', 'Europe', 'Americas', 'Americas', 'Africa', 'Africa', 'Asia', 'Europe', 'Africa', 'Africa', 'Americas', 'Oceania', 'Europe', 'Asia', 'Asia', 'Europe', 'Africa', 'Europe', 'Africa', 'Americas', 'Europe', 'Africa', 'Africa', 'Asia', 'Africa', 'Americas', 'Africa', 'Africa', 'Americas', 'Asia', 'Americas', 'Africa', 'Americas', 'Europe', 'Americas', 'Europe', 'Europe', 'Africa', 'Americas', 'Americas', 'Africa', 'Americas', 'Africa', 'Africa', 'Europe', 'Europe', 'Africa', 'Africa', 'Europe', 'Africa', 'Europe', 'Americas', 'Africa', 'Africa', 'Americas', 'Americas', 'Europe', 'Europe', 'Asia', 'Asia', 'Asia', 'Europe', 'Asia', 'Europe', 'Americas', 'Asia', 'Asia', 'Africa', 'Asia', 'Asia', 'Africa', 'Africa', 'Africa', 'Africa', 'Africa', 'Asia', 'Africa', 'Africa', 'Africa', 'Americas', 'Asia', 'Europe', 'Africa', 'Africa', 'Asia', 'Africa', 'Asia', 'Europe', 'Oceania', 'Americas', 'Africa', 'Africa', 'Europe', 'Asia', 'Asia', 'Americas', 'Americas', 'Americas', 'Asia', 'Europe', 'Europe', 'Europe', 'Africa', 'Africa', 'Asia', 'Africa', 'Europe', 'Africa', 'Asia', 'Europe', 'Africa', 'Europe', 'Asia', 'Africa', 'Europe', 'Europe', 'Asia', 'Africa', 'Americas', 'Africa', 'Europe', 'Africa', 'Europe', 'Americas', 'Americas', 'Africa', 'Africa')
idx <- rep(c("corruption_perception_index", "human_development_index"), each=121)
cpiRk <- c(166, 88, 88, 163, 106, 13, 16, 50, 139, 15, 83, 76, 29, 76, 69, 76, 150, 150, 130, 10, 145, 147, 23, 83, 83, 136, 40, 50, 56, 38, 1, 98, 102, 106, 88, 72, 154, 102, 3, 23, 98, 123, 11, 56, 58, 123, 139, 158, 158, 111, 50, 13, 76, 88, 161, 18, 32, 61, 69, 18, 45, 139, 55, 123, 61, 83, 161, 123, 111, 54, 95, 111, 45, 111, 72, 61, 88, 111, 147, 45, 130, 9, 1, 130, 98, 136, 5, 60, 117, 72, 130, 88, 95, 29, 28, 58, 43, 66, 48, 61, 71, 119, 7, 34, 61, 37, 83, 165, 4, 6, 76, 106, 72, 76, 66, 139, 11, 16, 21, 76, 150, 166, 88, 88, 163, 106, 13, 16, 50, 139, 15, 83, 76, 29, 76, 69, 76, 150, 150, 130, 10, 145, 147, 23, 83, 83, 136, 40, 50, 56, 38, 1, 98, 102, 106, 88, 72, 154, 102, 3, 23, 98, 123, 11, 56, 58, 123, 139, 158, 158, 111, 50, 13, 76, 88, 161, 18, 32, 61, 69, 18, 45, 139, 55, 123, 61, 83, 161, 123, 111, 54, 95, 111, 45, 111, 72, 61, 88, 111, 147, 45, 130, 9, 1, 130, 98, 136, 5, 60, 117, 72, 130, 88, 95, 29, 28, 58, 43, 66, 48, 61, 71, 119, 7, 34, 61, 37, 83, 165, 4, 6, 76, 106, 72, 76, 66, 139, 11, 16, 21, 76, 150)
vl <- c(0.479, 0.764, 0.745, 0.533, 0.827, 0.939, 0.893, 0.824, 0.579, 0.896, 0.485, 0.75, 0.698, 0.754, 0.794, 0.402, 0.404, 0.563, 0.518, 0.92, 0.352, 0.396, 0.847, 0.738, 0.727, 0.498, 0.776, 0.827, 0.775, 0.878, 0.925, 0.473, 0.722, 0.739, 0.691, 0.68, 0.42, 0.448, 0.895, 0.897, 0.697, 0.452, 0.926, 0.579, 0.866, 0.64, 0.414, 0.424, 0.493, 0.625, 0.836, 0.921, 0.624, 0.689, 0.649, 0.923, 0.899, 0.887, 0.73, 0.903, 0.742, 0.555, 0.8, 0.763, 0.497, 0.427, 0.716, 0.512, 0.476, 0.789, 0.442, 0.513, 0.781, 0.762, 0.735, 0.807, 0.647, 0.418, 0.556, 0.64, 0.558, 0.924, 0.915, 0.645, 0.353, 0.527, 0.949, 0.796, 0.55, 0.788, 0.693, 0.74, 0.682, 0.855, 0.843, 0.802, 0.498, 0.574, 0.847, 0.494, 0.776, 0.42, 0.925, 0.89, 0.666, 0.884, 0.766, 0.49, 0.913, 0.939, 0.74, 0.487, 0.78, 0.725, 0.767, 0.493, 0.91, 0.92, 0.795, 0.579, 0.516, 11, 36, 36, 15, 32, 79, 76, 51, 25, 77, 37, 38, 63, 38, 41, 38, 21, 21, 27, 83, 24, 22, 70, 37, 37, 26, 55, 51, 47, 56, 91, 34, 33, 32, 36, 39, 18, 33, 90, 70, 34, 28, 81, 47, 46, 28, 25, 17, 17, 31, 51, 79, 38, 36, 16, 75, 61, 44, 41, 75, 53, 25, 49, 28, 44, 37, 16, 28, 31, 50, 35, 31, 53, 31, 39, 44, 36, 31, 22, 53, 27, 84, 91, 27, 34, 26, 88, 45, 30, 39, 27, 36, 35, 63, 64, 46, 54, 42, 52, 44, 40, 29, 85, 60, 44, 58, 37, 12, 89, 86, 38, 32, 39, 38, 42, 25, 81, 76, 74, 38, 21)

hdi_cpi_data_long <- data.frame(country=ctry, year=2015L, country_code=ctryCode, cpi_rank=cpiRk, 
                                region=regn, continent=cnt, index=idx, value=vl,
                                stringsAsFactors = FALSE
                                )

## explore hdi_cpi_data_long
str(hdi_cpi_data_long)

## How many unique values are there in the index column?
unique(hdi_cpi_data_long$index)


## convert from long to wide
hdi_cpi_data_wide <- hdi_cpi_data_long %>% 
  spread(key=index, value=value)
  
## display the first 5 rows from hdi_cpi_data_wide
head(hdi_cpi_data_wide, 5)


## plot corruption_perception_index  versus human_development_index
figure(legend_location = "top_left") %>% 
    ly_points(x=human_development_index, y=corruption_perception_index, color=continent, alpha=0.7,
              hover=c(country, cpi_rank,corruption_perception_index, human_development_index), 
              data=hdi_cpi_data_wide
              )


## convert from wide to long
hdi_cpi_remake_long <- hdi_cpi_data_wide %>%
    gather(key="index", value="value", corruption_perception_index, human_development_index)
  
## display the first 5 rows of hdi_data_long
head(hdi_cpi_remake_long, 5)
all.equal(hdi_cpi_data_long, hdi_cpi_remake_long)


## explore the unique values in the movie_budget column
# unique(dat_90_13_long$movie_budget)

## spread the values in the `movie_budget` in two columns
# dat_90_13_wide <- dat_90_13_long %>% 
#   spread(key=movie_budget, value=value)
  
## View column names of dat_90_13_wide
# names(dat_90_13_wide)

## create a scatter plot with log(budget_2013) Vs log(intgross_2013) 
# p_scatter <- figure() %>%
#   ly_points(y=log(intgross_2013), x=log(budget_2013), size=4, alpha=0.5, data=dat_90_13_wide)
  
## View plot
# p_scatter

## fit a linear reg model
# lin_reg <- lm(log(intgross_2013) ~ log(budget_2013), data = dat_90_13)

## add the linear regression line layer to p_scatter
# p_scatter %>% 
#   ly_abline(lin_reg)


## extract entries for year 2007
dat_2007 <- gapminder %>% 
  filter(year == 2007)
dat_2002 <- gapminder %>% 
  filter(year == 2002)

## create scatter plot
figure(toolbar_location="above", legend_location="bottom_right") %>%
    ly_points(x=gdpPercap, y=lifeExp, color=continent, size=6, alpha=0.7, 
              data=dat_2007, hover=c(country, lifeExp, gdpPercap)
              )

figure(legend_location = "bottom_right", tools=c("resize", "save")) %>% 
    ly_points(x = gdpPercap, y = lifeExp, data = dat_2002, color = continent)

figure(legend_location = "bottom_right", tools=c("resize", "save"), toolbar_location=NULL) %>% 
    ly_points(x = gdpPercap, y = lifeExp, data = dat_2002, color = continent)

Chapter 4 - Grid Plots and Maps

Intro to Grid Plots:

  • Example of dataset for TB by year by age group in the US - combine multiple figures in the same area
    • figure() %>% ly_bar(x = year, y = count, data = tb_2534, color = gender, position = “stack”) # x should be a factor, default is stacked bars if position is missing (dodge or fill also available)
  • Can use the grid plot basics for multi-plotting
    • fig_list <- list(bar_2534 = bar_2534, bar_3544 = bar_3544)
    • grid_plot(fig_list, width = 1000, height = 500) # will have different axis limits by default
    • grid_plot(fig_list, width = 1000, height = 500, same_axes = TRUE) # forces the axes to be on the same scale
    • grid_plot(fig_list, width = 900, height = 600, nrow = 2, same_axes = TRUE) %>% theme_axis(“x”, major_label_orientation = 90) # overrides the defaults of all in one row
    • fig_list <- list(list(bar_1524 = bar_1524, bar_2534 = bar_2534), list(bar_3544 = bar_3544))
    • grid_plot(fig_list, same_axes = TRUE) %>% theme_axis(“x”, major_label_orientation = 90) # list of plots plots one list per row, and NULL will place an empty plot in that column

Facets with Grid Plots:

  • Facets can be helpful for slicing data, placing small batches of the data (segmented by factor) in a larger plot
  • Can start by creating a plot for each of the groups, though this is inefficient
    • fig_list <- list(bar_1524 = bar_1524, bar_2534 = bar_2534, bar_3544 = bar_3544, bar_4554 = bar_4554, bar_5564 = bar_5564, bar_65 = bar_65)
    • grid_plot(fig_list, width = 900, height = 600, nrow = 2, same_axes = TRUE) %>% theme_axis(“x”, major_label_orientation = 90)
  • Can instead use the split() function and a function for plotting to create the relevant lists
    • tb_split_age <- split(tb, tb$age)
    • plot_bar <- function(x){ figure() %>% ly_bar(y = count, year, data = x, color = gender, position = “dodge”)}
  • Can instead use the lapply() functionality
    • fig_list <- lapply(tb_split_age, plot_bar)
    • grid_plot(fig_list, width = 900, height = 600, nrow = 2, same_axes = TRUE) %>% theme_axis(“x”, major_label_orientation = 90)

rbokeh maps:

  • Can create interactive maps using rbokeh - transportation, density, population, and other areas where geography is key to understanding
  • NYC bike data available from the bikedata package
  • Can begin by initializing a map (appears to source Google Maps)
    • ny_map <- gmap(lat = 40.73306, lng = -73.97351, zoom = 11)
  • Can use the map type argument to change the type of map - hybrid, satellite, road, terrain
  • Can also customize maps using gamp_style(), such as making the water blue
    • ny_map <- gmap(lat = 40.73306, lng = -73.97351, zoom = 11, map_style = gmap_style(“blue_water”))
  • Can then add points layers to the map and arrange in grids using grid_plot() as per previous chapters
    • ny_map %>% ly_points(x = station_longitude, y = station_latitude, data = ny_bikedata_20170427, fill_color = start_count, line_alpha = 0, size = 8, hover = c(station_name, start_count))
    • grid_plot(list(weekeend_April23 = map_weekend_20170423, weekday_April25 = map_weekday_20170425), width = 860, height = 420)

Example code includes:

tb <- data.frame(iso2="US", 
                 gender=rep(c("m", "f"), each=84),
                 year=factor(c(1995, 1996, 1997, 1998, 1999, 2000, 2001, 2002, 2003, 2004, 2005, 2006, 2007, 2008, 1995, 1996, 1997, 1998, 1999, 2000, 2001, 2002, 2003, 2004, 2005, 2006, 2007, 2008, 1995, 1996, 1997, 1998, 1999, 2000, 2001, 2002, 2003, 2004, 2005, 2006, 2007, 2008, 1995, 1996, 1997, 1998, 1999, 2000, 2001, 2002, 2003, 2004, 2005, 2006, 2007, 2008, 1995, 1996, 1997, 1998, 1999, 2000, 2001, 2002, 2003, 2004, 2005, 2006, 2007, 2008, 1995, 1996, 1997, 1998, 1999, 2000, 2001, 2002, 2003, 2004, 2005, 2006, 2007, 2008, 1995, 1996, 1997, 1998, 1999, 2000, 2001, 2002, 2003, 2004, 2005, 2006, 2007, 2008, 1995, 1996, 1997, 1998, 1999, 2000, 2001, 2002, 2003, 2004, 2005, 2006, 2007, 2008, 1995, 1996, 1997, 1998, 1999, 2000, 2001, 2002, 2003, 2004, 2005, 2006, 2007, 2008, 1995, 1996, 1997, 1998, 1999, 2000, 2001, 2002, 2003, 2004, 2005, 2006, 2007, 2008, 1995, 1996, 1997, 1998, 1999, 2000, 2001, 2002, 2003, 2004, 2005, 2006, 2007, 2008, 1995, 1996, 1997, 1998, 1999, 2000, 2001, 2002, 2003, 2004, 2005, 2006, 2007, 2008)), 
                 age=c(1524, 1524, 1524, 1524, 1524, 1524, 1524, 1524, 1524, 1524, 1524, 1524, 1524, 1524, 2534, 2534, 2534, 2534, 2534, 2534, 2534, 2534, 2534, 2534, 2534, 2534, 2534, 2534, 3544, 3544, 3544, 3544, 3544, 3544, 3544, 3544, 3544, 3544, 3544, 3544, 3544, 3544, 4554, 4554, 4554, 4554, 4554, 4554, 4554, 4554, 4554, 4554, 4554, 4554, 4554, 4554, 5564, 5564, 5564, 5564, 5564, 5564, 5564, 5564, 5564, 5564, 5564, 5564, 5564, 5564, 65, 65, 65, 65, 65, 65, 65, 65, 65, 65, 65, 65, 65, 65, 1524, 1524, 1524, 1524, 1524, 1524, 1524, 1524, 1524, 1524, 1524, 1524, 1524, 1524, 2534, 2534, 2534, 2534, 2534, 2534, 2534, 2534, 2534, 2534, 2534, 2534, 2534, 2534, 3544, 3544, 3544, 3544, 3544, 3544, 3544, 3544, 3544, 3544, 3544, 3544, 3544, 3544, 4554, 4554, 4554, 4554, 4554, 4554, 4554, 4554, 4554, 4554, 4554, 4554, 4554, 4554, 5564, 5564, 5564, 5564, 5564, 5564, 5564, 5564, 5564, 5564, 5564, 5564, 5564, 5564, 65, 65, 65, 65, 65, 65, 65, 65, 65, 65, 65, 65, 65, 65), 
                 count=c(355, 333, 330, 321, 331, 365, 320, 343, 365, 362, 383, 388, 414, 375, 876, 815, 701, 663, 616, 602, 613, 562, 526, 547, 535, 568, 490, 513, 1417, 1219, 1127, 1009, 1011, 906, 824, 813, 754, 728, 666, 659, 572, 495, 1121, 1073, 979, 1007, 930, 904, 876, 795, 828, 829, 767, 759, 744, 725, 742, 678, 679, 628, 601, 577, 524, 490, 487, 504, 499, 531, 533, 526, 1099, 1007, 944, 914, 801, 738, 649, 592, 650, 582, 624, 596, 562, 561, 280, 289, 269, 269, 232, 246, 239, 233, 277, 265, 241, 257, 257, 220, 579, 487, 449, 425, 391, 376, 410, 423, 353, 339, 348, 384, 338, 329, 499, 478, 447, 424, 394, 349, 346, 362, 310, 302, 276, 263, 260, 269, 285, 279, 254, 267, 245, 253, 247, 255, 269, 252, 242, 212, 225, 224, 202, 217, 201, 179, 244, 152, 176, 167, 169, 166, 161, 146, 135, 172, 591, 541, 514, 492, 444, 396, 389, 370, 354, 344, 322, 303, 308, 300), 
                 stringsAsFactors = FALSE
                 )
str(tb)
tb_2534 <- tb %>% filter(age==2534)
str(tb_2534)


## create a bar plot for age group tb_2534
bar_2534 <- figure() %>%
  ly_bar(x=year, y=count, color=gender, data=tb_2534, hover=TRUE)

## View figure
bar_2534


## create a bar plot for age group tb_2534 with % on the y-axis
bar_2534_percent <- figure(ylab = "share") %>% 
  ly_bar(x = year, y =  count,  tb_2534, color = gender, hover = TRUE,  position = "fill")
         
## View figure
bar_2534_percent


## create a list with bar_2534 and bar_2534_percent figures
fig_list <- list(bar_2534 = bar_2534, bar_2534_percent = bar_2534_percent)

## create a grid plot 
grid_plot(fig_list, width=1000, height=400)

## create a grid plot with same axes limits
grid_plot(figs = fig_list, width = 1000, height = 400, same_axes=TRUE)


plot_line <- function(x){
    figure() %>% 
        ly_lines(y =  count, year, data = x, color = age,  alpha = 1, width = 2)
}

## create two dataframes for female/male data           
tb_female <- tb %>% filter(gender=="f")
tb_male <- tb %>% filter(gender=="m")


## create two plots using plot_line
fig_female <- plot_line(tb_female)
fig_male <- plot_line(tb_male)

## create figure list
fig_list <- list(female = fig_female, male = fig_male)

## plot the two figures in a grid
grid_plot(fig_list, width=1000, height=600, same_axes=TRUE)


## split tb data by gender 
tb_split_gender <- split(tb, tb$gender)

## create a list of figures using lapply
fig_list <- lapply(tb_split_gender, FUN=plot_line)

## create a grid plot 
grid_plot(fig_list, width=1000, height=600, same_axes=TRUE)


## define a function to create a bar plot with the number of tb cases over time
plot_bar <- function(x){ 
    figure() %>% 
        ly_bar(y=count, x=year, data=x, color = gender, position = "dodge", hover=TRUE)
}

## split tb data by age
tb_split_age <- split(tb, tb$age)

## apply the function to the groups in tb_split_age
fig_list <- fig_list <- lapply(tb_split_age, plot_bar)

## create a grid plot 
grid_plot(fig_list, width=600, height=900, nrow=3, same_axes=TRUE) %>% 
    theme_axis("x", major_label_orientation = 90)


## initialize a map for NY center
# ny_map <- gmap(lat=40.73306, lng=-73.97351, zoom=11, map_style=gmap_style("blue_water"))
# ny_map


## filter ny_bikedata to get the entries for day "2017-04-25"
# ny_bikedata_20170425 <- ny_bikedata %>% filter(trip_date==as.Date("2017-04-25"))

## add a points layer to ny_map
# ny_map %>%
#     ly_points(y=station_latitude, x=station_longitude, 
#               size=8, fill_color=start_count, line_alpha=0, 
#               data=ny_bikedata_20170425, hover=c(station_name, start_count, end_count)
#               )

## create a names list with the two figures
# fig_list <- list(map_weekend=map_weekend_20170423, map_weekday=map_weekday_20170425)

## create a grid plot with the 2 maps
# grid_plot(fig_list, width=860, height=420)

A/B Testing in R

Chapter 1 - Mini Case Study in A/B Testing

Introduction:

  • A/B testing is a powerful way to experiment with potential changes before implementing them
    • Framework for testing new ideas to improve an existing design (often a website)
  • Hypothetical example - cat adoption website - could a change in home page improve conversion rate (clicks divided by views)?
    • Question - does changing the photo improve conversion rate?
    • Hypothesis - cat in hat will improve conversion rate
    • Dependent variable - clicks
    • Independent variable - homepage photo
  • Need to begin by assessing conversion rates in the current website
    • click_data <- read_csv(“click_data.csv”)

Baseline conversion rates:

  • Contnuning the previous example - hypothesis of cats in hats having “more” conversions
    • Need to define “more” relative to some baseline - recent past, control group at same time, etc.
    • click_data %>% summarize(conversion_rate = mean(clicked_adopt_today)) # mean from historical data
    • click_data_sum <- click_data %>% group_by(lubridate::month(visit_date)) %>% summarize(conversion_rate = mean(clicked_adopt_today)) # mean by month from the historical data
    • ggplot(click_data_sum, aes(x = month(visit_date), y=conversion_rate)) + geom_point() + geom_line()

Experimental design and power analysis:

  • Power analysis helps determine how many samples are needed (thus how long the experiment needs to run)
    • Ideal is to run both conditions simultaneously - mitigate seasonality and other potential confounders
    • Should know the planned test, baseline (control) value, and desired (test) value, as well as proportion of the data (typically 0.5), significance/alpha (typically 0.05), and power (typically 0.8)
  • Can use the powerMediation package to assess the power - note the function returns the total sample size, so each group is divided by 2
    • library(powerMediation)
    • total_sample_size <- SSizeLogisticBin(p1 = 0.2, p2 = 0.3, B = 0.5, alpha = 0.05, power = 0.8) # note the function returns the total sample size, so each group is divided by 2

Example code includes:

# Read in data
click_data <- readr::read_csv("./RInputFiles/click_data.csv")
## Parsed with column specification:
## cols(
##   visit_date = col_date(format = ""),
##   clicked_adopt_today = col_integer()
## )
click_data
## # A tibble: 3,650 x 2
##    visit_date clicked_adopt_today
##    <date>                   <int>
##  1 2017-01-01                   1
##  2 2017-01-02                   1
##  3 2017-01-03                   0
##  4 2017-01-04                   1
##  5 2017-01-05                   1
##  6 2017-01-06                   0
##  7 2017-01-07                   0
##  8 2017-01-08                   0
##  9 2017-01-09                   0
## 10 2017-01-10                   0
## # ... with 3,640 more rows
# Find oldest and most recent date
min(click_data$visit_date)
## [1] "2017-01-01"
max(click_data$visit_date)
## [1] "2017-12-31"
# Calculate the mean conversion rate by day of the week
click_data %>%
  group_by(weekdays(visit_date)) %>%
  summarize(conversion_rate = mean(clicked_adopt_today))
## # A tibble: 7 x 2
##   `weekdays(visit_date)` conversion_rate
##   <chr>                            <dbl>
## 1 Friday                           0.267
## 2 Monday                           0.277
## 3 Saturday                         0.256
## 4 Sunday                           0.3  
## 5 Thursday                         0.271
## 6 Tuesday                          0.271
## 7 Wednesday                        0.298
# Calculate the mean conversion rate by week of the year
click_data %>%
  group_by(lubridate::week(visit_date)) %>%
  summarize(conversion_rate = mean(clicked_adopt_today))
## # A tibble: 53 x 2
##    `lubridate::week(visit_date)` conversion_rate
##                            <dbl>           <dbl>
##  1                             1           0.229
##  2                             2           0.243
##  3                             3           0.171
##  4                             4           0.129
##  5                             5           0.157
##  6                             6           0.186
##  7                             7           0.257
##  8                             8           0.171
##  9                             9           0.186
## 10                            10           0.2  
## # ... with 43 more rows
# Compute conversion rate by week of the year
click_data_sum <- click_data %>%
    mutate(weekOfYear = lubridate::week(visit_date)) %>%
    group_by(weekOfYear) %>%
    summarize(conversion_rate = mean(clicked_adopt_today))

# Build plot
ggplot(click_data_sum, aes(x = `weekOfYear`, y = conversion_rate)) +
    geom_point() +
    geom_line() +
    scale_y_continuous(limits = c(0, 1), labels = scales::percent)

# Compute and look at sample size for experiment in August
total_sample_size <- powerMediation::SSizeLogisticBin(p1 = 0.54, p2 = 0.64, 
                                                      B = 0.5, alpha = 0.05, power = 0.8
                                                      )
total_sample_size
## [1] 758
# Compute and look at sample size for experiment in August with 5% increase
total_sample_size <- powerMediation::SSizeLogisticBin(p1 = 0.54, p2 = 0.59, 
                                                      B = 0.5, alpha = 0.05, power = 0.8
                                                      )
total_sample_size
## [1] 3085

Chapter 2 - Mini Case Study in A/B Testing - Part II

Analyzing Results:

  • Can analyze the experiment data from the previous design - available in a new dataset
    • experiment_data <- read_csv(“experiment_data.csv”)
    • experiment_data %>% group_by(condition) %>% summarize(conversion_rate = mean(clicked_adopt_today))
    • experiment_data_sum <- experiment_data %>% group_by(visit_date, condition) %>% summarize(conversion_rate = mean(clicked_adopt_today))
    • ggplot(experiment_data_sum, aes(x = visit_date, y = conversion_rate, color = condition, group = condition)) + geom_point() + geom_line()
  • Can further assess the statistical significance of the outcomes
    • glm(clicked_adopt_today ~ condition, family = “binomial”, data = experiment_data) %>% broom::tidy()

Designing follow-up experiments:

  • Can continue to refine and test new hypotheses, but typically still with one step at a time
    • Experiments need to be unique, and each with their own control group
    • Attempt to avoid confounding variables; hard to explain real-world outcomes if there were many changes at the same time

Pre-follow-up-experiment assumptions:

  • Control conditions for seasonal products can be especially challenging - careful not to choose times that already have very extreme conversion rates

Follow-up experiment assumptions:

  • May want to look at the differences in conversion rate by month
    • eight_month_checkin_data_sum <- eight_month_checkin_data %>%
    • mutate(month_text = month(visit_date, label = TRUE)) %>% group_by(month_text, condition) %>%
    • summarize(conversion_rate = mean(clicked_adopt_today))
    • eight_month_checkin_data_diff <- eight_month_checkin_data_sum %>%
    • spread(condition, conversion_rate) %>%
    • mutate(condition_diff = cat_hat - no_hat)
    • mean(eight_month_checkin_data_diff$condition_diff)
    • sd(eight_month_checkin_data_diff$condition_diff)

Example code includes:

experiment_data <- read_csv("./RInputFiles/experiment_data.csv")
## Parsed with column specification:
## cols(
##   visit_date = col_date(format = ""),
##   condition = col_character(),
##   clicked_adopt_today = col_integer()
## )
experiment_data
## # A tibble: 588 x 3
##    visit_date condition clicked_adopt_today
##    <date>     <chr>                   <int>
##  1 2018-01-01 control                     0
##  2 2018-01-01 control                     1
##  3 2018-01-01 control                     0
##  4 2018-01-01 control                     0
##  5 2018-01-01 test                        0
##  6 2018-01-01 test                        0
##  7 2018-01-01 test                        1
##  8 2018-01-01 test                        0
##  9 2018-01-01 test                        0
## 10 2018-01-01 test                        1
## # ... with 578 more rows
followup_experiment_data <- read_csv("./RInputFiles/eight_month_checkin_data.csv")
## Parsed with column specification:
## cols(
##   visit_date = col_date(format = ""),
##   condition = col_character(),
##   clicked_adopt_today = col_integer()
## )
followup_experiment_data
## # A tibble: 4,860 x 3
##    visit_date condition clicked_adopt_today
##    <date>     <chr>                   <int>
##  1 2018-01-01 cat_hat                     1
##  2 2018-01-01 cat_hat                     1
##  3 2018-01-01 cat_hat                     0
##  4 2018-01-01 cat_hat                     0
##  5 2018-01-01 cat_hat                     0
##  6 2018-01-01 cat_hat                     0
##  7 2018-01-01 cat_hat                     0
##  8 2018-01-01 cat_hat                     0
##  9 2018-01-01 cat_hat                     1
## 10 2018-01-01 no_hat                      0
## # ... with 4,850 more rows
# Group and summarize data
experiment_data_clean_sum <- experiment_data %>%
    group_by(condition, visit_date) %>%
    summarize(conversion_rate = mean(clicked_adopt_today))

# Make plot of conversion rates over time
ggplot(experiment_data_clean_sum, aes(x = visit_date, y = conversion_rate, 
                                      color = condition, group = condition
                                      )
       ) + 
    geom_point() +
    geom_line()

# View summary of results
experiment_data %>% 
    group_by(condition) %>%
    summarize(conversion_rate = mean(clicked_adopt_today))
## # A tibble: 2 x 2
##   condition conversion_rate
##   <chr>               <dbl>
## 1 control             0.167
## 2 test                0.384
# Run logistic regression
experiment_results <- glm(clicked_adopt_today ~ condition, family = "binomial", 
                          data = experiment_data
                          ) %>%
    broom::tidy()
experiment_results
## # A tibble: 2 x 5
##   term          estimate std.error statistic  p.value
##   <chr>            <dbl>     <dbl>     <dbl>    <dbl>
## 1 (Intercept)      -1.61     0.156    -10.3  8.28e-25
## 2 conditiontest     1.14     0.197      5.77 7.73e- 9
# Run logistic regression power analysis
total_sample_size <- powerMediation::SSizeLogisticBin(p1 = 0.39, p2 = 0.59, B = 0.5, 
                                                      alpha = 0.05, power = 0.8
                                                      )
total_sample_size
## [1] 194
# View conversion rates by condition
followup_experiment_data %>%
    group_by(condition) %>%
    summarize(conversion_rate = mean(clicked_adopt_today))
## # A tibble: 2 x 2
##   condition conversion_rate
##   <chr>               <dbl>
## 1 cat_hat             0.459
## 2 no_hat              0.271
# Run logistic regression
followup_experiment_results <- glm(clicked_adopt_today ~ condition, family = "binomial",
                                   data = followup_experiment_data
                                   ) %>%
    broom::tidy()
followup_experiment_results
## # A tibble: 2 x 5
##   term            estimate std.error statistic  p.value
##   <chr>              <dbl>     <dbl>     <dbl>    <dbl>
## 1 (Intercept)       -0.163    0.0407     -4.01 6.02e- 5
## 2 conditionno_hat   -0.825    0.0611    -13.5  1.66e-41
# Compute monthly summary
eight_month_checkin_data_sum <- followup_experiment_data %>%
    mutate(month_text = lubridate::month(visit_date, label = TRUE)) %>%
    group_by(month_text, condition) %>%
    summarize(conversion_rate = mean(clicked_adopt_today))

# Plot month-over-month results
ggplot(eight_month_checkin_data_sum, aes(x = month_text, y = conversion_rate, 
                                         color = condition, group = condition
                                         )
       ) +
    geom_point() +
    geom_line()

# Plot monthly summary
ggplot(eight_month_checkin_data_sum, aes(x = month_text, y = conversion_rate,
                                         color = condition, group = condition
                                         )
       ) +
    geom_point() +
    geom_line() +
    scale_y_continuous(limits = c(0, 1), labels = scales::percent) +
    labs(x = "Month", y = "Conversion Rate")

# Compute difference over time
# no_hat_data_diff <- no_hat_data_sum %>% 
#     spread(year, conversion_rate) %>% 
#     mutate(year_diff = `2018` - `2017`)
# no_hat_data_diff

# Compute summary statistics
# mean(no_hat_data_diff$year_diff, na.rm = TRUE)
# sd(no_hat_data_diff$year_diff, na.rm = TRUE)


# Run power analysis for logistic regression
total_sample_size <- powerMediation::SSizeLogisticBin(p1 = 0.49, p2 = 0.64, B = 0.5, 
                                                      alpha = 0.05, power = 0.8
                                                      )
total_sample_size
## [1] 341
# View summary of data
# followup_experiment_data_sep %>% 
#     group_by(condition) %>% 
#     summarize(conversion_rate=mean(clicked_adopt_today))

# Run logistic regression
# followup_experiment_sep_results <- glm(clicked_adopt_today ~ condition,
#                                        family = "binomial",
#                                        data = followup_experiment_data_sep
#                                        ) %>%
#     broom::tidy()
# followup_experiment_sep_results

Chapter 3 - Experimental Design in A/B Testing

A/B Testing Research Questions:

  • A/B testing combined experimental design and statistics - core building block basic principles
  • Any experimental design that compares two ideas can be run as an A/B test - conversion rates, engagement with a web site, drop-off rates, total amount of time or money spent
  • Example of looking at time spent on a websit
    • str(viz_website_2017)
    • viz_website_2017 %>% summarize(mean(time_spent_homepage_sec))
    • viz_website_2017 %>% group_by(month(visit_date)) %>% summarize(mean(time_spent_homepage_sec))

Assumptions and types of A/B testing:

  • Example of changing text in a website title, then checking the implications
  • Can look at within-group experiments (everyone sees both) or between-group experiments (everyone sees one or the other)
    • The within experiment will often have better power, while the between experiment is easier to run when people may only interact once
    • The between experiment needs to be appropriately random, so that whether the person sees A/B is not linked to other attributes of the person
  • There are several types of A/B testing
    • A/B testing is test and control
    • A/A testing is to verify that the control process is working well - should be no significant effects
    • A/B/N testing is a control conditions with any number of test conditions - seems exciting and fast, but has more challenging statistics and requires more data points

Confounding variables?

  • Confounding variables are elements of the environment that can confound your ability to find the real effect of A/B
    • Sometimes the confounder is internal to the experiment - examples of word length/novelty being the real driver rather than the specific work chosen
    • Sometimes the confounder is external to the experiment - examples of differing demographics by month, with the demographics having been a key driver of outcomes

Side effects:

  • Side effects are unintended effects of a change that you made
    • Example of changing from tools to tips if it changed the page loading times
  • Side effects can include load times and information “above the fold” (what a person sees without doing any scrolling)

Example code includes:

# Compute summary by month
viz_website_2017 %>%
    group_by(month(visit_date)) %>%
    summarize(article_conversion_rate = mean(clicked_article))


# Compute 'like' click summary by month
viz_website_2017_like_sum <- viz_website_2017 %>%
    mutate(month = month(visit_date, label = TRUE)) %>%
    group_by(month) %>%
    summarize(like_conversion_rate = mean(clicked_like))

# Plot 'like' click summary by month
ggplot(viz_website_2017_like_sum,
       aes(x = month, y = like_conversion_rate, group = 1)
       ) +
    geom_point() +
    geom_line() +
    scale_y_continuous(limits = c(0, 1), labels = percent)


# Plot comparison of 'like'ing and 'sharing'ing an article
ggplot(viz_website_2017_like_share_sum,
       aes(x = month, y = conversion_rate, color = action, group = action)
       ) +
    geom_point() +
    geom_line() +
    scale_y_continuous(limits = c(0, 1), labels = percent)


# Compute conversion rates for A/A experiment
viz_website_2018_01_sum <- viz_website_2018_01 %>%
    group_by(condition) %>%
    summarize(like_conversion_rate = mean(clicked_like))
viz_website_2018_01_sum

# Plot conversion rates for two conditions
ggplot(viz_website_2018_01_sum, aes(x = condition, y = like_conversion_rate)) +
    geom_bar(stat = "identity") +
    scale_y_continuous(limits = c(0, 1), labels = percent)


# Run logistic regression
aa_experiment_results <- glm(clicked_like ~ condition, family = "binomial", data = viz_website_2018_01) %>%
    broom::tidy()
aa_experiment_results


# Compute 'like' conversion rate by week and condition
viz_website_2018_02 %>%
    mutate(week = week(visit_date)) %>%
    group_by(week, condition) %>%
    summarize(like_conversion_rate = mean(clicked_like))

# Compute 'like' conversion rate by if article published and condition
viz_website_2018_02 %>%
    group_by(article_published, condition) %>%
    summarize(like_conversion_rate = mean(clicked_like))


# Plot 'like' conversion rates by date for experiment
ggplot(viz_website_2018_02_sum,
       aes(x = visit_date, y = like_conversion_rate, color = condition,
           linetype = article_published, group = interaction(condition, article_published)
           )
       ) +
    geom_point() +
    geom_line() +
    geom_vline(xintercept = as.numeric(as.Date("2018-02-15"))) +
    scale_y_continuous(limits = c(0, 0.3), labels = percent)


# Compute 'like' conversion rate and mean pageload time by day
viz_website_2018_03_sum <- viz_website_2018_03 %>%
    group_by(visit_date, condition) %>%
    summarize(mean_pageload_time = mean(pageload_time), like_conversion_rate = mean(clicked_like))

# Plot effect of 'like' conversion rate by pageload time
ggplot(viz_website_2018_03_sum, aes(x = mean_pageload_time, y = like_conversion_rate, color = condition)) +
    geom_point()


# Plot 'like' conversion rate by day
ggplot(viz_website_2018_03_sum, aes(x = visit_date, y = like_conversion_rate, color = condition,
                                    linetype = pageload_delay_added, 
                                    group = interaction(condition, pageload_delay_added)
                                    )
       ) +
    geom_point() +
    geom_line() +
    geom_vline(xintercept = as.numeric(as.Date("2018-03-15"))) +
    scale_y_continuous(limits = c(0, 0.3), labels = percent)

Chapter 4 - Statistical Analyses in A/B Testing

Power analyses:

  • Generally, the goal of a power analysis is to determine the sample size - dependent on alpha, power (1 minus beta), and effect size
    • Effect size is often defined as the difference in the two groups divided by the standard deviation of the groups
  • The t-test is often used for significance, and can be planned using the library(pwr)
    • pwr.t.test(power = 0.8, sig.level = 0.05, d = 0.6) # will return the number of data points needed for power 0.8, alpha 0.05, effect size 0.6
    • pwr.t.test(power = 0.8, sig.level = 0.05, d = 0.2) # effect size change of ~3x drives sample size change of ~9x (delta-effect-size-squared)

Statistical tests:

  • Logistic regression and t-tests are both common statistical methods used for A/B testing
    • viz_website_2018_01 <- read_csv(“viz_website_2018_01.csv”)
    • aa_experiment_results <- t.test(time_spent_homepage_sec ~ condition, data = viz_website_2018_01)
  • Linear regression can be thought of as an extension of t-tests with more than 2 levels per variable
    • However, for an A/B test with only 2-levels, you will get the same results

Stopping rules and sequential analysis:

  • Stopping rules are procedures that allow for interim analysis (peaks in to the data) - also known as “sequential analysis”
    • Can stop because the experiment worked, stop because the experiment failed, or continue experiment
    • The p-value needs to be adjusted lower to account for the multiple peaks at the data
    • Need to be very careful to prevent p-hacking by creating the stopping rules and points in advance
  • The library(gsDesign) can help with running sequrntial analysis in R
    • library(gsDesign)
    • seq_analysis <- gsDesign(k = 4, test.type = 1, alpha = 0.05, beta = 0.2, sfu = “Pocock”) # k=4 looks, test.type=1 is similar to one-sided test, alpha is significance, beta is 1-power so beta=0.2 is power=0.8, sfu is the spending function
  • Can then figure out the sample sizes using resource-based approaches
    • max_n <- 1000
    • max_n_per_group <- max_n / 2
    • stopping_points <- max_n_per_group * seq_analysis$timing

Multivariate testing:

  • Sometmes want to make comparisons that account for multiple changes
    • multivar_results <- lm(time_spent_homepage_sec ~ word_one data = viz_website_2018_05) %>% tidy() # single variable
    • multivar_results <- lm(time_spent_homepage_sec ~ word_one * word_two, data = viz_website_2018_05) %>% tidy() # full interaction effects
  • The default R order for regressions is to use the lowest alphanumeric as the baseline level - can modify this pre-regression though
    • multivar_results <- viz_website_2018_05 %>% mutate(word_one = factor(word_one, levels = c(“tips”, “tools”))) %>% mutate(word_two = factor(word_two, levels = c(“better”, “amazing”))) %>% lm(time_spent_homepage_sec ~ word_one * word_two, data = .) %>% tidy()

A/B Testing Recap:

  • Introduction to the basic concepts of A/B testing
  • New Ideas -> Experiments -> Statistical Analysis -> Implement Winners -> Repeat

Example code includes:

# Run power analysis for logistic regression
total_sample_size <- powerMediation::SSizeLogisticBin(p1 = 0.17, p2 = 0.27, 
                                                      B = 0.5, alpha = 0.05, power = 0.8
                                                      )
total_sample_size


# Run power analysis for t-test
sample_size <- pwr::pwr.t.test(d = 0.3, sig.level = 0.05, power = 0.8)
sample_size


# Run logistic regression
ab_experiment_results <- glm(clicked_like ~ condition, family = "binomial", data = viz_website_2018_04) %>%
    broom::tidy()
ab_experiment_results


# Run t-test
ab_experiment_results <- t.test(time_spent_homepage_sec ~ condition, data = viz_website_2018_04)
ab_experiment_results


# Run sequential analysis
seq_analysis_3looks <- gsDesign::gsDesign(k = 3, test.type = 1, 
                                          alpha = 0.05, beta = 0.2, sfu = "Pocock"
                                          )
seq_analysis_3looks


# Fill in max number of points and compute points per group and find stopping points
max_n <- 3000
max_n_per_group <- max_n / 2
stopping_points <- max_n_per_group * seq_analysis_3looks$timing
stopping_points


# Compute summary values for four conditions
viz_website_2018_05_sum <- viz_website_2018_05 %>% 
    group_by(word_one, word_two) %>% 
    summarize(mean_time_spent_homepage_sec = mean(time_spent_homepage_sec))

# Plot summary values for four conditions
ggplot(viz_website_2018_05_sum, aes(x = word_one, y = mean_time_spent_homepage_sec, fill = word_two)) + 
    geom_bar(stat = "identity", position = "dodge")


# Compute summary values for four conditions
viz_website_2018_05_sum <- viz_website_2018_05 %>% 
    group_by(word_one, word_two) %>% 
    summarize(like_conversion_rate = mean(clicked_like))

# Plot summary values for four conditions
ggplot(viz_website_2018_05_sum, aes(x = word_one, y = like_conversion_rate, fill = word_two)) +
    geom_bar(stat = "identity", position = "dodge") +
    scale_y_continuous(limits = c(0, 1), labels = percent)


# Organize variables and run logistic regression
viz_website_2018_05_like_results <- viz_website_2018_05 %>%
    mutate(word_one = factor(word_one, levels = c("tips", "tools"))) %>%
    mutate(word_two = factor(word_two, levels = c("better", "amazing"))) %>%
    glm(clicked_like ~ word_one * word_two, family = "binomial", data = .) %>%
    broom::tidy()
viz_website_2018_05_like_results

Mixture Models in R

Chapter 1 - Introduction to Mixture Models

Introduction to Model-Based Clustering:

  • Mixture models are a tool for model-based clustering (partitioning and segmentation)
    • Objective for clusters to be homogenous within and heterogenous across
  • Common techniques include k-means (assign to nearest centers) and hierarchical (connect based on sililarity) and probabilistic model-based approaches (mixture models)
    • gender <- read.csv(“gender.csv”)
    • ggplot(gender, aes(x = Weight, y = BMI)) + geom_points()
  • May be helpful to have probabilities by gender rather than a hard cutoff for male vs. female
    • This is the core of the mixture model - assumes an underlying probability distribution, with the outcome being the combination of these distributions

Gaussian Distribution:

  • There are packages for fitting mixture models in R - mixtools (no Poisson), bayesmix (Bayesian), EMCluster (Gaussian only), flexmix (covered in this course)
  • The Gaussain distribution frequently plays a role in the mixture model
    • Defined by the mean and standard deviation
    • rnorm(n, mean, sd) # sample from the Gaussian of mean and sd, taking n samples
    • The mean is typically estimated as the sample mean, and the sd is typically estimated as root-mean-squared-delta-from-mean - sd()
    • ggplot(data = population_sample) + geom_histogram(aes(x = x, y = ..density..)) + stat_function(geom = “line”, fun = dnorm, args = list(mean = mean_estimate, sd = standard_deviation_estimate))

Gaussian Mixture Models (GMM):

  • Can imagine two Gaussian distributions, and pick from each randomly with 50/50 probability
    • number_of_obs <- 500
    • coin <- sample(c(0,1), size = number_of_obs, replace = TRUE, prob = c(0.5, 0.5)) # can change the coin to be non-50/50 for other mixture simulations
    • gauss_1 <- rnorm(n = number_of_obs, mean = 5, sd = 2)
    • gauss_2 <- rnorm(n = number_of_obs)
    • mixture_simulation <- ifelse(coin, gauss_1, gauss_2)
    • head(cbind(coin, gauss_1, gauss_2, mixture_simulation))
    • mixture_simulation <- data.frame(x = mixture_simulation)
    • ggplot(mixture_simulation) + geom_histogram(aes(x = x, ..density..), bins = 40)
  • Can also create mixtures of 3+ underlying Gaussian
    • proportions <- sample(c(0, 1, 2), number_of_obs, replace = TRUE, prob = c(1/3, 1/3, 1/3))
    • gauss_3 <- rnorm(n = number_of_obs, mean = 10, sd = 1)
    • mixture_simulation <- data.frame(x = ifelse(proportions == 0, gauss_1, ifelse(proportions == 1, gauss_2, gauss_3)))
    • ggplot(mixture_simulation) + geom_histogram(aes(x = x, ..density..), bins = 40)

Example code includes:

gender <- readr::read_csv("./RInputFiles/gender.csv")
## Parsed with column specification:
## cols(
##   Gender = col_character(),
##   Height = col_double(),
##   Weight = col_double(),
##   BMI = col_double(),
##   probability = col_double()
## )
glimpse(gender)
## Observations: 10,000
## Variables: 5
## $ Gender      <chr> "Male", "Male", "Male", "Male", "Male", "Male", "M...
## $ Height      <dbl> 73.84702, 68.78190, 74.11011, 71.73098, 69.88180, ...
## $ Weight      <dbl> 241.8936, 162.3105, 212.7409, 220.0425, 206.3498, ...
## $ BMI         <dbl> 0.04435662, 0.03430822, 0.03873433, 0.04276545, 0....
## $ probability <dbl> 5.778312e-06, 6.059525e-01, 2.625952e-05, 3.628734...
# Have a look to gender (before clustering)
head(gender)
## # A tibble: 6 x 5
##   Gender Height Weight    BMI probability
##   <chr>   <dbl>  <dbl>  <dbl>       <dbl>
## 1 Male     73.8   242. 0.0444  0.00000578
## 2 Male     68.8   162. 0.0343  0.606     
## 3 Male     74.1   213. 0.0387  0.0000263 
## 4 Male     71.7   220. 0.0428  0.000363  
## 5 Male     69.9   206. 0.0423  0.00461   
## 6 Male     67.3   152. 0.0337  0.911
# Scatterplot with probabilities
gender %>% 
  ggplot(aes(x = Weight, y = BMI, col = probability))+
  geom_point(alpha = 0.5)

# Set seed
set.seed(1313)

# Simulate a Gaussian distribution
simulation <- rnorm(n = 500, mean = 5, sd = 4)

# Check first six values
head(simulation)
## [1]  2.618374  8.719739 10.469360 11.462134  6.165605  7.497809
# Estimation of the mean
mean_estimate <- mean(simulation)
mean_estimate
## [1] 5.324427
# Estimation of the standard deviation
standard_deviation_estimate <- sd(simulation)
standard_deviation_estimate
## [1] 3.769612
# Transform the results to a data frame
simulation <- data.frame(x = simulation)

# Plot the sample with the estimated curve
ggplot(simulation) + 
  geom_histogram(aes(x = x, y = ..density..)) + 
  stat_function(geom = "line", fun = dnorm,
                args = list(mean = mean_estimate, 
                sd = standard_deviation_estimate))
## `stat_bin()` using `bins = 30`. Pick better value with `binwidth`.

# Estimation of the mean
mean_estimate <- gender %>% 
  pull(Weight) %>% 
  mean()
mean_estimate
## [1] 161.4404
# Estimation of the standard deviation
sd_estimate <- gender %>% 
  pull(Weight) %>% 
  sd()
sd_estimate
## [1] 32.10844
# Plot the sample with the estimated curve
gender %>% 
  ggplot() + 
  geom_histogram(aes(x = Weight, y = ..density..), bins = 100) + 
  stat_function(geom = "line", fun = dnorm,
                args = list(mean = mean_estimate, sd = sd_estimate))

# Create coin object
coin <- sample(c(0, 1), size = 500, replace = TRUE, prob = c(0.2, 0.8))

# Sample from two different Gaussian distributions
mixture <- ifelse(coin == 1, rnorm(n = 500, mean = 5, sd = 2), rnorm(n = 500))

# Check the first elements
head(mixture)
## [1] 6.715330 5.157209 2.158443 5.133819 6.089409 1.007223
# Transform into a data frame
mixture <- data.frame(x = mixture)

# Create histogram especifiying that is a density plot
mixture %>% ggplot() + 
    geom_histogram(aes(x = x, y = ..density..), bins = 50)

number_observations <- 1000

# Create the assignment object
assignments <- sample(c(0, 1 , 2), size = number_observations, replace = TRUE, prob = c(0.3, 0.4, 0.3))

# Simulate the GMM with 3 distributions
mixture <- data.frame(
    x = ifelse(assignments == 1, rnorm(n = number_observations, mean = 5, sd = 2), 
               ifelse(assignments == 2, 
                      rnorm(n = number_observations, mean = 10, sd = 1), 
                      rnorm(n = number_observations)
                      )
               )
    )

# Plot the mixture
mixture %>% 
    ggplot() + 
    geom_histogram(aes(x = x, y = ..density..), bins = 50)


Chapter 2 - Structure of Mixture Models and Parameter Estimation

Structure of Mixture Models:

  • Three questions to be answered for clustering with mixture models
    • Suitable probability distribution - depends on domain expertise
    • Number of clusters - domain expertise or testing to see what best satisfies criteria
    • Parameters and estimates - based on Expectation Maximization (EM) Algorithm
  • Example of the gender dataset - bivariate Gaussian, with two clusters, and mu/sigma/proportion for each
  • Example of handwritten digits (3 vs. 6) - Bernoulli distributions with two clusters, mean probability of being 1 for every dot
  • Example of crime types in Chicago - Poisson distribution with six clusters (crime types), average and proportion of crimes

Parameter Estimation:

  • Suppose that we have an assumption of 2 clusters each from a Gaussian distribution and with each distribution having the same sigma
    • If the probabilities are known, try to estimate the means
    • If the means are known, try to estimate the probabilities
    • means_estimates <- data_with_probs %>% summarise(mean_red = sum(x * prob_red) / sum(prob_red), mean_blue = sum(x * prob_blue) / sum(prob_blue))
    • proportions_estimates <- data_with_probs %>% summarise(proportion_red = mean(prob_red), proportion_blue = 1 - proportion_red)
    • data %>% mutate(prob_from_red = 0.3 * dnorm(x, mean = 3), prob_from_blue = 0.7 * dnorm(x,mean = 5), prob_red = prob_from_red/(prob_from_red + prob_from_blue), prob_blue = prob_from_blue/(prob_from_red + prob_from_blue)) %>%
    • select(x, prob_red, prob_blue) %>% head()

EM Algorithm:

  • Can begin by making naïve assumptions about the distributions, for later refinement
    • means_init <- c(1, 2)
    • props_init <- c(0.5, 0.5)
  • Can then run a first iteration of the probabilities - the expectations
    • means_estimates <- data_with_probs %>% summarise(mean_red = sum(x * prob_red) / sum(prob_red), mean_blue = sum(x * prob_blue) / sum(prob_blue)) %>% as.numeric()
    • props_estimates <- data_with_probs %>% summarise(proportion_red = mean(prob_red), proportion_blue = 1- proportion_red) %>% as.numeric()
  • Basically, the iterations continue
    • Iteration 0: Initial Parameters -> Estimate Probabilities (1)
    • Iteration 1: Estimated Probabilities (1) -> Estimated Parameters (2) -> Estimated Probabilities (2)
    • Iteration 2: Estimated Probabilities (2) -> Estimated Parameters (3) -> Estimated Probabilities (3)
    • Etc.
  • Can translate the iterative process in to a function that is called by way of a for loop
    • expectation <- function(data, means, proportions){
    • data <- data %>%
    •   mutate(prob_from_red = proportions[1] * dnorm(x, mean = means[1]),  
    •          prob_from_blue = proportions[2] * dnorm(x, mean = means[2]),  
    •          prob_red = prob_from_red/(prob_from_red + prob_from_blue),  
    •          prob_blue = prob_from_blue/(prob_from_red + prob_from_blue)
    •          ) %>%  
    •   select(x, prob_red, prob_blue)  
    • return(data)
    • }
    • for(i in 1:10){
    • new_values <- maximization(expectation(data, means_init, props_init))
    • means_init <- new_values[[1]]
    • props_init <- new_values[[2]]
    • cat(c(i, means_init, proportions_init),“”)
    • }

Example code includes:

digits <- readr::read_csv("./RInputFiles/digits.csv")
## Parsed with column specification:
## cols(
##   .default = col_integer()
## )
## See spec(...) for full column specifications.
dim(digits)
## [1] 1593  266
digitData <- digits[, 1:256]
digitKey <- digits[, 257:266]

# keep a subset of 4 and 8
digitUse <- rowSums(digitKey[, c(5, 9)]==1)
digData <- digitData[digitUse, ]
digKey <- digitKey[digitUse, ]

show_digit <- function(arr256, col=gray(4:1/4), ...) {
    arr256 <- as.numeric(arr256)
    image(matrix(arr256, nrow=16)[,16:1],col=col,...)
}

# Dimension
# broom::glance(digits)

# Apply `glimpse` to the data
glimpse(digitData)
## Observations: 1,593
## Variables: 256
## $ V1   <int> 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, ...
## $ V2   <int> 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, ...
## $ V3   <int> 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 1, 0, 0, 0, 0, 0, ...
## $ V4   <int> 0, 0, 0, 0, 0, 0, 0, 0, 0, 1, 0, 0, 0, 1, 0, 0, 0, 0, 1, ...
## $ V5   <int> 0, 0, 0, 0, 0, 1, 0, 1, 0, 1, 1, 0, 0, 1, 0, 1, 0, 0, 1, ...
## $ V6   <int> 0, 1, 0, 0, 0, 1, 1, 1, 1, 1, 1, 0, 1, 1, 0, 1, 0, 0, 1, ...
## $ V7   <int> 1, 1, 0, 1, 0, 1, 1, 1, 1, 1, 1, 0, 1, 1, 1, 1, 1, 1, 1, ...
## $ V8   <int> 1, 1, 0, 1, 0, 1, 1, 1, 1, 1, 1, 0, 1, 1, 1, 1, 1, 1, 1, ...
## $ V9   <int> 1, 1, 0, 1, 0, 1, 1, 1, 1, 1, 1, 0, 1, 1, 1, 1, 1, 1, 1, ...
## $ V10  <int> 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 0, 1, 1, 1, 1, 1, 1, ...
## $ V11  <int> 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 0, 1, 1, 1, 0, 1, 1, ...
## $ V12  <int> 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 0, 1, 1, 1, 0, 1, 1, ...
## $ V13  <int> 1, 1, 1, 1, 1, 1, 0, 1, 1, 1, 1, 1, 0, 0, 1, 1, 0, 0, 0, ...
## $ V14  <int> 1, 0, 1, 1, 1, 1, 0, 0, 0, 0, 1, 1, 0, 0, 1, 0, 0, 0, 0, ...
## $ V15  <int> 0, 0, 0, 1, 1, 0, 0, 0, 0, 0, 0, 1, 0, 0, 1, 0, 0, 0, 0, ...
## $ V16  <int> 0, 0, 0, 1, 0, 0, 0, 0, 0, 0, 0, 1, 0, 0, 0, 0, 0, 0, 0, ...
## $ V17  <int> 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, ...
## $ V18  <int> 0, 0, 0, 0, 0, 0, 0, 0, 0, 1, 0, 0, 0, 1, 0, 0, 0, 0, 0, ...
## $ V19  <int> 0, 0, 0, 0, 0, 0, 0, 0, 0, 1, 1, 0, 0, 1, 0, 1, 0, 0, 1, ...
## $ V20  <int> 0, 1, 0, 0, 0, 1, 1, 1, 1, 1, 1, 0, 0, 1, 0, 1, 1, 0, 1, ...
## $ V21  <int> 0, 1, 0, 0, 0, 1, 1, 1, 1, 1, 1, 0, 0, 1, 0, 1, 1, 1, 1, ...
## $ V22  <int> 1, 1, 0, 1, 0, 1, 1, 1, 1, 1, 1, 0, 1, 0, 1, 1, 1, 1, 0, ...
## $ V23  <int> 1, 1, 0, 1, 0, 1, 1, 0, 1, 0, 1, 0, 1, 0, 1, 0, 1, 1, 0, ...
## $ V24  <int> 1, 0, 0, 0, 1, 1, 0, 0, 1, 0, 0, 0, 1, 0, 1, 0, 1, 1, 0, ...
## $ V25  <int> 1, 0, 0, 0, 1, 0, 1, 0, 1, 0, 0, 1, 1, 0, 1, 0, 1, 1, 0, ...
## $ V26  <int> 1, 0, 0, 0, 1, 0, 0, 1, 0, 0, 0, 1, 1, 1, 0, 0, 1, 1, 0, ...
## $ V27  <int> 1, 0, 0, 0, 1, 0, 0, 0, 1, 0, 0, 1, 1, 1, 0, 1, 1, 1, 1, ...
## $ V28  <int> 0, 0, 0, 0, 1, 1, 1, 0, 1, 1, 1, 0, 0, 1, 0, 1, 1, 1, 1, ...
## $ V29  <int> 1, 1, 0, 0, 1, 1, 1, 1, 1, 1, 1, 0, 0, 1, 1, 1, 1, 1, 1, ...
## $ V30  <int> 1, 1, 1, 0, 1, 1, 1, 1, 1, 1, 1, 1, 0, 0, 1, 1, 0, 0, 0, ...
## $ V31  <int> 0, 0, 1, 1, 1, 0, 0, 0, 0, 0, 1, 1, 0, 0, 1, 0, 0, 0, 0, ...
## $ V32  <int> 0, 0, 0, 1, 0, 0, 0, 0, 0, 0, 0, 1, 0, 0, 0, 0, 0, 0, 0, ...
## $ V33  <int> 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 1, 0, 0, 0, 0, 0, ...
## $ V34  <int> 0, 0, 0, 0, 0, 1, 0, 0, 0, 1, 1, 0, 0, 1, 0, 1, 0, 0, 1, ...
## $ V35  <int> 0, 1, 0, 0, 0, 1, 1, 1, 1, 1, 1, 0, 0, 1, 0, 1, 1, 1, 1, ...
## $ V36  <int> 0, 1, 0, 0, 0, 1, 1, 1, 1, 1, 1, 1, 0, 1, 0, 1, 1, 1, 1, ...
## $ V37  <int> 1, 1, 0, 1, 0, 1, 0, 1, 1, 0, 1, 1, 0, 0, 1, 0, 1, 1, 0, ...
## $ V38  <int> 1, 1, 0, 1, 0, 0, 0, 0, 1, 0, 0, 1, 1, 0, 1, 0, 1, 1, 0, ...
## $ V39  <int> 1, 1, 0, 0, 1, 0, 0, 0, 1, 0, 0, 1, 0, 0, 1, 0, 1, 0, 0, ...
## $ V40  <int> 1, 0, 0, 0, 1, 0, 0, 0, 0, 0, 0, 1, 0, 0, 1, 0, 1, 0, 0, ...
## $ V41  <int> 1, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 1, 0, 0, 0, 0, 1, 0, 0, ...
## $ V42  <int> 1, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 1, 0, 0, 0, 1, 0, 0, ...
## $ V43  <int> 0, 0, 0, 0, 1, 0, 0, 0, 0, 0, 0, 0, 1, 0, 0, 0, 1, 0, 0, ...
## $ V44  <int> 0, 0, 0, 0, 1, 0, 0, 0, 0, 0, 0, 0, 1, 1, 0, 0, 1, 1, 0, ...
## $ V45  <int> 0, 1, 0, 0, 1, 1, 1, 1, 0, 1, 1, 0, 0, 1, 0, 0, 1, 1, 1, ...
## $ V46  <int> 1, 1, 0, 0, 1, 1, 1, 1, 1, 1, 1, 0, 0, 1, 0, 1, 1, 1, 0, ...
## $ V47  <int> 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 0, 0, 1, 1, 0, 0, 0, ...
## $ V48  <int> 0, 0, 1, 1, 0, 0, 0, 0, 0, 0, 0, 1, 0, 0, 1, 0, 0, 0, 0, ...
## $ V49  <int> 0, 0, 0, 0, 0, 1, 0, 0, 0, 1, 0, 0, 0, 1, 0, 1, 0, 0, 1, ...
## $ V50  <int> 0, 1, 0, 0, 0, 1, 1, 0, 1, 1, 1, 1, 0, 1, 0, 1, 1, 1, 1, ...
## $ V51  <int> 0, 1, 0, 0, 0, 1, 1, 1, 1, 1, 1, 1, 0, 1, 0, 1, 1, 1, 1, ...
## $ V52  <int> 1, 1, 0, 0, 0, 0, 0, 1, 1, 0, 0, 1, 0, 0, 1, 0, 1, 1, 0, ...
## $ V53  <int> 1, 0, 0, 1, 0, 0, 0, 0, 0, 0, 0, 1, 1, 0, 1, 0, 0, 0, 0, ...
## $ V54  <int> 1, 0, 1, 1, 1, 0, 0, 0, 0, 0, 0, 1, 1, 0, 1, 0, 0, 0, 0, ...
## $ V55  <int> 1, 0, 1, 0, 1, 0, 0, 0, 0, 0, 0, 1, 0, 0, 1, 0, 0, 0, 0, ...
## $ V56  <int> 1, 0, 1, 0, 0, 0, 0, 0, 0, 0, 0, 1, 0, 0, 1, 0, 0, 0, 0, ...
## $ V57  <int> 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 1, 0, 0, 0, 0, 0, 0, 0, ...
## $ V58  <int> 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, ...
## $ V59  <int> 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, ...
## $ V60  <int> 0, 0, 0, 0, 1, 0, 0, 0, 0, 0, 0, 0, 1, 0, 0, 0, 1, 0, 0, ...
## $ V61  <int> 1, 0, 0, 0, 1, 0, 0, 0, 0, 0, 0, 0, 1, 1, 0, 0, 1, 1, 1, ...
## $ V62  <int> 1, 1, 0, 0, 0, 1, 1, 1, 0, 1, 0, 1, 1, 1, 0, 1, 1, 1, 1, ...
## $ V63  <int> 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 0, 0, 1, 1, 0, 1, 0, ...
## $ V64  <int> 1, 1, 1, 1, 1, 1, 0, 0, 1, 1, 1, 1, 0, 0, 1, 0, 0, 0, 0, ...
## $ V65  <int> 0, 1, 0, 0, 0, 1, 1, 0, 0, 1, 0, 0, 0, 1, 0, 1, 0, 1, 1, ...
## $ V66  <int> 0, 1, 0, 0, 0, 1, 1, 1, 1, 1, 1, 1, 0, 1, 0, 1, 1, 1, 1, ...
## $ V67  <int> 0, 1, 0, 1, 0, 0, 1, 1, 1, 0, 1, 1, 0, 1, 1, 0, 1, 1, 0, ...
## $ V68  <int> 1, 0, 1, 1, 0, 0, 0, 0, 1, 0, 0, 1, 0, 0, 1, 0, 0, 0, 0, ...
## $ V69  <int> 1, 0, 1, 1, 1, 0, 0, 0, 0, 0, 0, 0, 1, 0, 1, 0, 0, 0, 0, ...
## $ V70  <int> 1, 0, 1, 0, 1, 0, 0, 0, 0, 0, 0, 1, 1, 0, 1, 0, 0, 0, 0, ...
## $ V71  <int> 1, 0, 1, 0, 0, 0, 0, 0, 0, 0, 0, 1, 0, 0, 1, 0, 0, 0, 0, ...
## $ V72  <int> 0, 0, 1, 0, 0, 0, 0, 0, 0, 0, 0, 1, 0, 0, 0, 0, 0, 0, 0, ...
## $ V73  <int> 1, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, ...
## $ V74  <int> 1, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, ...
## $ V75  <int> 1, 0, 0, 0, 1, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, ...
## $ V76  <int> 1, 0, 0, 0, 1, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, ...
## $ V77  <int> 1, 0, 0, 0, 1, 0, 0, 0, 0, 0, 0, 0, 1, 1, 0, 0, 1, 0, 0, ...
## $ V78  <int> 1, 0, 0, 0, 0, 1, 0, 0, 0, 0, 0, 1, 1, 1, 0, 0, 1, 1, 1, ...
## $ V79  <int> 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 0, 1, 1, 1, 1, 1, 1, ...
## $ V80  <int> 0, 1, 1, 1, 1, 1, 0, 0, 1, 1, 1, 1, 0, 0, 1, 0, 0, 1, 0, ...
## $ V81  <int> 0, 1, 0, 0, 0, 1, 1, 1, 0, 1, 1, 1, 0, 1, 0, 1, 1, 1, 1, ...
## $ V82  <int> 0, 1, 0, 1, 0, 0, 1, 1, 1, 1, 1, 1, 0, 1, 1, 1, 1, 1, 0, ...
## $ V83  <int> 0, 1, 1, 1, 0, 0, 0, 1, 1, 0, 0, 1, 1, 0, 1, 0, 1, 0, 0, ...
## $ V84  <int> 1, 0, 1, 1, 1, 0, 0, 0, 0, 1, 0, 0, 1, 0, 1, 0, 0, 0, 0, ...
## $ V85  <int> 1, 0, 1, 0, 1, 0, 0, 0, 0, 1, 0, 0, 0, 0, 1, 0, 0, 0, 0, ...
## $ V86  <int> 1, 0, 0, 0, 1, 0, 0, 0, 0, 1, 0, 1, 1, 0, 1, 0, 0, 0, 0, ...
## $ V87  <int> 0, 0, 0, 0, 1, 0, 0, 0, 0, 0, 0, 1, 0, 0, 0, 0, 0, 0, 0, ...
## $ V88  <int> 1, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, ...
## $ V89  <int> 1, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, ...
## $ V90  <int> 1, 0, 0, 0, 1, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, ...
## $ V91  <int> 1, 0, 0, 0, 1, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, ...
## $ V92  <int> 1, 0, 0, 0, 1, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, ...
## $ V93  <int> 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, ...
## $ V94  <int> 1, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 1, 1, 1, 0, 0, 1, 0, 1, ...
## $ V95  <int> 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, ...
## $ V96  <int> 0, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 0, 1, 1, 1, 0, 1, 1, ...
## $ V97  <int> 0, 1, 0, 0, 0, 1, 1, 1, 0, 0, 1, 1, 0, 1, 0, 1, 1, 1, 1, ...
## $ V98  <int> 0, 1, 1, 1, 0, 0, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 0, ...
## $ V99  <int> 1, 0, 1, 1, 1, 0, 0, 1, 1, 1, 0, 1, 1, 0, 1, 0, 1, 1, 0, ...
## $ V100 <int> 1, 0, 1, 0, 1, 0, 0, 0, 1, 1, 0, 0, 0, 0, 1, 0, 0, 0, 0, ...
## $ V101 <int> 1, 0, 0, 0, 0, 0, 0, 0, 1, 0, 0, 0, 0, 0, 1, 0, 0, 0, 0, ...
## $ V102 <int> 1, 0, 0, 0, 0, 0, 0, 0, 1, 0, 0, 1, 1, 0, 1, 0, 0, 0, 0, ...
## $ V103 <int> 1, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 1, 0, 0, 0, 0, 0, 0, 0, ...
## $ V104 <int> 1, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, ...
## $ V105 <int> 1, 0, 0, 0, 1, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, ...
## $ V106 <int> 1, 0, 0, 0, 1, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, ...
## $ V107 <int> 0, 0, 0, 0, 1, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, ...
## $ V108 <int> 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, ...
## $ V109 <int> 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, ...
## $ V110 <int> 1, 0, 0, 1, 1, 0, 0, 0, 0, 0, 0, 1, 0, 0, 0, 0, 1, 0, 0, ...
## $ V111 <int> 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, ...
## $ V112 <int> 0, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 0, 0, 1, 1, 1, 1, 1, 1, ...
## $ V113 <int> 0, 1, 0, 1, 0, 1, 1, 1, 0, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, ...
## $ V114 <int> 0, 1, 1, 1, 0, 0, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 0, ...
## $ V115 <int> 1, 0, 1, 1, 1, 0, 0, 0, 1, 1, 0, 0, 1, 0, 0, 1, 1, 1, 0, ...
## $ V116 <int> 1, 0, 0, 0, 1, 0, 0, 0, 1, 0, 0, 0, 0, 0, 1, 0, 0, 0, 0, ...
## $ V117 <int> 1, 0, 0, 0, 0, 0, 0, 0, 1, 0, 0, 0, 0, 0, 1, 0, 0, 0, 0, ...
## $ V118 <int> 1, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 1, 0, 0, 0, 0, 0, 0, ...
## $ V119 <int> 1, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 1, 0, 0, 0, 0, 0, 0, ...
## $ V120 <int> 1, 0, 0, 0, 1, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, ...
## $ V121 <int> 0, 0, 0, 0, 1, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, ...
## $ V122 <int> 0, 0, 0, 0, 1, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, ...
## $ V123 <int> 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, ...
## $ V124 <int> 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, ...
## $ V125 <int> 1, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 1, 0, 0, 0, 0, 0, 0, 0, ...
## $ V126 <int> 1, 0, 0, 1, 1, 0, 0, 0, 1, 0, 0, 1, 0, 0, 1, 0, 0, 0, 0, ...
## $ V127 <int> 0, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, ...
## $ V128 <int> 0, 1, 0, 0, 0, 1, 1, 1, 1, 1, 1, 0, 1, 1, 1, 1, 1, 1, 1, ...
## $ V129 <int> 0, 1, 1, 1, 0, 1, 1, 1, 0, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, ...
## $ V130 <int> 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 0, ...
## $ V131 <int> 1, 0, 0, 1, 1, 0, 0, 0, 1, 0, 0, 0, 0, 0, 0, 1, 1, 1, 0, ...
## $ V132 <int> 1, 0, 0, 0, 0, 0, 0, 0, 1, 0, 0, 0, 0, 0, 1, 0, 0, 0, 0, ...
## $ V133 <int> 1, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 1, 0, 0, 0, 0, ...
## $ V134 <int> 1, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, ...
## $ V135 <int> 1, 0, 0, 0, 1, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, ...
## $ V136 <int> 0, 0, 0, 0, 1, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, ...
## $ V137 <int> 0, 0, 0, 0, 1, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, ...
## $ V138 <int> 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, ...
## $ V139 <int> 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, ...
## $ V140 <int> 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, ...
## $ V141 <int> 1, 0, 0, 1, 0, 0, 0, 0, 0, 0, 0, 1, 0, 0, 0, 0, 0, 0, 0, ...
## $ V142 <int> 1, 0, 0, 1, 1, 0, 0, 0, 1, 1, 1, 1, 0, 0, 1, 0, 0, 0, 0, ...
## $ V143 <int> 0, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, ...
## $ V144 <int> 0, 1, 0, 0, 0, 1, 1, 1, 0, 0, 1, 0, 1, 1, 0, 1, 1, 1, 1, ...
## $ V145 <int> 0, 1, 1, 1, 1, 1, 1, 1, 0, 1, 1, 1, 1, 1, 1, 1, 1, 1, 0, ...
## $ V146 <int> 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 0, ...
## $ V147 <int> 1, 0, 0, 1, 1, 0, 0, 0, 1, 0, 0, 0, 0, 0, 0, 1, 1, 1, 0, ...
## $ V148 <int> 1, 0, 0, 0, 0, 0, 0, 0, 1, 0, 0, 0, 0, 0, 1, 0, 0, 0, 0, ...
## $ V149 <int> 1, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 1, 0, 0, 0, 0, ...
## $ V150 <int> 0, 0, 0, 0, 1, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, ...
## $ V151 <int> 0, 0, 0, 0, 1, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, ...
## $ V152 <int> 0, 0, 0, 0, 1, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, ...
## $ V153 <int> 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, ...
## $ V154 <int> 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, ...
## $ V155 <int> 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, ...
## $ V156 <int> 0, 0, 0, 1, 0, 0, 0, 0, 0, 0, 0, 1, 0, 0, 0, 0, 0, 0, 0, ...
## $ V157 <int> 1, 0, 0, 1, 1, 0, 0, 0, 1, 1, 0, 1, 0, 0, 1, 0, 0, 0, 0, ...
## $ V158 <int> 1, 0, 1, 1, 1, 1, 0, 0, 1, 1, 1, 1, 0, 0, 1, 0, 0, 0, 0, ...
## $ V159 <int> 0, 1, 1, 0, 1, 1, 1, 1, 1, 1, 1, 0, 1, 1, 1, 1, 1, 1, 1, ...
## $ V160 <int> 0, 1, 0, 0, 0, 1, 1, 1, 0, 0, 0, 0, 1, 1, 0, 0, 1, 1, 1, ...
## $ V161 <int> 0, 1, 1, 1, 1, 0, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 0, ...
## $ V162 <int> 1, 1, 0, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 0, 1, 1, 1, 0, ...
## $ V163 <int> 1, 0, 0, 1, 0, 1, 0, 0, 1, 0, 0, 0, 0, 1, 1, 1, 0, 1, 0, ...
## $ V164 <int> 1, 0, 0, 0, 0, 0, 0, 0, 1, 0, 0, 0, 0, 0, 1, 1, 0, 0, 0, ...
## $ V165 <int> 0, 0, 0, 0, 0, 0, 0, 0, 1, 0, 0, 0, 0, 0, 1, 1, 0, 0, 0, ...
## $ V166 <int> 0, 0, 0, 0, 1, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, ...
## $ V167 <int> 0, 0, 0, 0, 1, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, ...
## $ V168 <int> 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, ...
## $ V169 <int> 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, ...
## $ V170 <int> 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, ...
## $ V171 <int> 1, 0, 0, 1, 0, 0, 0, 0, 0, 0, 0, 1, 0, 0, 0, 0, 0, 0, 0, ...
## $ V172 <int> 1, 0, 0, 1, 1, 0, 0, 0, 1, 1, 1, 1, 0, 0, 1, 0, 0, 0, 0, ...
## $ V173 <int> 1, 0, 1, 1, 1, 0, 0, 0, 1, 1, 1, 1, 0, 0, 1, 0, 0, 0, 0, ...
## $ V174 <int> 0, 1, 1, 0, 1, 1, 0, 0, 1, 1, 1, 1, 0, 0, 1, 0, 1, 1, 1, ...
## $ V175 <int> 0, 1, 0, 0, 0, 1, 1, 1, 0, 0, 0, 0, 1, 1, 0, 1, 1, 1, 1, ...
## $ V176 <int> 0, 1, 0, 0, 0, 1, 0, 1, 0, 0, 0, 0, 1, 1, 0, 0, 1, 0, 0, ...
## $ V177 <int> 1, 1, 1, 1, 1, 0, 1, 1, 1, 1, 1, 1, 1, 0, 0, 1, 1, 1, 0, ...
## $ V178 <int> 1, 1, 0, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 0, 1, 1, 1, 0, ...
## $ V179 <int> 1, 0, 0, 0, 0, 1, 0, 1, 1, 0, 0, 0, 0, 1, 0, 1, 0, 1, 1, ...
## $ V180 <int> 0, 0, 0, 0, 0, 0, 0, 0, 1, 0, 0, 0, 0, 1, 1, 0, 0, 1, 1, ...
## $ V181 <int> 0, 0, 0, 0, 1, 0, 0, 0, 1, 0, 0, 0, 0, 0, 1, 0, 0, 0, 0, ...
## $ V182 <int> 0, 0, 0, 0, 1, 0, 0, 0, 1, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, ...
## $ V183 <int> 0, 0, 0, 0, 0, 0, 0, 0, 1, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, ...
## $ V184 <int> 0, 0, 0, 0, 0, 0, 0, 0, 1, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, ...
## $ V185 <int> 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, ...
## $ V186 <int> 0, 0, 0, 1, 0, 0, 0, 0, 1, 0, 0, 1, 0, 0, 0, 0, 0, 0, 0, ...
## $ V187 <int> 1, 0, 0, 1, 1, 0, 0, 0, 1, 1, 1, 1, 0, 0, 1, 0, 0, 0, 0, ...
## $ V188 <int> 1, 0, 1, 1, 1, 0, 0, 0, 1, 1, 1, 1, 0, 0, 1, 0, 0, 0, 0, ...
## $ V189 <int> 0, 0, 1, 0, 1, 0, 0, 0, 1, 1, 1, 1, 0, 0, 1, 0, 0, 1, 0, ...
## $ V190 <int> 0, 1, 0, 0, 0, 1, 1, 0, 0, 0, 1, 0, 1, 1, 0, 1, 1, 1, 1, ...
## $ V191 <int> 0, 1, 0, 0, 0, 1, 1, 1, 0, 0, 0, 0, 1, 1, 0, 1, 1, 1, 1, ...
## $ V192 <int> 0, 0, 0, 0, 0, 0, 0, 1, 0, 0, 0, 0, 0, 1, 0, 0, 0, 0, 0, ...
## $ V193 <int> 1, 1, 1, 1, 1, 0, 0, 1, 1, 1, 1, 1, 1, 0, 0, 1, 1, 1, 0, ...
## $ V194 <int> 1, 1, 0, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 0, 0, 1, 1, 1, 0, ...
## $ V195 <int> 1, 1, 0, 0, 0, 1, 1, 1, 0, 0, 1, 0, 0, 1, 0, 1, 1, 1, 1, ...
## $ V196 <int> 1, 0, 0, 0, 1, 1, 0, 0, 0, 0, 0, 0, 0, 1, 1, 0, 0, 1, 1, ...
## $ V197 <int> 0, 0, 0, 0, 1, 0, 0, 0, 0, 0, 0, 0, 0, 1, 1, 0, 0, 0, 1, ...
## $ V198 <int> 0, 0, 0, 0, 1, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, ...
## $ V199 <int> 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, ...
## $ V200 <int> 0, 0, 0, 1, 0, 0, 0, 0, 1, 1, 0, 0, 0, 0, 0, 0, 0, 0, 0, ...
## $ V201 <int> 1, 0, 0, 1, 0, 0, 0, 0, 1, 1, 0, 1, 0, 0, 0, 0, 0, 0, 0, ...
## $ V202 <int> 1, 0, 0, 1, 1, 0, 0, 0, 1, 1, 0, 1, 0, 0, 1, 0, 0, 0, 0, ...
## $ V203 <int> 1, 0, 1, 1, 1, 0, 0, 0, 1, 1, 1, 1, 0, 0, 1, 0, 0, 0, 0, ...
## $ V204 <int> 1, 0, 1, 0, 1, 0, 0, 0, 1, 1, 1, 1, 0, 0, 1, 1, 0, 1, 0, ...
## $ V205 <int> 0, 1, 0, 0, 0, 1, 1, 1, 0, 0, 1, 0, 1, 1, 0, 1, 1, 1, 1, ...
## $ V206 <int> 0, 1, 0, 0, 0, 1, 1, 1, 0, 0, 0, 0, 1, 1, 0, 1, 1, 1, 1, ...
## $ V207 <int> 0, 1, 0, 0, 0, 1, 0, 1, 0, 0, 0, 0, 1, 1, 0, 1, 1, 0, 1, ...
## $ V208 <int> 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, ...
## $ V209 <int> 1, 0, 1, 1, 1, 0, 0, 0, 1, 0, 0, 1, 1, 0, 0, 0, 1, 0, 0, ...
## $ V210 <int> 1, 1, 1, 1, 1, 0, 1, 1, 1, 1, 1, 1, 1, 0, 0, 1, 1, 1, 0, ...
## $ V211 <int> 1, 1, 0, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 0, 1, 1, 1, 0, ...
## $ V212 <int> 1, 1, 0, 0, 1, 1, 1, 1, 1, 1, 1, 0, 0, 1, 1, 1, 1, 1, 1, ...
## $ V213 <int> 0, 0, 0, 0, 1, 1, 0, 1, 1, 1, 0, 0, 0, 1, 1, 0, 0, 1, 1, ...
## $ V214 <int> 0, 0, 0, 1, 0, 1, 0, 0, 1, 1, 0, 0, 0, 1, 1, 0, 0, 0, 1, ...
## $ V215 <int> 0, 0, 0, 1, 0, 0, 0, 0, 1, 1, 0, 0, 0, 0, 0, 0, 0, 0, 0, ...
## $ V216 <int> 1, 0, 0, 1, 1, 0, 0, 0, 1, 1, 0, 1, 0, 0, 1, 0, 0, 0, 0, ...
## $ V217 <int> 1, 0, 1, 1, 1, 0, 0, 0, 1, 1, 1, 1, 0, 0, 1, 0, 0, 0, 0, ...
## $ V218 <int> 1, 0, 1, 0, 1, 0, 0, 0, 1, 0, 1, 1, 0, 0, 1, 0, 1, 1, 0, ...
## $ V219 <int> 0, 0, 1, 0, 0, 1, 0, 1, 0, 0, 1, 0, 1, 0, 1, 1, 1, 1, 0, ...
## $ V220 <int> 0, 0, 0, 0, 0, 1, 1, 1, 0, 0, 1, 0, 1, 1, 0, 1, 1, 1, 1, ...
## $ V221 <int> 0, 1, 0, 0, 0, 1, 1, 1, 0, 0, 0, 0, 1, 1, 0, 1, 1, 1, 1, ...
## $ V222 <int> 0, 1, 0, 0, 0, 1, 1, 1, 0, 0, 0, 0, 1, 1, 0, 0, 1, 0, 1, ...
## $ V223 <int> 0, 0, 0, 0, 0, 0, 0, 1, 0, 0, 0, 0, 0, 1, 0, 0, 0, 0, 0, ...
## $ V224 <int> 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, ...
## $ V225 <int> 1, 0, 0, 0, 1, 0, 0, 0, 0, 0, 0, 1, 0, 0, 0, 0, 0, 0, 0, ...
## $ V226 <int> 0, 0, 1, 1, 1, 0, 0, 0, 1, 1, 0, 1, 1, 0, 0, 0, 1, 0, 0, ...
## $ V227 <int> 1, 1, 1, 1, 1, 0, 1, 1, 1, 1, 1, 1, 1, 0, 0, 1, 1, 0, 0, ...
## $ V228 <int> 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 0, 0, 1, 1, 1, 0, ...
## $ V229 <int> 1, 0, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, ...
## $ V230 <int> 1, 0, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 0, 1, 1, 1, ...
## $ V231 <int> 1, 0, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, ...
## $ V232 <int> 1, 0, 1, 0, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, ...
## $ V233 <int> 1, 0, 1, 0, 1, 1, 1, 1, 0, 0, 1, 1, 1, 1, 1, 1, 1, 1, 1, ...
## $ V234 <int> 0, 0, 0, 0, 0, 1, 1, 1, 0, 0, 1, 0, 1, 1, 1, 1, 1, 1, 1, ...
## $ V235 <int> 0, 0, 0, 0, 0, 1, 1, 1, 0, 0, 1, 0, 1, 1, 0, 1, 1, 1, 1, ...
## $ V236 <int> 0, 1, 0, 0, 0, 1, 1, 1, 0, 0, 0, 0, 1, 1, 0, 0, 1, 1, 1, ...
## $ V237 <int> 0, 1, 0, 0, 0, 0, 0, 1, 0, 0, 0, 0, 0, 1, 0, 0, 0, 0, 1, ...
## $ V238 <int> 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, ...
## $ V239 <int> 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, ...
## $ V240 <int> 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, ...
## $ V241 <int> 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, ...
## $ V242 <int> 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, ...
## $ V243 <int> 0, 0, 1, 0, 1, 0, 0, 0, 1, 0, 0, 1, 1, 0, 0, 0, 0, 0, 0, ...
## $ V244 <int> 1, 1, 1, 1, 1, 0, 0, 0, 1, 1, 1, 1, 1, 0, 0, 0, 0, 0, 0, ...
## $ V245 <int> 1, 1, 1, 1, 1, 0, 1, 1, 1, 1, 1, 1, 1, 0, 0, 1, 1, 0, 0, ...
## $ V246 <int> 1, 1, 1, 0, 1, 0, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 0, ...
## $ V247 <int> 1, 1, 1, 0, 0, 1, 1, 1, 0, 0, 1, 1, 1, 1, 1, 1, 1, 1, 1, ...
## $ V248 <int> 0, 1, 0, 0, 0, 1, 1, 0, 0, 0, 1, 1, 1, 1, 1, 1, 1, 1, 1, ...
## $ V249 <int> 0, 1, 0, 0, 0, 1, 1, 0, 0, 0, 1, 0, 1, 1, 0, 1, 1, 1, 1, ...
## $ V250 <int> 0, 1, 0, 0, 0, 1, 1, 0, 0, 0, 0, 0, 0, 1, 0, 0, 1, 0, 1, ...
## $ V251 <int> 0, 1, 0, 0, 0, 1, 0, 0, 0, 0, 0, 0, 0, 1, 0, 0, 0, 0, 1, ...
## $ V252 <int> 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 1, 0, 0, 0, 0, 1, ...
## $ V253 <int> 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, ...
## $ V254 <int> 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, ...
## $ V255 <int> 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, ...
## $ V256 <int> 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, ...
# Digit in row 50
show_digit(digitData[50, ])

# Digit in row 100
show_digit(digitData[100, ])

gaussian_sample_with_probs <- data.frame(
    x = c(54.5, 7.7, 55.9, 27.9, 4.6, 59.9, 6.4, 60.5, 32.6, 21.3, 0.5, 8.9, 70.7, 49.3, 40.1, 43, 8.1, 62.9, 56, 54.4, 42.5, 46.1, 58.3, 61.7, -11.6, 10.8, 27.5, 12.2, 67.7, -5.6, 13.3, 62.7, 37.2, 41.4, 47.4, 54.2, 31, 60.2, 69.9, 33.8, 25.4, 21.9, 17.9, 61.5, 49.8, 37.9, 55.8, 14.1, 53.3, 45.6, 44.7, 14.2, -5.7, 10.9, 63.7, -6.5, 50.3, 61.4, 35.1, -3.7, 68.4, -6.2, 64, 24.4, 65.7, 59.7, 52.7, 27.2, 17.5, 22.6, 14.7, 22.1, 61.5, 55.6, 62.6, 5.6, 52.3, 8, 25.4, 48.8, 58.4, 6.2, 52.3, 6.6, 64, 43, 60.6, 33.5, 45.8, 2.5, 63, 58.2, 50.9, 22.1, 36.5, 27.1, 61.4, 56.3, 63.5, 55.6, 53.8, 31.9, 30.7, 15.6, 14.8, 44.4, 51.9, 61.4, 11.8, 51.3, 58.6, 45.4, 8.3, 41.5, 52.7, 9.1, 60.8, 40.2, 20.5, 40.2, 59.2, 36.7, 47.5, 12.2, 7.7, 56.2, -13.2, 6, 58.7, 43.7, 67.3, 53.6, 37.6, 54.3, 37.7, 51.9, 10.5, 42, 24, -0.7, 53.1, 27.4, 57.2, 37.3, 28.6, 13.5, 35.2, 22.7, 35.8, 66.9, 45.9, 45.9, 56.7, 55.6, 58.3, 3.2, 45.9, 59.5, 50.8, 43.7, 42.8, 4.7, 29.5, 50.9, 7.8, 44.3, 53.6, 57, 57.8, 47.3, 56.8, 51.1, 27.7, 44.9, 33, 44, 42.1, 38, 52.3, 44, 28.1, 52.7, 53.6, 4.7, 42.1, 40.8, 5, 8, 49.1, 67.5, 16.2, 11.2, 14.6, 32.8, 61.3, 49.8, 51.5, 54.5, 51.6, 45.8, 55.9, 7.4, -10.2, 41.9, 27.4, 45.1, 17.7, 37.5, 53.5, 25.7, 18.1, 13.4, 40.5, 13.3, 2, 49.8, 66.7, 34.7, 11.4, 42.1, 54.4, 48.3, 38.3, 17.4, 48.2, 48.4, 57.4, 54.5, 13.6, 52.3, -0.1, 12.8, 29.3, 45.6, 62.3, 49.2, 32.6, 38.4, 15, 6.1, 12.2, 5.8, 17.7, 20.7, 43.6, 52.3, 42.4, 64.6, 34.3, 9.5, 3.6, 37.2, 45.7, 56.9, 67, 48.7, -3.1, 50.1, 45.4, 54.4, 38.1, 10.8, 7.4, 50.5, 24.7, 11.4, 59.5, 43.9, 4.4, 53.7, 41.9, 60.2, 49.5, 11.6, 51.1, 69.1, 46.2, 35.5, 15, -6.4, 59.9, 57.3, 49.1, 55.5, 55.6, 43.9, 52.5, 46.4, 5.8, 55.3, 22.2, 42.7, 51.3, 40.1, 62.1, 62.2, 48.8, 6.1, 0.6, 19.6, 36.8, 48, 33.8, 52.8, 66.6, 30.2, 45.9, 5.9, 52.7, 49.7, 37.7, 10.4, 60.1, 35.8, 62.1, 35, 38.7, 13.3, -4.9, 30.6, 55.9, 23.7, 12.6, 45.7, 38.1, 9.9, 39.6, 46.3, -3.5, 31.2, 8.3, -8.1, 31.4, 65.7, 10.7, 5.5, 54.4, 51.8, 59.8, 50.3, 45.1, 8.5, 15.3, 3.2, 19.3, 40.8, 48.4, 30.1, 32.7, 12.7, 59.2, 51.4, 55.3, 58.9, -19, 61.9, 30.3, 77.2, 39.8, 31.3, 23.1, 56, 41.9, 0.5, 33.4, 36.6, 54.4, 12.4, 16.4, 24.4, -2.4, 30.9, 56.4, 12.5, 65.2, 10, -1.7, 45.7, 49.5, 45.3, 17.5, 29, -8.7, 51.7, 17.3, 20.2, 14.6, 47.6, 55.3, 50.2, 4.1, 47.5, 71, 13.2, 75.4, 6.2, 53, 54.2, 40.6, 55.1, 67.4, 45, 47.3, 44.2, 8.4, 46.1, 48.7, 8.3, 40.4, 63, 49, 2.8, 50.4, 17.7, 40.4, 41.1, 56.6, 37.3, -0.1, 62.5, 47.7, 62.1, 16.6, 33.3, 4.1, 61, 49.4, 44.1, 18.7, -1.3, 42.1, -11.8, 40.6, 45.6, 14.9, 51.9, 57.4, 41.3, 59.2, 58.6, 50.5, -3.9, -0.6, 11.5, 54.5, 57.1, 46.2, 51.9, 58.2, 51.6, 50.3, 64.2, 8.3, 49, 42, 43.7, 53.4, 6.5, 36.6, -18.2, 41.8, -6.8, 35, 46.8, 43.8, 60.6, -11.3, 18.5, 0.3, 40.2, 73.3, 58.2, 43.9, 22.2, 12.8, 6.7, 36.3, 51.8, 33.6, 71, 56.8, 26, 43.3, 37.4, 60, 17.2, -10.3, 43.9, 69, 38.7, 57.9, 40.2, 48.6, 57.7, 45.8, 56.2, 7.3, 32.1, 41.2, 39.1), 
    prob_cluster1=c(0, 1, 0, 0.552, 1, 0, 1, 0, 0.158, 0.947, 1, 1, 0, 0, 0.01, 0.003, 1, 0, 0, 0, 0.004, 0.001, 0, 0, 1, 0.999, 0.591, 0.999, 0, 1, 0.998, 0, 0.03, 0.006, 0.001, 0, 0.268, 0, 0, 0.107, 0.773, 0.933, 0.985, 0, 0, 0.023, 0, 0.997, 0, 0.001, 0.002, 0.997, 1, 0.999, 0, 1, 0, 0, 0.065, 1, 0, 1, 0, 0.834, 0, 0, 0, 0.626, 0.988, 0.912, 0.996, 0.928, 0, 0, 0, 1, 0, 1, 0.773, 0, 0, 1, 0, 1, 0, 0.003, 0, 0.118, 0.001, 1, 0, 0, 0, 0.926, 0.038, 0.631, 0, 0, 0, 0, 0, 0.201, 0.286, 0.994, 0.996, 0.002, 0, 0, 0.999, 0, 0, 0.001, 1, 0.005, 0, 1, 0, 0.009, 0.961, 0.009, 0, 0.036, 0, 0.999, 1, 0, 1, 1, 0, 0.002, 0, 0, 0.025, 0, 0.024, 0, 0.999, 0.004, 0.855, 1, 0, 0.604, 0, 0.028, 0.484, 0.997, 0.062, 0.909, 0.05, 0, 0.001, 0.001, 0, 0, 0, 1, 0.001, 0, 0, 0.002, 0.003, 1, 0.398, 0, 1, 0.002, 0, 0, 0, 0.001, 0, 0, 0.576, 0.001, 0.138, 0.002, 0.004, 0.022, 0, 0.002, 0.533, 0, 0, 1, 0.004, 0.007, 1, 1, 0, 0, 0.993, 0.999, 0.996, 0.147, 0, 0, 0, 0, 0, 0.001, 0, 1, 1, 0.005, 0.606, 0.001, 0.987, 0.026, 0, 0.754, 0.985, 0.998, 0.008, 0.998, 1, 0, 0, 0.076, 0.999, 0.004, 0, 0, 0.019, 0.988, 0, 0, 0, 0, 0.997, 0, 1, 0.998, 0.417, 0.001, 0, 0, 0.162, 0.018, 0.995, 1, 0.998, 1, 0.987, 0.956, 0.002, 0, 0.004, 0, 0.087, 0.999, 1, 0.03, 0.001, 0, 0, 0, 1, 0, 0.001, 0, 0.021, 0.999, 1, 0, 0.82, 0.999, 0, 0.002, 1, 0, 0.005, 0, 0, 0.999, 0, 0, 0.001, 0.057, 0.995, 1, 0, 0, 0, 0, 0, 0.002, 0, 0.001, 1, 0, 0.925, 0.003, 0, 0.009, 0, 0, 0, 1, 1, 0.971, 0.035, 0, 0.104, 0, 0, 0.329, 0.001, 1, 0, 0, 0.024, 0.999, 0, 0.05, 0, 0.067, 0.016, 0.998, 1, 0.298, 0, 0.87, 0.998, 0.001, 0.021, 0.999, 0.012, 0.001, 1, 0.247, 1, 1, 0.233, 0, 0.999, 1, 0, 0, 0, 0, 0.001, 1, 0.995, 1, 0.975, 0.007, 0, 0.34, 0.157, 0.998, 0, 0, 0, 0, 1, 0, 0.325, 0, 0.011, 0.246, 0.895, 0, 0.005, 1, 0.12, 0.037, 0, 0.998, 0.992, 0.834, 1, 0.273, 0, 0.998, 0, 0.999, 1, 0.001, 0, 0.001, 0.987, 0.446, 1, 0, 0.989, 0.964, 0.996, 0, 0, 0, 1, 0, 0, 0.998, 0, 1, 0, 0, 0.008, 0, 0, 0.001, 0.001, 0.002, 1, 0.001, 0, 1, 0.008, 0, 0, 1, 0, 0.986, 0.008, 0.006, 0, 0.028, 1, 0, 0, 0, 0.991, 0.128, 1, 0, 0, 0.002, 0.98, 1, 0.004, 1, 0.008, 0.001, 0.996, 0, 0, 0.006, 0, 0, 0, 1, 1, 0.999, 0, 0, 0.001, 0, 0, 0, 0, 0, 1, 0, 0.004, 0.002, 0, 1, 0.037, 1, 0.005, 1, 0.068, 0.001, 0.002, 0, 1, 0.981, 1, 0.009, 0, 0, 0.002, 0.925, 0.998, 1, 0.042, 0, 0.114, 0, 0, 0.725, 0.003, 0.027, 0, 0.989, 1, 0.002, 0, 0.016, 0, 0.009, 0, 0, 0.001, 0, 1, 0.189, 0.006, 0.014)
)

gaussian_sample_with_probs <- gaussian_sample_with_probs %>%
    mutate(prob_cluster2 = 1-prob_cluster1)
glimpse(gaussian_sample_with_probs)
## Observations: 500
## Variables: 3
## $ x             <dbl> 54.5, 7.7, 55.9, 27.9, 4.6, 59.9, 6.4, 60.5, 32....
## $ prob_cluster1 <dbl> 0.000, 1.000, 0.000, 0.552, 1.000, 0.000, 1.000,...
## $ prob_cluster2 <dbl> 1.000, 0.000, 1.000, 0.448, 0.000, 1.000, 0.000,...
# Estimation of the means
means_estimates <- gaussian_sample_with_probs %>% 
    summarise(mean_cluster1= sum(x*prob_cluster1)/sum(prob_cluster1),
              mean_cluster2 = sum(x*prob_cluster2)/sum(prob_cluster2)
              )
means_estimates
##   mean_cluster1 mean_cluster2
## 1      10.39535      49.46501
# Estimation of the proportions
props_estimates <- gaussian_sample_with_probs %>% 
    summarise(props_cluster1 = mean(prob_cluster1),
              props_cluster2 = mean(prob_cluster2)
              )
props_estimates
##   props_cluster1 props_cluster2
## 1        0.33148        0.66852
# Transform to a vector
means_estimates <- as.numeric(means_estimates)

# Plot histogram with means estimates
ggplot(gaussian_sample_with_probs) + geom_histogram(aes(x = x), bins = 100) +
    geom_vline(xintercept = means_estimates)

gaussian_sample <- data.frame(
    x=c(6.4, 5.9, 57.8, 52.6, 54.3, 52.3, 4.4, 49.1, -4, 12.7, 19.8, 51.8, 35.4, 17.1, 38.8, 44.1, 45.6, 7.9, 57.7, 51.1, 14.1, 36.6, 51.6, 4.1, -1.8, 55.1, 52.4, 54.4, 47.9, 36.6, 53.9, 15, 68.8, 8.3, 40.8, 39.3, 37.1, 12.7, 54.6, 34.1, 24.9, 58.5, 50.8, 48.6, 60, 52.1, 61.5, 6.9, 63, 63.5, 54.1, 37.7, 52.6, 49.1, 53.7, 13.4, 23.6, 45.5, 33.4, 46.4, 46.6, 56.1, 37.8, 44.1, 62.4, 12, 54.4, 31.6, -1, 9.4, 16, 53.4, 71.1, 8.9, 64.4, 55.9, 50.5, 57.2, 45.9, 18.5, 53.9, 12.5, 12.2, 1.5, 0.3, 40.1, 13.9, 53.2, 12.1, 57.2, 2.3, -2.6, 2.7, 59.6, 3, 10.3, 66.9, 57.3, 57.6, 9.1, 43.8, 51.1, 7.7, 13.4, 46.3, 57.5, 0.2, 1.9, 43.8, 53.9, 9.3, 45.5, 15.4, -3.2, -1.2, 40.5, 1.9, 14.5, -2, 3.4, 54.1, 2.9, 58.2, 49.5, 49.1, 60.2, 45.3, 59.7, 38, 22.4, 42.6, 53.6, 7.3, 43.9, 2.8, 66.5, 56.5, 44.4, 53.5, 40.6, 57.1, 43.8, -3.1, 47.3, 42.5, 50.8, -12, -12, 15.2, 43.8, 57.3, 32.2, 61.1, 15.1, 5.8, 24.7, 51.5, 7.7, -5.1, 63.1, 50.1, 39.9, 38.7, -5.2, 50.3, 49.1, 58.1, 31.3, 54.6, 39.1, 4.4, 60.5, 45.6, 59.7, 39.5, 60.6, 42.8, 49.5, 12.9, 47.2, 50, 11.4, 50.9, 57.3, 46.7, 35.6, 38.8, 56, -5.7, 50.5, 21.2, 45.9, 60.7, 22.1, 46.7, 12.5, 55.2, 48.4, 36.6, 54, 47, 50.3, 51.7, 11, 56, 42.4, 61.8, 45.6, 60.5, 40.6, 8.8, 21, 5.6, 68.2, 21.3, 11.5, 47.2, 26.4, 35.8, 25.4, 19.6, 56, 9.1, 63.4, 48.5, 3.2, 57.1, 52.7, 11.3, 16.3, 49, 46.5, 12.4, 9.6, 45.5, 55.3, 72.9, 8.1, -3.8, 53.8, 34.1, 45.7, 56.3, 44, 23.4, 57.2, 0.5, 33.2, 63.4, 37.3, 57.3, 52.7, 9.7, 51.9, 39.4, 63.7, 23.3, 39.9, -0.5, 41.6, 11.3, 48, 38.2, 54.2, 41.3, 30.6, 55.2, 48.9, 34.4, 16.2, 45.7, 10.1, 42.7, 12.2, 39.5, 14.1, 64.9, 53.1, 50.4, 47, 58.5, 50.8, 43.9, 56.8, 12.6, 44.5, 54.6, 8.9, 15.5, 50.2, 4.8, 52.8, 14.4, 33.7, 5.4, -0.2, 19.8, 51, 59.4, -8.2, 10.4, 47.8, 31.2, 41.4, 9.4, -3.2, 21.1, 44.7, 22.9, 11.5, 49.6, 26.7, 11.5, 35.2, 9.4, 44.8, 63.1, 8.5, 21, 30.9, 16.1, 54.4, 53.4, 9.7, 49.8, 45.6, -3, 53, 43.4, 43.4, 43.9, 56.6, 33.5, 55.1, 54.4, 62.8, 37.9, 35.1, 8.6, 7.1, 46.1, 6.1, 27, -9.9, 6.4, 44.6, 49, 46, 42.4, 9.5, 47.1, 51.3, -4.7, 14, 64.8, 38, 33.6, -0.4, 53.5, 40.3, 47.2, 58.5, 45.4, 2.5, 52.9, 47.4, 56.1, 17.7, 3.9, 30.7, 44.6, 42.4, 55.4, 47.1, 11.5, 50.7, 47.6, 11.3, 45.1, 44.2, 46.6, 36.9, 47.4, 54.6, -2, 50.7, 63.6, 58.9, 7.6, -3.1, 31.1, 44.9, 55.7, 16.6, 64.3, 27.1, 23, 48.7, -0.8, 23.6, 72.8, 11.9, 57.3, 25.4, 47.1, 9.4, 57.6, 39.6, 25.3, 31.2, 52.4, 51.1, 1.6, 76.5, 50.7, 34.2, 7.6, 25.4, 11.7, 53.5, 17.5, 53.7, 61.2, 49.9, 48.8, 40.8, 61.2, 16.4, 48.6, 7.5, -2, 64.2, 26.2, 11.2, 3.2, -4.3, 37.9, 47.7, 26.3, 58, 66.9, 59.1, 35.8, 14.2, 53, 60.3, 63.3, 53.6, 47.6, 57.1, 37, 47.6, 61.6, 52.7, 0.8, 50.5, 48.1, -3.4, 53.6, 35.7, 49.8, 2.7, 59.9, 36.5, 63.6, 53.3, 3.8, 20.2, 19.7, 20.7, 45.6, 39.8, 37.2, 38.6, 12.4, 56.3, 59.6, 10.5, 11, -6.8, 58.8, 49.5, -3.6, 51.1, 53.1, 46, 57.9, 15.2, -2.3, 22.9, 32.8, 37.6, 52, 77.5, 2.2, 9.5, 40.4, 48.5, 27.2, 37.4)
)
str(gaussian_sample)
## 'data.frame':    500 obs. of  1 variable:
##  $ x: num  6.4 5.9 57.8 52.6 54.3 52.3 4.4 49.1 -4 12.7 ...
# Create data frame with probabilities
gaussian_sample_with_probs <- gaussian_sample %>% 
    mutate(prob_from_cluster1 = 0.35 * dnorm(x, mean = 10, sd = 10),
           prob_from_cluster2 = 0.65 * dnorm(x, mean = 50, sd = 10),
           prob_cluster1 = prob_from_cluster1/(prob_from_cluster1 + prob_from_cluster2),
           prob_cluster2 = prob_from_cluster2/(prob_from_cluster1 + prob_from_cluster2)) %>%
    select(x, prob_cluster1, prob_cluster2) 
head(gaussian_sample_with_probs)
##      x prob_cluster1 prob_cluster2
## 1  6.4  9.998524e-01  0.0001475847
## 2  5.9  9.998792e-01  0.0001208354
## 3 57.8  7.976210e-06  0.9999920238
## 4 52.6  6.384176e-05  0.9999361582
## 5 54.3  3.234434e-05  0.9999676557
## 6 52.3  7.198080e-05  0.9999280192
expectation <- function(data, means, proportions, sds){
  # Estimate the probabilities
  exp_data <- data %>% 
      mutate(prob_from_cluster1 = proportions[1] * dnorm(x, mean = means[1], sd = sds[1]),
             prob_from_cluster2 = proportions[2] * dnorm(x, mean = means[2], sd = sds[2]),
             prob_cluster1 = prob_from_cluster1/(prob_from_cluster1 + prob_from_cluster2),
             prob_cluster2 = prob_from_cluster2/(prob_from_cluster1 + prob_from_cluster2)) %>%
      select(x, prob_cluster1, prob_cluster2)
    # Return data with probabilities
  return(exp_data)
}

maximization <- function(data_with_probs){
    means_estimates <- data_with_probs %>%
        summarise(mean_1 = sum(x * prob_cluster1) / sum(prob_cluster1),
                  mean_2 = sum(x * prob_cluster2) / sum(prob_cluster2)
                  ) %>% 
        as.numeric()
    props_estimates <- data_with_probs %>% 
        summarise(proportion_1 = mean(prob_cluster1), proportion_2 = 1 - proportion_1) %>% 
        as.numeric()
    list(means_estimates, props_estimates)   
}


means_init <- c(0, 100)
props_init <- c(0.5, 0.5)

# Iterative process
for(i in 1:10){
    new_values <- maximization(expectation(gaussian_sample, means_init, props_init, c(10, 10)))
    means_init <- new_values[[1]]
    props_init <- new_values[[2]]
    cat(c(i, means_init, props_init), "\n")
}
## 1 25.28863 56.90005 0.6797875 0.3202125 
## 2 20.01129 53.44814 0.539439 0.460561 
## 3 14.77156 51.48322 0.4377961 0.5622039 
## 4 11.62146 50.28191 0.3846544 0.6153456 
## 5 10.34764 49.72052 0.363436 0.636564 
## 6 9.918957 49.49888 0.355935 0.644065 
## 7 9.777305 49.41932 0.3533705 0.6466295 
## 8 9.730017 49.39192 0.3525025 0.6474975 
## 9 9.714139 49.38262 0.3522096 0.6477904 
## 10 9.708796 49.37948 0.3521109 0.6478891
fun_gaussian <- function(x, mean, proportion){
    proportion * dnorm(x, mean, sd = 10)
}

means_iter10 <- means_init
props_iter10 <- props_init

gaussian_sample %>% ggplot() + 
    geom_histogram(aes(x = x, y = ..density..), bins = 200) +
    stat_function(geom = "line", fun = fun_gaussian, 
                  args = list(mean = means_iter10[1], proportion = props_iter10[1])
                  ) +
    stat_function(geom = "line", fun = fun_gaussian,
                  args = list(mean = means_iter10[2], proportion = props_iter10[2])
                  )


Chapter 3 - Mixture of Gaussians with flexmix

Univariate Gaussian Mixture Models:

  • Gaussian mixture models are formed by Gaussian distributions, which can have many potential parameters
    • Simplest version is the univariate Gaussian, such as the BMI dataset with no labels for gender
  • Example of using the gender dataset for segmenting assuming that the data are not labeled by gender
    • Weight should be a Gaussian - continuous, not linked to integer values, etc.
    • Histogram looks like two Gaussians, so begin with the assumption of 2 univariate Gaussians with a resulting 2 segments
    • Parameters can initially be estimated with a baseline mean, sd, and proportion (6 total parameters)
    • The EM algorithm, implemented in flexmix, can then help to simplify the calculations

Univariate Gaussian Mixture Models with flexmix:

  • Can begin by checking what the most suitable distributions might be
    • gender %>% ggplot(aes(x = Weight)) + geom_histogram(bins = 100)
    • Univariate Gaussian with 2 clusters
  • Can use the flexmix::flexmix(formula, data, k, models, control, …) to make the estimates
    • formula - describes the model to be fit (often variable ~ 1)
    • data - data frame
    • k - number of clusters
    • models - distribution to be considered, such as FLXMCnorm1 for the univariate Gaussian
    • control - maximum iterations and tolerance
  • Example of fitting to a dataset using flexmix
    • fit_mixture <- flexmix(Weight ~ 1, data = gender, k = 2, model = FLXMCnorm1(), control = list(tol = 1e-15, verbose = 1, iter = 1e4))
    • proportions <- prior(fit_mixture) # proportions from the model
    • parameters(fit_mixture) # all the parameters
    • comp_1 <- parameters(fit_mixture, component = 1) # just the parameters for component 1
    • posterior(fit_mixture) %>% head() # probability of belonging to each cluster by observation
    • posterior(fit_mixture) %>% head() # assignment to the cluster with maximum probability
    • table(gender$Gender, clusters(fit_mixture))

Bivariate Gaussian Mixture Models with flexmix:

  • May want to use additional variables to improve the clustering - for example, using both height and weight from the gender dataset
    • Bivariate Gaussian with 2 clusters, and needing to estimate additional means and standard deviations (which need to also be between the variables)
  • The flexmix library implements the Bivariate Gaussian distribution, which is conceptually like
    • There would be two means - variable 1 and variable 2
    • There would be a 2x2 covariance matrix - sd1, sd2, cov(1, 2), cov(1, 2) - really, three terms since the off-diagonals will be equal

Bivariate Gaussian Mixture Models with flexmix:

  • Example of a covariance matrix without cross-terms
    • fit_without_cov <- flexmix(cbind(Weight, BMI) ~ 1, k = 2, data = gender, model = FLXMCmvnorm(diag = TRUE), control = list(tolerance = 1e-15, iter.max = 1000)) # cbind() is because there are two variables; diag=TRUE means no covariance
    • proportions <- prior(fit_without_cov)
    • parameters(fit_without_cov)
    • comp_1 <- parameters(fit_without_corr, component=1)
    • comp_2 <- parameters(fit_without_corr, component=2)
    • mean_comp_1 <- comp_1[1:2]
    • mean_comp_2 <- comp_2[1:2]
  • Can then visualize the resulting clusters
    • library(ellipse)
    • ellipse_comp_1 <- ellipse(x = covariance_comp_1, centre = mean_comp_1, npoints = nrow(gender))
    • ellipse_comp_2 <- ellipse(x = covariance_comp_2, centre = mean_comp_2, npoints = nrow(gender))
    • gender %>%
    • ggplot(aes(x = Weight, y = BMI)) + geom_point() +
    •   geom_path(data = data.frame(ellipse_comp_1), aes(x=x,y=y), col = "red") +  
    •   geom_path(data = data.frame(ellipse_comp_2), aes(x=x,y=y), col = "blue"  
  • Need to include joint variability to improve the modeling
    • fit_with_cov <- flexmix(cbind(Weight, BMI) ~ 1, k = 2, data = gender, model = FLXMCmvnorm(diag = FALSE), control = list(tolerance = 1e-15, iter.max = 1000)) # cbind() is because there are two variables; diag=FALSE means covariance

Example code includes:

xExample <- c(7.3, 58.7, 9.7, 16.9, 6.3, 35.1, 33.5, 61.3, 28.3, 24.3, 58.6, 13.1, 58.7, 34, 29.1, 46.4, 54.6, 5.9, 30.6, 27.9, 27.5, -5.3, 37.6, 9.1, 44.5, 57.5, 30.5, 5, 51.9, 33.6, 37.4, 28.8, 47.9, 5.4, 64.1, 45.1, 41, 36.3, 28.2, 33.8, 9.8, 57.4, 48.4, 58.3, 27.7, 38.4, 36.4, 66.9, 30.7, 34.3, 25.9, 48.5, 52, 0.3, 45.3, 31.9, 21.6, 36.6, 29, 13.2, 41.5, 8.2, 46.6, 30.6, 48.6, 5.6, 39.3, 30.5, 34.2, 61.5, 4.2, 71.3, 42.5, 32.7, 54.4, 19.2, 13.3, 40.3, 72, 21.8, 49.5, 38.7, 9.6, 49.6, 32, 30.9, 28.6, 30.1, 29.8, 67.9, 60.8, 55, 34.6, 32.8, 11.9, 50.5, 32.1, 13.7, 48.6, 32.6, 9.1, 27.6, 35.6, 28.3, 15.1, 54.7, 30.8, 22.2, 27.5, 49.3, 56, 26.1, 57.2, 46.4, 50.3, 43.6, 51.8, 47.5, 15.5, 60.2, 63.6, 45.3, 14.1, 42.1, 31.4, 42.4, 61.7, 60.1, 27.7, 55.9, 3.3, 18.7, 58.1, 46, 14, 41.7, 28.9, 29.1, 56.9, 32.3, -0.8, 29.4, 27.3, 33.5, 39.1, 13.9, 28.7, 29.4, 10.3, 44.3, 57.1, 76, 49.4, 44.9, 23.2, 53.9, 33.6, 32.7, 30, 57, 63.6, 32.9, 8.6, 26.5, 26, 53.3, 40.8, 30.1, 10.5, 47.2, 30.2, 49.3, 52.4, 48.8, 51.4, 40.7, 33.8, 45.7, 28.1, 13.2, 28.4, 31.7, 30, 29.6, 49.5, 35, 62, 51.9, 39, 15.4, 59.1, 54.8, 9.2, 9.7, 35.4, 32.9, 31.3, 30.4, 64.4, 63.4, 32.9, 40.6, 37.5, 52.3, 35.3, 8.1, 6.4, 26.2, 29.2, 29.7, 27.8, 35.2, 34.1, 29.8, 49, 65.6, -1.1, 28.6, 33.7, 48.1, 45.7, 30.3, 32.7, 64.5, 29.8, 52.5, 48.4, 48.8, 26.4, 37.4, 33.2, 46.1, 29.5, -0.9, 49.8, 34.1, 48.9, 12.5, 36.6, 22.1, 57.3, 9.5, 9.4, 58.5, 50.2, 45.3, 25.3, 27.4, 4.5, 58.5, 63.4, 48.7, 42.6, 33, 47.9, 30.3, 54.9, 7.9, 50.2, 11.2, 59.7, 46.5, 57.5, 26.9, 28.5, 29.7, 52.5, 16.9, 29.8, 28.6, 31.2, 65.3, 1.7, 31.4, 52.5, 5.1, 66.1, 51.5, 9.5, 9.8, 41.6, 0.3, 10.4, 15.5, 34.8, 27.5, 43.6, 31.4, 46.3, 4.6, 45.8, 49.2, 10.7, 48.1, 7.3, 33.4, 10.7, 53.4, 28.9, 51.1, 52.4, 55.9, 56.8, 47.2, 46.8, 30.8, 60.3, 53.6, 30.9, 70.8, 11.2, 7.5, 55.8, 14.3, 25.8, 14.5, 30.9, 60.8, 26.8, 16.5, 31.4, 26.6, 10.6, 53.4, 33.1, 33.1, 46.3, 8.2, 56, 14.1, 25.5, 59.6, 61.9, 58.6, 63.1, 47.7, 30.5, 42.4, 56.2, 17, 13.4, 34.4, 1.1, 18.4, 63.9, 38.6, 15, 30.1, 23.9, 5.9, 53.8, 18.2, 22.7, 45.7, 29.2, 8.4, 52.5, 42, 28.7, 61.7, 35.4, 32.5, 5.5, 6.8, 60.1, 29.4, 31.5, 2.3, 28.3, 29.6, 34.9, 33.2, 28.9, 33.9, 51, 35.4, 52.3, 60, 27.1, 24.7, 57.7, 32.7, 52.5, 66.3, 37.8, 46.3, 38.1, 30.6, 55.6, 44.9, 28.4, 28.9, 19, 7.7, 9.4, 36, 49.9, 42.2, 28.2, 11.5, 52.4, 46.3, 52.4, 27.4, 15.6, 62.3, 51.7, 41.6, 6.2, 10.5, 14.7, 30.4, 23.9, 58.7, 36.1, 47.6, 31.2, 29.1, 60.1, 18, 30, 56.5, 42.7, 27.1, 45.5, 36.6, 46.4, 25.9, 15.4, 31.6, 3.3, 33.6, 63.3, 57.1, 32.3, 11.8, 32.9, 47.2, 31.2, 49.3, 61.7, 11.5, 9.7, 49.6, 45.7, 16.1, 27.4, 22.8, 8.5, 56.2, 26, 45.7, 29, 34.6, 29.4, 3.9, 45.7, 31.7, 52.6, 40.2, 35.5, 5.8, 56.4, 49.5, 30.6, 40.2, 20.8, 43.9, 32.1, 40.8, 45.6, 32.8, 7.4, 27.5, 29.4, 50.8, 43.9, 36.8, 5.5, 61.5, 41.5, 47.5, 13.9, 30.1, 67.3, 27.1, 50.8, 37.4, 28, 25, 37.1, 49.3, 25.3, 26.9, 34.9, 51.8, 33.9, 34.7, 44.2, 10.1, 71.3, 47.5, 23.4, 45.7, 49.4, 32.6, 6.9, 67.8, 56.8, 41.9, 50.7, 31.5, 55, 14.2, 34.8, 26.2, 25.8, 64, 63.8, 56.4, 42.1, 29.5, 49.4, 30.2, 16.2, 30, -0.2, 30.7, 29.6, 57, 41.5, 6.4, 9.7, 47.1, 19.4, 39.8)
xExample <- c(xExample, 32.9, 53.6, 8.4, 32.8, 63.1, 58.4, 7.5, 26, 41.8, 29, 36.9, 41.5, 39.5, 14.1, 27.4, 14.9, 48.4, 34.8, 72.8, 36.9, 27.8, 27.6, 6.1, 43.8, 36.9, 58.5, 55.1, 45.2, 2.6, 20.4, 59, 60.6, 57.7, 29.8, 60.2, 36.9, 29, 28, 46.5, 55, 29.6, 52.6, 38, 45.3, 5.7, 44.8, 35.3, 56.1, 30.3, 32.4, 56.9, 30.8, 44.8, 62.8, 46.1, 57.2, 50.5, 46.4, 37.6, 29.9, 8.6, 35.5, 47.4, 27.2, 36.4, 33.1, 29.4, 25.8, 46, 27.6, 45.7, 32.3, 12.8, 49.8, 13.7, 65.3, 48.5, 39.6, 4, 32.1, 49.6, 44, 74.5, 31, 52.6, 33.3, 56.8, 11.4, 33.7, 34.3, 25.8, 39.8, 7.3, 33.6, 7.9, 49.6, 52.6, 36.5, 43, 14.7, 43.5, 37, 50.8, 46.5, 46.9, 25.4, 32.7, 48.4, 40.3, 45.9, 51.3, 24, 48.3, 39.5, 21.2, 48.1, 56.9, 32.3, 10.2, 9.3, 40.3, 52.8, 34.5, 32.4, 30.1, 10.8, -3.8, 30.4, 58.2, 57.3, 48.9, 36.1, 46.2, 69, 67.8, 58.5, 41.9, 29.6, 51.7, 39.4, 50.8, 29.2, 56.1, 54.4, 17.2, 57.5, 54.1, 48.6, -0.9, 56.3, 27.7, 58.8, 57, 44.1, 6.3, 4.1, 35.9, 60.2, 44.1, 53.9, 33.3, 35.4, 32.1, 56, 56.8, 30.1, 43.1, 64.6, 27.7, 30.7, 53, 66, 29.1, 45, 12.3, 41.3, 54.7, 45.3, 13.3, 9.7, -2, 29.1, 29.5, 31.3, 29.2, 13.8, 26.7, 7.4, 36.8, 42.6, 54.7, 51.3, 42.6, 18, 34, 44.1, 53.6, 44.7, 28.9, 64.9, 60, 66.6, 32.9, 15.5, 37.6, 8.3, 28.5, 16.2, 39.7, 25.9, 8.8, 30.9, 9.9, 39.3, 66.4, 62.4, 53.8, 9.3, 44.7, 50.4, 57.8, 29, 50.1, 28.5, 62.9, 16.3, 54, 45.4, 60.6, 9, 7.7, 64.2, 54.4, 53.3, 45.5, 38, 5.2, 61.7, 10.8, 4.3, 24.8, 26.5, 32.2, 4.5, 49.3, 3.9, 39.6, 26.8, 36.3, 65.1, 59.6, 61.3, 30.1, 65.5, 55.8, 48.2, 49.8, 11.2, 64.2, 29, 44.6, 59.9, 12.6, 51.8, 14.5, 28.8, 49.8, 30.4, 42.7, 2.8, 31.1, 29.2, 27.4, 49.9, 28.2, 59.5, 28.7, 9.4, 30.2, 33.3, 30, 26, 65.1, 55.9, 30.5, 61.1, 50.3, 31.3, 58.2, 41.3, 33.4, 14.8, 51.2, 40.8, 34.1, 33.7, 29.4, 56, 26.4, 30.7, 55.1, 49.7, 37.7, 56.9, 38.5, 28.8, 50.3, 45.7, 13.2, 32.8, 30.5, 30.6, 61.5, 57.7, 33.6, 24.6, 53.9, 36.1, 37.4, 55.5, 27.4, 44.2, 15.4, 56.3, 28.1, 28.8, 67.6, 17.7, 48.5, 57.5, 33.7, 12.9, 19.5, 30.6, 56.8, 75.4, 26, 32.3, 28.3, 10.7, 9, 66.5, 51.6, 30.2, 46, 44.1, 53, 33.9, 28.4, 53.1, 42.3, 55.2, 42.4, 9.4, 36.3, 26.6, 41.2, 33, 42.1, 27, 25.4, 53.8, 56.7, 22.2, 29.5, 30.9, 9.3, 30.4, 48.1, 30.9, 28.4, 38.6, 28.8, 52, 16.5, 64.3, 56.1, 51.4, 50.2, 30.1, 67.3, 62.3, 12.9, 27.9, 38.9, 29.3, 17.4, 30, 62.5, 40.5, 48, 31.9, 54.7, 27.4, 28.2, 46.6, 14, 61.9, 59.4, 65.4, 30.2, 28.9, 35.4, 55.8, 51.4, 47.8, 34, 56.2, 26.5, 30.2, 8.4, 10.9, 63.9, 41.9, 31.3, 52.8, 36, 45.4, -2, 57.3, 80.3, 41, 13.8, 31.9, 33.8, 48.5, 16.7, 29.5, 6.7, 42.1, 32.2, 45.7, 18.9, 30.5, 30.9, 40.2, 14.6, 41.2, 27, 6.1, 34.9, 57.5, 30.1, 56.6, 62.4, 11.5, 25.7, 14.8, 28.2, 43.5, 37.7, 32.1, 44.4, 56.2, 7.6, 29.4, 63.4, 53, 14.6, 50.1, 62.6, 29.3, 33.5, 52.7)
mix_assign <- c(1, 2, 1, 1, 1, 2, 2, 2, 3, 3, 2, 1, 2, 2, 3, 2, 2, 1, 3, 3, 3, 1, 2, 1, 2, 2, 3, 1, 2, 3, 2, 3, 2, 1, 2, 2, 2, 2, 3, 3, 1, 2, 2, 2, 3, 3, 3, 2, 3, 3, 3, 2, 2, 1, 2, 3, 1, 3, 3, 1, 2, 1, 2, 3, 2, 1, 2, 3, 3, 2, 1, 2, 2, 3, 2, 1, 1, 2, 2, 3, 2, 2, 1, 2, 3, 2, 2, 3, 3, 2, 2, 2, 3, 3, 1, 2, 3, 1, 2, 2, 1, 3, 2, 3, 1, 2, 3, 1, 3, 2, 2, 3, 2, 2, 2, 2, 2, 2, 1, 2, 2, 2, 1, 2, 3, 2, 2, 2, 3, 2, 1, 1, 2, 2, 1, 2, 3, 3, 2, 3, 1, 3, 3, 2, 2, 1, 3, 3, 1, 2, 2, 2, 2, 2, 1, 2, 3, 2, 2, 2, 2, 3, 1, 3, 3, 2, 2, 3, 1, 2, 3, 2, 2, 2, 2, 2, 3, 2, 3, 1, 3, 3, 3, 3, 2, 3, 2, 2, 2, 1, 2, 2, 1, 1, 3, 3, 3, 3, 2, 2, 3, 2, 3, 2, 2, 1, 1, 3, 3, 3, 3, 3, 3, 2, 2, 2, 1, 3, 3, 2, 2, 3, 3, 2, 3, 2, 2, 2, 3, 2, 3, 2, 3, 1, 2, 3, 2, 1, 3, 3, 2, 1, 1, 2, 2, 2, 2, 3, 1, 2, 2, 2, 2, 2, 2, 3, 2, 1, 2, 1, 2, 2, 2, 3, 3, 3, 2, 1, 3, 3, 2, 2, 1, 3, 2, 1, 2, 2, 1, 1, 2, 1, 1, 1, 3, 3, 2, 3, 2, 1, 2, 2, 1, 2, 1, 3, 1, 2, 3, 2, 2, 2, 2, 2, 2, 3, 2, 2, 3, 2, 1, 1, 2, 1, 3, 1, 3, 2, 3, 1, 3, 3, 1, 2, 3, 2, 2, 1, 2, 1, 3, 2, 2, 2, 2, 2, 3, 2, 2, 1, 1, 3, 1, 1, 2, 3, 1, 3, 3, 1, 2, 1, 2, 2, 3, 1, 2, 2, 3, 2, 2, 3, 1, 1, 2, 3, 2, 1, 3, 3, 2, 3, 3, 3, 2, 3, 2, 2, 3, 3, 2, 3, 2, 2, 2, 2, 2, 3, 2, 2, 3, 3, 1, 1, 1, 2, 2, 2, 3, 1, 2, 2, 2, 3, 1, 2, 2, 2, 1, 1, 1, 3, 3, 2, 3, 2, 3, 2, 2, 1, 3, 2, 2, 3, 2, 3, 2, 3, 1, 3, 1, 3, 2, 2, 3, 1, 3, 2, 3, 2, 2, 1, 1, 2, 2, 1, 3, 3, 1, 2, 3, 2, 3, 2, 3, 1, 2, 2, 2, 2, 3, 1, 2, 2, 3, 2, 2, 2, 3, 2, 2, 3, 1, 3, 3, 2, 2, 2, 1, 2, 2, 2, 1, 3, 2, 3, 2, 2, 3, 3, 2, 2, 3, 3, 3, 2, 3, 3, 2, 1, 2, 2, 3, 2, 2, 3, 1, 2, 2, 2, 2, 3, 2, 1, 3, 3, 2, 2, 2, 2, 2, 3, 2, 3, 1, 3, 1, 3, 3, 2, 2, 1, 1, 2, 2, 2, 3, 2, 1, 3, 2, 2, 1, 3, 2, 3, 2, 2, 2, 1)
mix_assign <- c(mix_assign, 3, 1, 2, 3, 2, 3, 3, 3, 1, 2, 3, 2, 2, 2, 1, 2, 2, 2, 2, 3, 2, 3, 3, 3, 2, 2, 2, 2, 2, 2, 1, 2, 2, 2, 3, 3, 2, 3, 2, 2, 2, 2, 2, 2, 2, 3, 1, 3, 2, 3, 2, 3, 3, 3, 2, 3, 2, 3, 1, 2, 1, 2, 2, 2, 1, 3, 2, 2, 2, 3, 2, 3, 2, 1, 3, 2, 3, 2, 1, 2, 1, 2, 2, 3, 2, 1, 2, 3, 2, 2, 2, 3, 3, 2, 2, 2, 2, 3, 2, 2, 1, 2, 2, 3, 1, 1, 2, 2, 3, 3, 3, 1, 1, 3, 2, 2, 2, 3, 2, 2, 2, 2, 2, 3, 2, 2, 2, 3, 2, 2, 1, 2, 2, 2, 1, 2, 3, 2, 2, 2, 1, 1, 3, 2, 2, 2, 3, 3, 3, 2, 2, 3, 2, 2, 3, 3, 2, 2, 3, 2, 1, 2, 2, 2, 1, 1, 1, 3, 3, 3, 3, 1, 3, 1, 2, 2, 2, 2, 2, 1, 3, 2, 2, 2, 3, 2, 2, 2, 3, 1, 2, 1, 3, 1, 2, 3, 1, 3, 1, 3, 2, 2, 2, 1, 2, 2, 2, 3, 2, 3, 2, 1, 2, 2, 2, 1, 1, 2, 2, 2, 2, 2, 1, 2, 1, 1, 3, 3, 3, 1, 2, 1, 2, 3, 3, 2, 2, 2, 3, 2, 2, 2, 2, 1, 2, 3, 2, 2, 1, 2, 1, 3, 2, 3, 2, 1, 3, 3, 3, 2, 3, 2, 3, 1, 2, 2, 3, 3, 2, 2, 3, 2, 2, 3, 2, 2, 3, 1, 2, 2, 3, 3, 3, 2, 3, 2, 2, 2, 2, 2, 2, 3, 2, 2, 1, 3, 3, 3, 2, 2, 3, 3, 2, 2, 2, 2, 3, 2, 1, 2, 3, 3, 2, 1, 2, 2, 2, 1, 1, 3, 2, 2, 3, 3, 3, 1, 1, 2, 2, 3, 2, 2, 2, 3, 3, 2, 2, 2, 2, 1, 3, 3, 2, 3, 2, 3, 3, 2, 2, 2, 3, 2, 1, 3, 2, 3, 3, 2, 3, 2, 1, 2, 2, 2, 2, 3, 2, 2, 1, 3, 2, 2, 1, 3, 2, 2, 2, 3, 2, 3, 3, 2, 1, 2, 2, 2, 3, 3, 2, 2, 2, 2, 2, 2, 3, 3, 1, 1, 2, 2, 3, 2, 2, 2, 1, 2, 2, 2, 1, 3, 3, 2, 1, 3, 1, 2, 3, 2, 1, 2, 3, 2, 1, 2, 3, 1, 3, 2, 3, 2, 2, 1, 3, 1, 3, 2, 2, 3, 2, 2, 1, 3, 2, 2, 2, 2, 2, 3, 3, 2)

mix_example <- data.frame(x=xExample, assignment=mix_assign)
str(mix_example)
## 'data.frame':    1000 obs. of  2 variables:
##  $ x         : num  7.3 58.7 9.7 16.9 6.3 35.1 33.5 61.3 28.3 24.3 ...
##  $ assignment: num  1 2 1 1 1 2 2 2 3 3 ...
library(flexmix)
## Loading required package: lattice
set.seed(1515)

# If wanting verbose output
# control = list(tolerance = 1e-15, verbose = 1, iter = 1e4)
fit_mix_example <- flexmix(x ~ 1, data = mix_example, k = 3, model = FLXMCnorm1(), 
                           control = list(tolerance = 1e-15, iter = 1e4)
                           )

proportions <- prior(fit_mix_example)
comp_1 <- parameters(fit_mix_example, component = 1)
comp_2 <- parameters(fit_mix_example, component = 2)
comp_3 <- parameters(fit_mix_example, component = 3)


fun_prop <- function(x, mean, sd, proportion){
    proportion * dnorm(x = x, mean = mean, sd = sd)
}

ggplot(mix_example) + 
    geom_histogram(aes(x = x, y = ..density..)) + 
    stat_function(geom = "line", fun = fun_prop, 
                  args = list(mean = comp_1[1], sd = comp_1[2], proportion = proportions[1])
                  ) +
    stat_function(geom = "line", fun = fun_prop, 
                  args = list(mean = comp_2[1], sd = comp_2[2], proportion = proportions[2])
                  ) +
    stat_function(geom = "line", fun = fun_prop, 
                  args = list(mean = comp_3[1], sd = comp_3[2], proportion = proportions[3])
                  )
## `stat_bin()` using `bins = 30`. Pick better value with `binwidth`.

# Explore the first assignments
head(clusters(fit_mix_example))
## [1] 2 1 2 2 2 3
# Explore the first real labels
head(mix_example$assignment)
## [1] 1 2 1 1 1 2
# Create frequency table
table(mix_example$assignment, clusters(fit_mix_example))
##    
##       1   2   3
##   1   0 184   1
##   2 464   5  37
##   3  18   2 289
genderData <- readr::read_csv("./RInputFiles/gender.csv")
## Parsed with column specification:
## cols(
##   Gender = col_character(),
##   Height = col_double(),
##   Weight = col_double(),
##   BMI = col_double(),
##   probability = col_double()
## )
str(genderData)
## Classes 'tbl_df', 'tbl' and 'data.frame':    10000 obs. of  5 variables:
##  $ Gender     : chr  "Male" "Male" "Male" "Male" ...
##  $ Height     : num  73.8 68.8 74.1 71.7 69.9 ...
##  $ Weight     : num  242 162 213 220 206 ...
##  $ BMI        : num  0.0444 0.0343 0.0387 0.0428 0.0423 ...
##  $ probability: num  5.78e-06 6.06e-01 2.63e-05 3.63e-04 4.61e-03 ...
##  - attr(*, "spec")=List of 2
##   ..$ cols   :List of 5
##   .. ..$ Gender     : list()
##   .. .. ..- attr(*, "class")= chr  "collector_character" "collector"
##   .. ..$ Height     : list()
##   .. .. ..- attr(*, "class")= chr  "collector_double" "collector"
##   .. ..$ Weight     : list()
##   .. .. ..- attr(*, "class")= chr  "collector_double" "collector"
##   .. ..$ BMI        : list()
##   .. .. ..- attr(*, "class")= chr  "collector_double" "collector"
##   .. ..$ probability: list()
##   .. .. ..- attr(*, "class")= chr  "collector_double" "collector"
##   ..$ default: list()
##   .. ..- attr(*, "class")= chr  "collector_guess" "collector"
##   ..- attr(*, "class")= chr "col_spec"
set.seed(1313)
fit_with_covariance <- flexmix(cbind(Weight, BMI) ~ 1, data = genderData, k = 2, 
                               model = FLXMCmvnorm(diag = FALSE), 
                               control = list(tolerance = 1e-15, iter.max = 1000)
                               )

# Get the parameters
comp_1 <- parameters(fit_with_covariance, component = 1)
comp_2 <- parameters(fit_with_covariance, component = 2)

# The means
mean_comp_1 <- comp_1[1:2]
mean_comp_1
## [1] 135.97738684   0.03334097
mean_comp_2 <- comp_2[1:2]
mean_comp_2
## [1] 186.6849545   0.0391035
# The covariance matrices
covariance_comp_1 <- matrix(comp_1[3:6], nrow = 2)
covariance_comp_1
##              [,1]         [,2]
## [1,] 370.85097459 4.712215e-02
## [2,]   0.04712215 8.103393e-06
covariance_comp_2 <- matrix(comp_2[3:6], nrow = 2)
covariance_comp_2
##              [,1]         [,2]
## [1,] 405.22840544 2.742036e-02
## [2,]   0.02742036 4.668417e-06
# Create ellipse curve 1
ellipse_comp_1 <- ellipse::ellipse(x = covariance_comp_1, centre = mean_comp_1, npoints = nrow(genderData))
head(ellipse_comp_1)
##             x          y
## [1,] 181.4301 0.04005980
## [2,] 181.4223 0.04006096
## [3,] 181.4144 0.04006212
## [4,] 181.4065 0.04006327
## [5,] 181.3986 0.04006442
## [6,] 181.3906 0.04006557
# Create ellipse curve 2
ellipse_comp_2 <- ellipse::ellipse(x = covariance_comp_2, centre = mean_comp_2, npoints = nrow(genderData))
head(ellipse_comp_2)
##             x          y
## [1,] 231.1740 0.04387866
## [2,] 231.1607 0.04388009
## [3,] 231.1473 0.04388151
## [4,] 231.1340 0.04388294
## [5,] 231.1206 0.04388436
## [6,] 231.1072 0.04388578
# Plot the ellipses
genderData %>% 
    ggplot(aes(x = Weight, y = BMI)) + geom_point()+
    geom_path(data = data.frame(ellipse_comp_1), aes(x=x,y=y), col = "red") +
    geom_path(data = data.frame(ellipse_comp_2), aes(x=x,y=y), col = "blue")

# Check the assignments
table(genderData$Gender, clusters(fit_with_covariance))
##         
##             1    2
##   Female 4540  460
##   Male    386 4614

Chapter 4 - Mixture Models Beyond Gaussians

Bernoulli Mixture Models:

  • Example of the handwritten images dataset, with images of 3 and 6
    • The Bernoulli distribution is appropriate for a binary outcome when you do not want a continuous prediction but rather a probability of success
    • p <- 0.7
    • bernoulli <- sample(c(0, 1), 100, replace = TRUE, prob = c(1-p, p))
  • Every pixel in an image can be represented by a Bernoulli with outcomes being either black (filled) or white (empty), with a 16x16 considered to be a 256-length vector; example for a 3-pixel image
    • p1 <- 0.7; p2 <- 0.5; p3 <- 0.4
    • bernoulli_1 <- sample(c(0, 1), 100, replace = TRUE, prob = c(1-p1, p1))
    • bernoulli_2 <- sample(c(0, 1), 100, replace = TRUE, prob = c(1-p2, p2))
    • bernoulli_3 <- sample(c(0, 1), 100, replace = TRUE, prob = c(1-p3, p3))
    • multi_bernoulli <- cbind(bernoulli_1, bernoulli_2, bernoulli_3)
    • p_vector <- c(p1, p2, p3)

Bernoulli Mixture Models with flexmix:

  • Example of using flexmix to predict whether a digit is a 3 or a 6 in the 16x16 data that is stored in digits
    • digits_sample <- as.matrix(digits) # 320 x 256 (flattened array of pixels per image)
    • show_digit(digits_sample[320,])
  • For fitting a Bernoulli mixture model with two segments, can proceed similar to before
    • bernoulli_mix_model <- flexmix(digits_sample~1, k=2, model=FLXMCmvbinary(), control = list(tolerance = 1e-15, iter.max = 1000)) # digits_sample is the matrix, with each row as an image
    • prior(bernoulli_mix_model) # proportions in each cluster
    • param_comp1 <- parameters(bernoulli_mix_model, component = 1)
    • param_comp2 <- parameters(bernoulli_mix_model, component = 2)
    • show_digit(param_comp1) # will show probabilities of pixelation given segment is a 3

Poisson Mixture Models:

  • Can use Chicago crimes data with a Poisson model, since the goal is a count of crimes by type by community, with segments by level of crime danger in the community
    • lambda_1 <- 100; lambda_2 <- 200; lambda_3 <- 300
    • poisson_1 <- rpois(n = 100, lambda = lambda_1)
    • poisson_2 <- rpois(n = 100, lambda = lambda_2)
    • poisson_3 <- rpois(n = 100, lambda = lambda_3)
    • multi_poisson <- cbind(poisson_1, poisson_2, poisson_3)
  • Can extend the general concept to a crime dataset with 13 columns
    • Multi-Poisson distribution
    • Try from 1-15 clusters, and minimize BIC criteria
    • Parameters include each lambda for each multi-Poisson distribution

Poisson Mixture Models with flexmix:

  • Example of solving the Poisson mixture model using flexmix, with indeterminate clusters (try 1-15 and minimize BIC), and with parameters of lambdas by cluster and proportions by cluster
    • crimes_matrix <- as.matrix(crimes[,-1]) # do not include the community names
    • poisson_mix_model <- stepFlexmix(crimes_matrix ~ 1, k = 1:15, nrep = 5, model = FLXMCmvpois(), control = list(tolerance = 1e-15, iter = 1000)) # stepFlexMix is how to run 1:15
    • best_fit <- getModel(poisson_mix_model, which = “BIC”) # can also use AIC or ICL
    • prior(best_fit) # proportions
    • param_pmm <- data.frame(parameters(best_fit)) # parameters by cluster, converted to data frame
    • param_pmm <- param_pmm %>% mutate(Type = colnames(crimes_matrix))
    • head(param_pmm)
    • param_pmm %>% gather(Components, Lambda, -Type) %>% ggplot(aes(x = Type, y = Lambda, fill = Type)) + geom_bar(stat = “identity”) + facet_wrap(~ Components) + theme(axis.text.x = element_text(angle = 90, hjust = 1), legend.position = “none”)
    • crimes_c <- crimes %>% mutate(CLUSTER = factor(clusters(best_fit)))
    • crimes_c %>% group_by(CLUSTER) %>% mutate(NUMBER = row_number()) %>% ggplot(aes(x = CLUSTER, y = NUMBER, col = CLUSTER)) + geom_text(aes(label = COMMUNITY), size = 2.3)+ theme(legend.position=“none”)

Example code includes:

# Create the vector of probabilities
p_cluster_1 <- c(0.8, 0.8, 0.2, 0.9)

# Create the sample for each pixel
set.seed(18102308)
pixel_1 <- sample(c(0, 1), 100, replace = TRUE, prob = c(1-p_cluster_1[1], p_cluster_1[1]))
pixel_2 <- sample(c(0, 1), 100, replace = TRUE, prob = c(1-p_cluster_1[2], p_cluster_1[2]))
pixel_3 <- sample(c(0, 1), 100, replace = TRUE, prob = c(1-p_cluster_1[3], p_cluster_1[3]))
pixel_4 <- sample(c(0, 1), 100, replace = TRUE, prob = c(1-p_cluster_1[4], p_cluster_1[4]))

# Combine the samples
sample_cluster_1 <- cbind(pixel_1, pixel_2, pixel_3, pixel_4)

# Have a look to the sample
head(sample_cluster_1)
##      pixel_1 pixel_2 pixel_3 pixel_4
## [1,]       1       1       0       1
## [2,]       1       1       0       1
## [3,]       1       1       0       1
## [4,]       1       1       0       1
## [5,]       0       1       0       1
## [6,]       1       1       0       1
digitUse2 <- rowSums(digitKey[, c(1, 3, 10)]) == 1
digits_sample_2 <- digitData[digitUse2, ]
dim(digits_sample_2)
## [1] 478 256
# transform into matrix
digits_sample_2 <- as.matrix(digits_sample_2)

# dimension
dim(digits_sample_2)
## [1] 478 256
# look to the first observation
show_digit(digits_sample_2[1, ])

# look to the last observation
show_digit(digits_sample_2[nrow(digits_sample_2), ])

set.seed(1513)
# Fit Bernoulli mixture model
bernoulli_mix_model <- flexmix(digits_sample_2 ~ 1, k = 3, model = FLXMCmvbinary(), 
                               control = list(tolerance = 1e-15, iter.max = 1000)
                               )
prior(bernoulli_mix_model)
## [1] 0.3117220 0.3353131 0.3529649
# Extract the parameters for each cluster
param_comp_1 <- parameters(bernoulli_mix_model, component = 1)
param_comp_2 <- parameters(bernoulli_mix_model, component = 2)
param_comp_3 <- parameters(bernoulli_mix_model, component = 3)

# Visualize the clusters
show_digit(param_comp_1)

show_digit(param_comp_2)

show_digit(param_comp_3)

set.seed(1541)

# Create the vector of lambdas
lambda_1 <- c(150, 300, 50)

# Create the sample of each crime
assault_1 <- rpois(n = 10, lambda = lambda_1[1])
robbery_1 <- rpois(n = 10, lambda = lambda_1[2])
battery_1 <- rpois(n = 10, lambda = lambda_1[3])

# Combine the results
cities_1 <- cbind(assault_1, robbery_1, battery_1)

# Check the sample
cities_1
##       assault_1 robbery_1 battery_1
##  [1,]       154       297        55
##  [2,]       142       276        50
##  [3,]       166       312        41
##  [4,]       158       273        56
##  [5,]       129       278        52
##  [6,]       150       307        39
##  [7,]       140       321        49
##  [8,]       152       321        53
##  [9,]       143       318        42
## [10,]       125       324        51
crimes <- readr::read_csv("./RInputFiles/CoC_crimes.csv")
## Parsed with column specification:
## cols(
##   COMMUNITY = col_character(),
##   ASSAULT = col_integer(),
##   BATTERY = col_integer(),
##   BURGLARY = col_integer(),
##   `CRIMINAL DAMAGE` = col_integer(),
##   `CRIMINAL TRESPASS` = col_integer(),
##   `DECEPTIVE PRACTICE` = col_integer(),
##   `MOTOR VEHICLE THEFT` = col_integer(),
##   NARCOTICS = col_integer(),
##   OTHER = col_integer(),
##   `OTHER OFFENSE` = col_integer(),
##   ROBBERY = col_integer(),
##   THEFT = col_integer()
## )
dim(crimes)
## [1] 77 13
names(crimes) <- stringr::str_replace_all(stringr::str_to_lower(names(crimes)), " ", ".")

# Check with glimpse
glimpse(crimes)
## Observations: 77
## Variables: 13
## $ community           <chr> "ALBANY PARK", "ARCHER HEIGHTS", "ARMOUR S...
## $ assault             <int> 123, 51, 74, 169, 708, 1198, 118, 135, 337...
## $ battery             <int> 429, 134, 184, 448, 1681, 3347, 280, 350, ...
## $ burglary            <int> 147, 92, 55, 194, 339, 517, 76, 145, 327, ...
## $ criminal.damage     <int> 287, 114, 99, 379, 859, 1666, 150, 310, 52...
## $ criminal.trespass   <int> 38, 23, 56, 43, 228, 265, 29, 36, 88, 29, ...
## $ deceptive.practice  <int> 137, 67, 59, 178, 310, 767, 73, 200, 314, ...
## $ motor.vehicle.theft <int> 176, 50, 37, 189, 281, 732, 58, 123, 411, ...
## $ narcotics           <int> 27, 18, 9, 30, 345, 1456, 15, 22, 119, 10,...
## $ other               <int> 107, 37, 48, 114, 584, 1261, 76, 88, 238, ...
## $ other.offense       <int> 158, 44, 35, 164, 590, 1130, 94, 142, 339,...
## $ robbery             <int> 144, 30, 98, 111, 349, 829, 65, 109, 172, ...
## $ theft               <int> 690, 180, 263, 461, 1201, 2137, 239, 669, ...
# Transform into a matrix, without `community`
matrix_crimes <- crimes %>%
  select(-community) %>%  
  as.matrix()

# Check the first values
head(matrix_crimes)
##      assault battery burglary criminal.damage criminal.trespass
## [1,]     123     429      147             287                38
## [2,]      51     134       92             114                23
## [3,]      74     184       55              99                56
## [4,]     169     448      194             379                43
## [5,]     708    1681      339             859               228
## [6,]    1198    3347      517            1666               265
##      deceptive.practice motor.vehicle.theft narcotics other other.offense
## [1,]                137                 176        27   107           158
## [2,]                 67                  50        18    37            44
## [3,]                 59                  37         9    48            35
## [4,]                178                 189        30   114           164
## [5,]                310                 281       345   584           590
## [6,]                767                 732      1456  1261          1130
##      robbery theft
## [1,]     144   690
## [2,]      30   180
## [3,]      98   263
## [4,]     111   461
## [5,]     349  1201
## [6,]     829  2137
set.seed(2017)
# Fit the Poisson mixture model
poisson_mm <- stepFlexmix(matrix_crimes ~ 1, k = 1:15, nrep = 5, model = FLXMCmvpois(), 
                          control = list(tolerance = 1e-15, iter.max = 1000)
                          )
## 1 : * * * * *
## 2 : * * * * *
## 3 : * * * * *
## 4 : * * * * *
## 5 : * * * * *
## 6 : * * * * *
## 7 : * * * * *
## 8 : * * * * *
## 9 : * * * * *
## 10 : * * * * *
## 11 : * * * * *
## 12 : * * * * *
## 13 : * * * * *
## 14 : * * * * *
## 15 : * * * * *
# Select the model that minimize the BIC
best_poisson_mm <- getModel(poisson_mm, which = "BIC")

# Get the parameters into a data frame
params_lambdas <- data.frame(parameters(best_poisson_mm))

# Add the column with the type of crime
params_lambdas_crime <- params_lambdas %>% 
    mutate(crime = colnames(matrix_crimes))

# Plot the clusters with their lambdas
params_lambdas_crime %>% 
    gather(cluster, lambdas, -crime) %>% 
    ggplot(aes(x = crime, y = lambdas, fill = crime)) + 
    geom_bar(stat = "identity") +
    facet_wrap(~ cluster) +
    theme(axis.text.x = element_text(angle = 90, hjust = 1), legend.position = "none")

# Add the cluster assignments
crimes_with_clusters <- crimes %>% 
    mutate(cluster = factor(clusters(best_poisson_mm)))

# Plot the clusters with the communities
crimes_with_clusters %>% 
    group_by(cluster) %>% 
    mutate(number = row_number()) %>% 
    ggplot(aes(x = cluster, y = number, col = cluster)) + 
    geom_text(aes(label = community), size = 2.3) +
    theme(legend.position="none")


Developing R Packages

Chapter 1 - The R Package Structure

Introduction to Package Building:

  • R packages can include functions, data, documentation, vignettes, tests, and the like
  • At a minimum, the package must have 1) R Directory, 2) man Directory, 3) NAMESPACE file, and 4) DESCRIPTION file
  • Can use devtools to help with package building, as well as roxygen2
    • create()
    • document()
    • check()
    • build()
    • test()
  • The devtools functions have descriptive names closely related to their assigned tasks
    • devtools::create(“simutils”) # avoid names that are already on CRAN

Description and Namespace Files:

  • The DESCRIPTION contains background information such as author, package name, version, license, and the like
  • The NAMESPACE file will be edited based on entries made in other locations
    • import() will bring in from other packages
    • export() will export to the calling environment

Optional Directories:

  • The most common optional directories include data, vignettes, tests, compiled code, and translations
  • Example for adding data to the package
    • sim_dat <- data.frame( ID = 1:10, Value = sample(1:11, 10), Apples = sample(c(TRUE, FALSE), 10, replace = TRUE) )
    • devtools::use_data(sim_dat, pkg = “simutils”)
  • Example for adding vignettes to the package
    • use_vignette(“my_first_vignette”, pkg = “simutils”)
  • Best practices for structuring code - may NOT include subdirectories
    • Group similar functions together in a file
    • Do not create a small file for every function

Example code includes:

# Use the create function to set up your first package
devtools::create("./RPackages/datasummary")

# Take a look at the files and folders in your package
dir("./RPackages/datasummary")


# Create numeric_summary() function
numeric_summary <- function(x, na.rm) {
    # Include an error if x is not numeric
    if(!is.numeric(x)){
        stop("Data must be numeric")
    }
    
    # Create data frame
    data.frame( min = min(x, na.rm = na.rm),
                median = median(x, na.rm = na.rm),
                sd = sd(x, na.rm = na.rm),
                max = max(x, na.rm = na.rm))
}

data(airquality)

# Test numeric_summary() function
numeric_summary(airquality$Ozone, TRUE)


# What is in the R directory before adding a function?
dir("./RPackages/datasummary/R")

# Use the dump() function to write the numeric_summary function
dump("numeric_summary", file = "./RPackages/datasummary/R/numeric_summary.R")

# Verify that the file is in the correct directory
dir("./RPackages/datasummary/R")


# a package should not have the same name as an existing package and its name must only contain letters, numbers, or dots.


# What is in the package at the moment?
dir("./RPackages/datasummary")

# Add the weather data
data(Weather, package="mosaicData")
devtools::use_data(Weather, pkg = "./RPackages/datasummary")

# Add a vignette called "Generating Summaries with Data Summary"
devtools::use_vignette("Generating_Summaries_with_Data_Summary", pkg = "./RPackages/datasummary")

# What directories do you now have in your package now?
dir("./RPackages/datasummary")


data_summary <- function(x, na.rm = TRUE){
  num_data <- select_if(x, .predicate = is.numeric) 
  map_df(num_data, .f = numeric_summary, na.rm = TRUE, .id = "ID")
}

# Write the function to the R directory
dump("data_summary", file = "./RPackages/datasummary/R/data_summary.R")
dir("./RPackages/datasummary")

Chapter 2 - Documenting Packages

Introduction to roxygen2:

  • Good documentation is key to the package - all functions, usages, outputs, etc.
  • The roxygen2 package allows for creating this type of documentation
    • Included above the function, with each line starting with #’
    • Paragraph 1 is the title (should be short)
    • Paragraph 2 is the brief description (should be a single sentence)
    • Paragraph 3 is the longer description (an actual paragraph of a few sentences)
    • Paragraphs 4+ need to all start with @tag where tag might be param or author or import or return or export or examples or etc
  • Packages need to import other packages rather than calling them by way of library(package)

How to export functions:

  • Exported functions become visible to the end-user and are core to package functionality (documented)
    • Flagged with a tag of #’ @export
  • Non-exported functions are not visible to the end-user but instead serve as utility functions within the package
    • Flagged by having no tag of #’ @export
  • Only the exported functions get loaded, so calling a non-exported function requires a triple colon from the namespace
    • simutils:::sum_na(airquality$Ozone)

Documenting other elements:

  • Can include examples using the @examples tag with the example included on the line below
    • If you do not want an example to be run during checking, then the tag can be used with the example being inside {} and allowed to be multiple lines
  • The return from the function is specified using the @return tag, and with the tag being available to signal that this refers to one of the arguments/parameters
  • Can use the @author and @seealso tags as needed

Documenting a package:

  • All roxygen headers need to be followed by some form of R code
    • Can use a single line “_PACKAGE" for this
  • The minimum level of documentation is title, description, arguments, and exported (for exported functionsl only)
    • Other components may be useful to the end-user
  • Can put a data frame from the current environment in to the package
    • use_data(sim_dat, pkg = “simutils”)
  • Can also use the roxygen formatting and then conclude with “sim_dat” to put this in with headers and descriptors
  • Can create the manual files (create and/or update) using
    • document(“simutils”)

Example code includes:

#' Summary of Numeric Columns
#'
#' Generate specific summaries of numeric columns in a data frame
#' 
#' @param x A data frame. Non-numeric columns will be removed
#' @param na.rm A logical indicating whether missing values should be removed
#' @import purrr
#' @import dplyr
#' @importFrom tidyr gather
data_summary <- function(x, na.rm = TRUE){
  
  num_data <- select_if(x, .predicate = is.numeric) 
  
  map_df(num_data, .f = numeric_summary, na.rm = na.rm, .id = "ID")
  
}


#' Summary of Numeric Columns
#'
#' Generate specific summaries of numeric columns in a data frame
#' 
#' @param x A data frame. Non-numeric columns will be removed
#' @param na.rm A logical indicating whether missing values should be removed
#' @import dplyr
#' @import purrr
#' @importFrom tidyr gather
#' @export
data_summary <- function(x, na.rm = TRUE){
  
  num_data <- select_if(x, .predicate = is.numeric) 
  
  map_df(num_data, .f = numeric_summary, na.rm = na.rm, .id = "ID")
  
}


#' Data Summary for Numeric Columns
#'
#' Custom summaries of numeric data in a provided data frame
#'
#' @param x A data.frame containing at least one numeric column
#' @param na.rm A logical indicating whether missing values should be removed
#' @import dplyr
#' @import purrr
#' @importFrom tidyr gather
#' @export
#' @examples
#' data_summary(iris)
#' data_summary(airquality, na.rm = FALSE)
data_summary <- function(x, na.rm = TRUE){
  
  num_data <- select_if(x, .predicate = is.numeric) 
  
  map_df(num_data, .f = numeric_summary, na.rm = na.rm, .id = "ID")
  
}



# For code you use \code{text to format}
# To link to other functions you use \link[packageName]{functioName}, although note the package name is only required if the function is not in your package
# To include an unordered list you use \itemize{}. Inside the brakets you mark new items with \item followed by the item text.

#' Data Summary for Numeric Columns
#'
#' Custom summaries of numeric data in a provided data frame
#'
#' @param x A data.frame containing at least one numeric column
#' @param na.rm A logical indicating whether missing values should be removed
#' @import dplyr
#' @import purrr
#' @importFrom tidyr gather
#' @export
#' @examples
#' data_summary(iris)
#' data_summary(airquality, na.rm = FALSE)
#'
## Update the details for the return value
#' @return 
#' This function returns a \code{data.frame} including columns:
#' \itemize{
#'  \item ID
#'  \item min
#'  \item median
#'  \item sd
#'  \item max
#' }
#'
#' @export
data_summary <- function(x, na.rm = TRUE){
  
  num_data <- select_if(x, .predicate = is.numeric) 
  
  map_df(num_data, .f = numeric_summary, na.rm = na.rm, .id = "ID")
  
}


#' Summary of Numeric Columns
#' Generate specific summaries of numeric columns in a data frame
#'
#' @param x A data frame. Non-numeric columns will be removed
#' @param na.rm A logical indicating whether missing values should be removed
#' @import dplyr
#' @import purrr
#' @importFrom tidyr gather
#' @export
#' @examples
#' data_summary(iris)
#' data_summary(airquality, na.rm = FALSE)
#' 
#' @return This function returns a \code{data.frame} including columns: 
#' \itemize{
#'  \item ID
#'  \item min
#'  \item median
#'  \item sd
#'  \item max
#' }
#'
## Add in the author of the `data_summary()` function. 
#' @author My Name <myemail@example.com>
## Update the header to link to the `summary()` function (in the `base` package).
#' @seealso \link[base]{summary}
data_summary <- function(x, na.rm = TRUE){
  
  num_data <- select_if(x, .predicate = is.numeric) 
  
  map_df(num_data, .f = numeric_summary, na.rm = na.rm, .id = "ID")
  
}


#' Custom Data Summaries
#' 
#' Easily generate custom data frame summaries
#' 
#' @docType package
#' @name datasummary
_PACKAGE 


#' Random Weather Data
#'
#' A dataset containing randomly generated weather data.
#'
#' @format A data frame of 7 rows and 3 columns
#' \describe{
#'  \item{Day}{Numeric values giving day of the week, 1 = Monday, 7 = Sunday}
#'  \item{Temp}{Integer values giving temperature in degrees Celsius}
#'  \item{Weather}{Character values giving precipitation type, Sun if none}
#' }
#' @source Randomly generated data
weather


# Generate package documentation
document("datasummary")

# Examine the contents of the man directory
dir("datasummary/man")

# View the documentation for the data_summary function
help("data_summary")

# View the documentation for the weather dataset
help("weather")

Chapter 3 - Checking and Building R Packages

Why check an R package?

  • There are many checks for a typical R package, including many that are mandatory for submission to CRAN
    • Package can be installed
    • Description information is correct
    • Dependencies make sense
    • No code syntax errors
    • Documentation is complete
    • Unit tests can be run
    • Vignettes can be built
  • A system-level R tool can check the package for you
    • check(“simutils”) # default setting is the same as for CRAN
    • Errors need to be fixed, while warnings are less problematic (still should be investigated)

Errors, warnings, and notes:

  • Package dependencies will be checked; will error out if these are not available
  • Often have documentation issues; need to update function and argument names to match what has been updated in code
  • The examples are all run, and need to return with an OK status
  • If LaTEX is not installed, there will be documentation build errors

Differences in package dependencies:

  • The dependencies from “Depends:” are loaded in to the search() path, though this is not always the recommended approach due to masking
  • The dependencies from “Imports:” are loaded by a namespace
    • use_package(“dplyr”) ## adds to imports
  • The “Suggests:” are not required for running the package but may be helpful (for example, for running the vignettes)
    • use_package(“ggplot2”, “suggests”) ## adds to suggests

Building packages with continuous integration:

  • Can create package as either a source file or as a binary
    • build(“simutils”) # default builds the source file
    • build(“simutils”, binary = TRUE) # builds the binary version, needed for compiled code
  • Continuous integration can help with package maintenance
    • Automatically checks packages whenever code is changed
    • Useful with version control
    • use_travis(“simutils”)

Example code includes:

# Check your package
check("datasummary")


#' Numeric Summaries
#' Summarises numeric data and returns a data frame containing the minimum value, median, standard deviation, and maximum value.
#'
#' @param x a numeric vector containing the values to summarize.
#' @param na.rm a logical value indicating whether NA values should be stripped before the computation proceeds.
numeric_summary <- function(x, na.rm){

  if(!is.numeric(x)){
    stop("data must be numeric")
  }

  data.frame( min = min(x, na.rm = na.rm),
              median = median(x, na.rm = na.rm),
              sd = sd(x, na.rm = na.rm),
              max = max(x, na.rm = na.rm))
}


# The way in which you define variables in tidyverse package functions can cause confusion for the R CMD check, which sees column names and the name of your dataset, and flags them as "undefined global variables".
# To get around this, you can manually specify the data and its columns as a vector to utils::globalVariables(), by including a line of code similar to the following in your package-level documentation:
# utils::globalVariables(c("dataset_name", "col_name_1", "col_name_2"))
# This defines dataset_name, col_name_1, and col_name_2 as global variables, and now you shouldn't get the undefined global variables error.

#' datasummary: Custom Data Summaries
#'
#' Easily generate custom data frame summaries
#'
#' @docType package
#' @name datasummary
_PACKAGE

# Update this function call
utils::globalVariables(c("weather", "Temp"))


# Add dplyr as an imported dependency to the DESCRIPTION file
use_package("dplyr", pkg = "datasummary")

# Add purrr as an imported dependency to the DESCRIPTION file
use_package("purrr", pkg = "datasummary")

# Add tidyr as an imported dependency to the DESCRIPTION file
use_package("tidyr", pkg = "datasummary")


# Build the package
build("datasummary")

# Examine the contents of the current directory
dir("datasummary")

Chapter 4 - Adding Unit Tests to R Packages

What are unit tests and why write them?

  • Unit tests can help with checking that future function behavior remains as expected
    • Changes in functionality of supporting code
    • Later versions of R
    • Different operating systems
    • Different underlying data
  • Can add unit tests to the package using roxygen2
    • Call use_testthat to set up the test framework
    • This creates a test directory in the package root directory
    • Within the test directory, there is a script testthat.R which contains code to run the tests
    • Within the test directory is a directory testthat where you save all of your test scripts
  • Can then create individual tests that begin with expect_*()
    • library(testthat)
    • my_vector <- c(“First” = 1, “Second” = 2)
    • expect_identical(my_vector, c(“First” = 1, “Second” = 2)) # will pass since types and values are the same
    • expect_identical(myvector, c(1, 2)) # Error: vec1 not identical to c(1, 2). names for target but not for current
    • expect_equal(my_vector, c(“First” = 1L, “Second” = 2L)) # checks only the values and attributes, so this will pass even if vector is c(1, 2)
    • expect_equal(my_vector, c(First = 1.1, Second = 2.1), tolerance = 0.1) # include a tolerance for differences
    • expect_equivalent(my_vector, c(1, 2)) # compare only the values, not the types or the attributes

Testing errors and warnings:

  • Functions can give warnings or errors for many reasons, such as sqrt(-1)
  • The testthat contains functions for expecting warnings and errors
    • expect_warning(sqrt(-1)) # passes
    • expect_error(sqrt(“foo”)) # passes
    • expect_error(sqrt(-1)) # fails, since this returns a warning rather than an error
    • expect_error(sqrt(“foo”), “non-numeric argument to mathematical function”) # requires that the error thrown be exactly the string in the second argument
    • expect_error(sqrt(“foo”), “NaNs produced”) # fails, since that is not the message

Testing specific output and non-exported functions:

  • Printed messages and plots are side effects, which can be tested using expect_output
    • expect_output(str(airquality), “41 36 12 18 NA 28 23 19 8 NA”) # passes, since this is part of the output
    • expect_output(str(airquality), “air”) # fails, since the word “air” is not in the output
    • expect_output_file(str(airquality), “airq.txt”, update = TRUE) # creates the file, which will throw an error the first time that it is run
    • expect_output_file(str(airquality), “airq.txt”) # next time run, it will compare the output to the file
  • Can use the library for headers from the roxygen headers
    • expect_equivalent(na_counter(airquality), c(37, 7, 0, 0, 0, 0))
    • expect_equal(simutils:::sum_na(airquality$Ozone), 37) # three colons signal that this is a non-exported function

Grouping and running tests:

  • Can organize and group tests for easier future use - can add many tests in a single test_that() call
    • test_that(“na_counter correctly counts NA values”, { test_matrix = matrix(c(NA, 1, 4, NA, 5, 6), nrow = 2) ; air_expected = c(Ozone = 37, Solar.R = 7, Wind = 0, Temp = 0, Month = 0, Day = 0) ; mat_expected = c(V1 = 1, V2 = 1, V3 = 0) ; expect_equal(na_counter(airquality), air_expected) ; expect_equal(na_counter(test_matrix), mat_expected) })
    • context(“na_counter checks”) # will then give the appropriate information about what failed in the checks
  • Need to fix any failed tests, either by fixing the code or by fixing the test

Wrap up:

  • Sturcture of R packages, including NAMESPACE and DESCRIPTION
  • Documenting R packages and including roxygen2 for examples/documentation
  • Building integrated packages with checks and tests
  • Unit tests to ensure that packages run as expected

Example code includes:

# Set up the test framework
use_testthat("datasummary")

# Look at the contents of the package root directory
dir("datasummary")

# Look at the contents of the new folder which has been created 
dir("datasummary/tests")


# Create a summary of the iris dataset using your data_summary() function
iris_summary <- data_summary(iris)

# Count how many rows are returned
summary_rows <- nrow(iris_summary) 

# Use expect_equal to test that calling data_summary() on iris returns 4 rows
expect_equal(summary_rows, 4)


result <- data_summary(weather)

# Update this test so it passes
expect_equal(result$sd, c(2.1, 3.6), tolerance = 0.1)

expected_result <- list(
    ID = c("Day", "Temp"),
    min = c(1L, 14L),
    median = c(4L, 19L),
    sd = c(2.16024689946929, 3.65148371670111),
    max = c(7L, 24L)
)

# Write a passing test that compares expected_result to result
expect_equivalent(result, expected_result)


# Create a vector containing the numbers 1 through 10
my_vector <- 1:10

# Look at what happens when we apply this vector as an argument to data_summary()
data_summary(my_vector)

# Test if running data_summary() on this vector returns an error
expect_error(data_summary(my_vector))


# Run data_summary on the airquality dataset with na.rm set to FALSE
data_summary(airquality, na.rm=FALSE)

# Use expect_warning to formally test this
expect_warning(data_summary(airquality, na.rm = FALSE))


# Expected result
expected <- data.frame(min = 14L, median = 19L, sd = 3.65148371670111, max = 24L)

# Create variable result by calling numeric summary on the temp column of the weather dataset
result <- datasummary:::numeric_summary(weather$Temp, na.rm = TRUE)

# Test that the value returned matches the expected value
expect_equal(result, expected)


# Use context() and test_that() to group the tests below together
context("Test data_summary()")

test_that("data_summary() handles errors correctly", {

  # Create a vector
  my_vector <- 1:10

  # Use expect_error()
  expect_error(data_summary(my_vector))

  # Use expect_warning()
  expect_warning(data_summary(airquality, na.rm = FALSE))

})


# Run the tests on the datasummary package
test("datasummary")

Factor Analysis in R

Chapter 1 - Evaluating Your Measure with Factor Analysis

Introduction to Exploratory Factor Analysis:

  • Psychometrics is the study of unobservable (“of the mind”) variables
  • Factor analysis is a valuable tool in psychometric analysis
  • Factor analysis is mid-way between SEM (structural equation modeling) and Classical Test Theory
    • Exploratory Factor Analysis (EFA) is used during measure development
    • Confirmatory Factor Analysis (CFA) is used to validate a measure after development
  • This course will use library(psych) and the gcbs dataset on conspiracies
    • EFA_model <- fa(gcbs)
    • fa.diagram(EFA_model)
    • EFA_model$loadings

Overview of the Measure Development Process:

  • The development process includes
    • Develop items foir your measure - start with a larger list than you need
    • Collect pilot data from a representative sample
    • Check what the dataset looks like - psych::describe()
    • Consider whether to run EFA or CFA or both
    • If running both EFA and CFA, split the dataset in to two samples
    • Compare the two samples to make sure they are similar
  • Can use the psych package to view a dataset by the grouping variable
    • gcbs_grouped <- cbind(gcbs, group_var)
    • describeBy(gcbs_grouped, group = group_var) # group= can be a vector
    • statsBy(gcbs_grouped, group = “group_var”) # group= needs to be a name of a column

Measure Features: Correlations and Reliability:

  • Can grab the lower-diagonal correlations using lowerCor(gcbs)
  • Can also get the p-values using corr.test(gcbs, use = “pairwise.complete.obs”)$p # gets the p-values for each correlation
  • Can also get the 95% CI for the correlations using corr.test(gcbs, use = “pairwise.complete.obs”)$ci
  • Can also get the alpha using alpha(gcbs) # measure of the internal consistency or ‘reliability’ of the measure, with a target of 0.8+
  • Can look at the split-half reliability using splitHalf(gcbs)

Example code includes:

# Load the psych package
library(psych)
## 
## Attaching package: 'psych'
## The following object is masked from 'package:lavaan':
## 
##     cor2cov
## The following objects are masked from 'package:ggplot2':
## 
##     %+%, alpha
gcbs <- readRDS("./RInputFiles/GCBS_data.rds")
glimpse(gcbs)
## Observations: 2,495
## Variables: 15
## $ Q1  <int> 5, 5, 2, 5, 5, 1, 4, 5, 1, 1, 4, 5, 5, 5, 5, 4, 4, 2, 4, 5...
## $ Q2  <int> 5, 5, 4, 4, 4, 1, 3, 4, 1, 2, 4, 5, 4, 4, 4, 4, 4, 1, 2, 2...
## $ Q3  <int> 3, 5, 1, 1, 1, 1, 3, 3, 1, 1, 4, 1, 2, 4, 5, 2, 1, 1, 1, 1...
## $ Q4  <int> 5, 5, 2, 2, 4, 1, 3, 3, 1, 1, 5, 5, 4, 5, 5, 5, 3, 1, 1, 3...
## $ Q5  <int> 5, 5, 2, 4, 4, 1, 4, 4, 1, 1, 5, 5, 5, 4, 5, 5, 4, 1, 1, 4...
## $ Q6  <int> 5, 3, 2, 5, 5, 1, 3, 5, 1, 5, 5, 5, 5, 5, 5, 4, 2, 1, 1, 3...
## $ Q7  <int> 5, 5, 4, 4, 4, 1, 3, 5, 1, 1, 4, 3, 3, 5, 5, 5, 4, 1, 1, 2...
## $ Q8  <int> 3, 5, 2, 1, 3, 1, 4, 5, 1, 1, 4, 1, 3, 5, 5, 1, 1, 1, 1, 3...
## $ Q9  <int> 4, 1, 2, 4, 1, 1, 2, 5, 1, 1, 2, 1, 5, 5, 5, 3, 1, 1, 1, 4...
## $ Q10 <int> 5, 4, 4, 5, 5, 1, 3, 5, 1, 4, 5, 5, 3, 5, 5, 5, 4, 2, 3, 4...
## $ Q11 <int> 5, 4, 2, 5, 5, 1, 3, 5, 1, 1, 4, 5, 4, 5, 4, 4, 4, 2, 2, 4...
## $ Q12 <int> 5, 5, 4, 5, 5, 1, 2, 5, 1, 1, 2, 5, 3, 5, 3, 5, 1, 1, 2, 2...
## $ Q13 <int> 3, 4, 0, 1, 3, 1, 2, 3, 1, 1, 2, 1, 3, 4, 5, 4, 1, 1, 1, 4...
## $ Q14 <int> 5, 4, 2, 4, 5, 1, 3, 4, 1, 1, 1, 5, 3, 4, 5, 5, 4, 1, 2, 4...
## $ Q15 <int> 5, 5, 4, 5, 5, 1, 4, 5, 1, 5, 5, 5, 5, 5, 5, 5, 4, 2, 3, 4...
# Conduct a single-factor EFA
EFA_model <- fa(gcbs)

# View the results
EFA_model
## Factor Analysis using method =  minres
## Call: fa(r = gcbs)
## Standardized loadings (pattern matrix) based upon correlation matrix
##      MR1   h2   u2 com
## Q1  0.70 0.49 0.51   1
## Q2  0.72 0.52 0.48   1
## Q3  0.64 0.41 0.59   1
## Q4  0.77 0.59 0.41   1
## Q5  0.67 0.45 0.55   1
## Q6  0.75 0.56 0.44   1
## Q7  0.73 0.54 0.46   1
## Q8  0.65 0.43 0.57   1
## Q9  0.70 0.48 0.52   1
## Q10 0.56 0.32 0.68   1
## Q11 0.72 0.52 0.48   1
## Q12 0.79 0.62 0.38   1
## Q13 0.68 0.46 0.54   1
## Q14 0.74 0.55 0.45   1
## Q15 0.57 0.33 0.67   1
## 
##                 MR1
## SS loadings    7.27
## Proportion Var 0.48
## 
## Mean item complexity =  1
## Test of the hypothesis that 1 factor is sufficient.
## 
## The degrees of freedom for the null model are  105  and the objective function was  9.31 with Chi Square of  23173.8
## The degrees of freedom for the model are 90  and the objective function was  1.93 
## 
## The root mean square of the residuals (RMSR) is  0.08 
## The df corrected root mean square of the residuals is  0.09 
## 
## The harmonic number of observations is  2495 with the empirical chi square  3398.99  with prob <  0 
## The total number of observations was  2495  with Likelihood Chi Square =  4809.34  with prob <  0 
## 
## Tucker Lewis Index of factoring reliability =  0.761
## RMSEA index =  0.145  and the 90 % confidence intervals are  0.142 0.149
## BIC =  4105.36
## Fit based upon off diagonal values = 0.97
## Measures of factor score adequacy             
##                                                    MR1
## Correlation of (regression) scores with factors   0.97
## Multiple R square of scores with factors          0.94
## Minimum correlation of possible factor scores     0.87
# Set up the single-factor EFA
EFA_model <- fa(gcbs)

# View the factor loadings
EFA_model$loadings
## 
## Loadings:
##     MR1  
## Q1  0.703
## Q2  0.719
## Q3  0.638
## Q4  0.770
## Q5  0.672
## Q6  0.746
## Q7  0.734
## Q8  0.654
## Q9  0.695
## Q10 0.565
## Q11 0.719
## Q12 0.786
## Q13 0.679
## Q14 0.743
## Q15 0.574
## 
##                  MR1
## SS loadings    7.267
## Proportion Var 0.484
# Create a path diagram of the items' factor loadings
fa.diagram(EFA_model)

# Take a look at the first few lines of the response data and their corresponding sum scores
head(gcbs)
##   Q1 Q2 Q3 Q4 Q5 Q6 Q7 Q8 Q9 Q10 Q11 Q12 Q13 Q14 Q15
## 1  5  5  3  5  5  5  5  3  4   5   5   5   3   5   5
## 2  5  5  5  5  5  3  5  5  1   4   4   5   4   4   5
## 3  2  4  1  2  2  2  4  2  2   4   2   4   0   2   4
## 4  5  4  1  2  4  5  4  1  4   5   5   5   1   4   5
## 5  5  4  1  4  4  5  4  3  1   5   5   5   3   5   5
## 6  1  1  1  1  1  1  1  1  1   1   1   1   1   1   1
rowSums(gcbs[1:6, ])
##  1  2  3  4  5  6 
## 68 65 37 55 59 15
# Then look at the first few lines of individuals' factor scores
head(EFA_model$scores)
##             MR1
## [1,]  1.5614675
## [2,]  1.3432026
## [3,] -0.3960355
## [4,]  0.7478868
## [5,]  1.0435203
## [6,] -1.7290812
# To get a feel for how the factor scores are distributed, look at their summary statistics and density plot.
summary(EFA_model$scores)
##       MR1           
##  Min.   :-1.854703  
##  1st Qu.:-0.783260  
##  Median :-0.001971  
##  Mean   : 0.000000  
##  3rd Qu.: 0.728568  
##  Max.   : 1.949580
plot(density(EFA_model$scores, na.rm = TRUE), main = "Factor Scores")

# Basic descriptive statistics
describe(gcbs)
##     vars    n mean   sd median trimmed  mad min max range  skew kurtosis
## Q1     1 2495 3.47 1.46      4    3.59 1.48   0   5     5 -0.55    -1.10
## Q2     2 2495 2.96 1.49      3    2.96 1.48   0   5     5 -0.01    -1.40
## Q3     3 2495 2.05 1.39      1    1.82 0.00   0   5     5  0.98    -0.44
## Q4     4 2495 2.64 1.45      2    2.55 1.48   0   5     5  0.26    -1.34
## Q5     5 2495 3.25 1.47      4    3.32 1.48   0   5     5 -0.35    -1.27
## Q6     6 2495 3.11 1.51      3    3.14 1.48   0   5     5 -0.17    -1.42
## Q7     7 2495 2.67 1.51      2    2.59 1.48   0   5     5  0.28    -1.39
## Q8     8 2495 2.45 1.57      2    2.32 1.48   0   5     5  0.51    -1.30
## Q9     9 2495 2.23 1.42      2    2.05 1.48   0   5     5  0.76    -0.82
## Q10   10 2495 3.50 1.39      4    3.63 1.48   1   5     4 -0.59    -0.94
## Q11   11 2495 3.27 1.40      4    3.34 1.48   0   5     5 -0.35    -1.11
## Q12   12 2495 2.64 1.50      2    2.56 1.48   0   5     5  0.29    -1.37
## Q13   13 2495 2.10 1.38      1    1.89 0.00   0   5     5  0.89    -0.56
## Q14   14 2495 2.96 1.49      3    2.95 1.48   0   5     5 -0.02    -1.43
## Q15   15 2495 4.23 1.10      5    4.47 0.00   0   5     5 -1.56     1.71
##       se
## Q1  0.03
## Q2  0.03
## Q3  0.03
## Q4  0.03
## Q5  0.03
## Q6  0.03
## Q7  0.03
## Q8  0.03
## Q9  0.03
## Q10 0.03
## Q11 0.03
## Q12 0.03
## Q13 0.03
## Q14 0.03
## Q15 0.02
# Graphical representation of error
error.dots(gcbs)

# Graphical representation of error
error.bars(gcbs)

# Establish two sets of indices to split the dataset
N <- nrow(gcbs)
indices <- seq(1, N)
indices_EFA <- sample(indices, floor((.5*N)))
indices_CFA <- indices[!(indices %in% indices_EFA)]

# Use those indices to split the dataset into halves for your EFA and CFA
gcbs_EFA <- gcbs[indices_EFA, ]
gcbs_CFA <- gcbs[indices_CFA, ]


# Use the indices from the previous exercise to create a grouping variable
group_var <- vector("numeric", nrow(gcbs))
group_var[indices_EFA] <- 1
group_var[indices_CFA] <- 2

# Bind that grouping variable onto the gcbs dataset
gcbs_grouped <- cbind(gcbs, group_var)

# Compare stats across groups
describeBy(gcbs_grouped, group = group_var)
## 
##  Descriptive statistics by group 
## group: 1
##           vars    n mean   sd median trimmed  mad min max range  skew
## Q1           1 1247 3.48 1.44      4    3.59 1.48   0   5     5 -0.54
## Q2           2 1247 2.99 1.48      3    2.99 1.48   0   5     5 -0.02
## Q3           3 1247 2.07 1.38      1    1.84 0.00   0   5     5  0.96
## Q4           4 1247 2.62 1.44      2    2.53 1.48   0   5     5  0.26
## Q5           5 1247 3.23 1.47      4    3.30 1.48   0   5     5 -0.33
## Q6           6 1247 3.13 1.50      3    3.16 1.48   0   5     5 -0.22
## Q7           7 1247 2.66 1.51      2    2.58 1.48   0   5     5  0.29
## Q8           8 1247 2.49 1.57      2    2.37 1.48   0   5     5  0.46
## Q9           9 1247 2.21 1.39      2    2.01 1.48   0   5     5  0.79
## Q10         10 1247 3.51 1.40      4    3.63 1.48   1   5     4 -0.59
## Q11         11 1247 3.30 1.38      4    3.38 1.48   0   5     5 -0.39
## Q12         12 1247 2.63 1.51      2    2.54 1.48   0   5     5  0.31
## Q13         13 1247 2.14 1.40      1    1.94 0.00   0   5     5  0.82
## Q14         14 1247 2.95 1.49      3    2.94 1.48   0   5     5 -0.01
## Q15         15 1247 4.24 1.11      5    4.48 0.00   1   5     4 -1.57
## group_var   16 1247 1.00 0.00      1    1.00 0.00   1   1     0   NaN
##           kurtosis   se
## Q1           -1.08 0.04
## Q2           -1.37 0.04
## Q3           -0.46 0.04
## Q4           -1.33 0.04
## Q5           -1.28 0.04
## Q6           -1.40 0.04
## Q7           -1.38 0.04
## Q8           -1.34 0.04
## Q9           -0.76 0.04
## Q10          -0.96 0.04
## Q11          -1.05 0.04
## Q12          -1.36 0.04
## Q13          -0.69 0.04
## Q14          -1.41 0.04
## Q15           1.67 0.03
## group_var      NaN 0.00
## -------------------------------------------------------- 
## group: 2
##           vars    n mean   sd median trimmed  mad min max range  skew
## Q1           1 1248 3.47 1.47      4    3.59 1.48   0   5     5 -0.55
## Q2           2 1248 2.94 1.51      3    2.93 1.48   0   5     5  0.01
## Q3           3 1248 2.03 1.39      1    1.80 0.00   0   5     5  1.00
## Q4           4 1248 2.66 1.46      2    2.57 1.48   0   5     5  0.26
## Q5           5 1248 3.28 1.47      4    3.35 1.48   0   5     5 -0.37
## Q6           6 1248 3.09 1.51      3    3.11 1.48   0   5     5 -0.11
## Q7           7 1248 2.67 1.51      2    2.59 1.48   0   5     5  0.28
## Q8           8 1248 2.41 1.57      2    2.27 1.48   0   5     5  0.57
## Q9           9 1248 2.26 1.45      2    2.08 1.48   0   5     5  0.73
## Q10         10 1248 3.50 1.38      4    3.62 1.48   1   5     4 -0.58
## Q11         11 1248 3.23 1.42      3    3.29 1.48   0   5     5 -0.31
## Q12         12 1248 2.66 1.50      2    2.58 1.48   0   5     5  0.26
## Q13         13 1248 2.06 1.37      1    1.85 0.00   0   5     5  0.95
## Q14         14 1248 2.96 1.49      3    2.95 1.48   0   5     5 -0.03
## Q15         15 1248 4.21 1.10      5    4.45 0.00   0   5     5 -1.56
## group_var   16 1248 2.00 0.00      2    2.00 0.00   2   2     0   NaN
##           kurtosis   se
## Q1           -1.13 0.04
## Q2           -1.43 0.04
## Q3           -0.43 0.04
## Q4           -1.35 0.04
## Q5           -1.26 0.04
## Q6           -1.44 0.04
## Q7           -1.40 0.04
## Q8           -1.25 0.04
## Q9           -0.89 0.04
## Q10          -0.93 0.04
## Q11          -1.17 0.04
## Q12          -1.37 0.04
## Q13          -0.42 0.04
## Q14          -1.45 0.04
## Q15           1.74 0.03
## group_var      NaN 0.00
statsBy(gcbs_grouped, group = "group_var")
## Statistics within and between groups  
## Call: statsBy(data = gcbs_grouped, group = "group_var")
## Intraclass Correlation 1 (Percentage of variance due to groups) 
##        Q1        Q2        Q3        Q4        Q5        Q6        Q7 
##         0         0         0         0         0         0         0 
##        Q8        Q9       Q10       Q11       Q12       Q13       Q14 
##         0         0         0         0         0         0         0 
##       Q15 group_var 
##         0         1 
## Intraclass Correlation 2 (Reliability of group differences) 
##        Q1        Q2        Q3        Q4        Q5        Q6        Q7 
##    -93.70     -0.60     -1.00     -1.07     -0.87     -1.35   -104.83 
##        Q8        Q9       Q10       Q11       Q12       Q13       Q14 
##      0.48     -0.36    -84.52      0.40     -2.47      0.49   -337.47 
##       Q15 group_var 
##     -1.93      1.00 
## eta^2 between groups  
##  Q1.bg  Q2.bg  Q3.bg  Q4.bg  Q5.bg  Q6.bg  Q7.bg  Q8.bg  Q9.bg Q10.bg 
##      0      0      0      0      0      0      0      0      0      0 
## Q11.bg Q12.bg Q13.bg Q14.bg Q15.bg 
##      0      0      0      0      0 
## 
## To see the correlations between and within groups, use the short=FALSE option in your print statement.
## Many results are not shown directly. To see specific objects select from the following list:
##  mean sd n F ICC1 ICC2 ci1 ci2 raw rbg pbg rwg nw pwg etabg etawg nwg nG Call
# Take a look at some correlation data
lowerCor(gcbs, use = "pairwise.complete.obs")
##     Q1   Q2   Q3   Q4   Q5   Q6   Q7   Q8   Q9   Q10 
## Q1  1.00                                             
## Q2  0.53 1.00                                        
## Q3  0.36 0.40 1.00                                   
## Q4  0.52 0.53 0.50 1.00                              
## Q5  0.48 0.46 0.40 0.57 1.00                         
## Q6  0.63 0.55 0.40 0.61 0.50 1.00                    
## Q7  0.47 0.67 0.42 0.57 0.45 0.54 1.00               
## Q8  0.39 0.38 0.78 0.49 0.41 0.41 0.41 1.00          
## Q9  0.42 0.49 0.49 0.56 0.46 0.48 0.53 0.48 1.00     
## Q10 0.44 0.38 0.32 0.40 0.43 0.41 0.39 0.36 0.37 1.00
## Q11 0.64 0.52 0.34 0.52 0.49 0.62 0.49 0.37 0.46 0.45
## Q12 0.52 0.72 0.44 0.60 0.49 0.59 0.75 0.42 0.57 0.40
## Q13 0.38 0.40 0.71 0.51 0.43 0.42 0.45 0.76 0.54 0.37
## Q14 0.53 0.50 0.43 0.60 0.54 0.55 0.52 0.45 0.55 0.41
## Q15 0.51 0.40 0.27 0.39 0.45 0.47 0.39 0.31 0.32 0.45
##     Q11  Q12  Q13  Q14  Q15 
## Q11 1.00                    
## Q12 0.55 1.00               
## Q13 0.40 0.49 1.00          
## Q14 0.56 0.56 0.50 1.00     
## Q15 0.54 0.41 0.30 0.46 1.00
# Take a look at some correlation data
corr.test(gcbs, use = "pairwise.complete.obs")$p
##                Q1            Q2            Q3            Q4            Q5
## Q1   0.000000e+00 1.038105e-175  2.525793e-74 1.746323e-174 5.801103e-143
## Q2  1.384140e-177  0.000000e+00  6.236650e-93 8.388030e-183 1.237758e-127
## Q3   3.608276e-75  3.282447e-94  0.000000e+00 1.087371e-155  1.282718e-94
## Q4  2.359896e-176 1.075388e-184 1.647531e-157  0.000000e+00 7.309882e-214
## Q5  1.054746e-144 2.578663e-129  6.108182e-96 8.032837e-216  0.000000e+00
## Q6  1.477903e-277 1.757495e-198  1.248831e-96 3.037754e-253 1.470071e-154
## Q7  8.142449e-139  0.000000e+00 5.318107e-109 5.260693e-212 2.336455e-122
## Q8   1.549786e-91  5.579984e-85  0.000000e+00 1.898345e-150 1.224898e-101
## Q9  4.344797e-106 3.376084e-148 3.104324e-151 3.108940e-210 1.462606e-133
## Q10 3.550942e-116  9.131376e-87  6.760094e-61  1.298818e-98 1.476449e-111
## Q11 9.499179e-292 1.822105e-173  2.580298e-69 9.037626e-175 2.540009e-153
## Q12 9.097129e-175  0.000000e+00 1.005698e-117 1.550592e-244 2.612164e-152
## Q13  9.052542e-87  1.297778e-96  0.000000e+00 1.798859e-167 1.168044e-111
## Q14 1.912163e-184 3.969981e-158 1.103607e-113 8.219433e-248 4.008639e-188
## Q15 9.793389e-162  3.129498e-96  1.676489e-41  1.255385e-93 3.849304e-125
##                Q6            Q7            Q8            Q9           Q10
## Q1  1.448345e-275 4.315498e-137  2.634636e-90 1.433783e-104 1.420377e-114
## Q2  1.493871e-196  0.000000e+00  6.695981e-84 1.958129e-146  1.267356e-85
## Q3   2.997195e-95 1.861338e-107  0.000000e+00 1.862595e-149  2.704037e-60
## Q4  2.916244e-251 4.734624e-210 1.120024e-148 2.766957e-208  3.376926e-97
## Q5  9.408454e-153 9.813111e-121 3.429715e-100 7.459290e-132 5.462862e-110
## Q6   0.000000e+00 2.582592e-187 1.111480e-101 4.903141e-145  2.966233e-99
## Q7  3.149502e-189  0.000000e+00 1.110564e-101 4.177923e-178  1.437786e-89
## Q8  3.704932e-103 3.582463e-103  0.000000e+00 3.981155e-142  1.778530e-78
## Q9  8.755609e-147 5.497267e-180 7.372509e-144  0.000000e+00  2.784487e-79
## Q10 1.098605e-100  9.585238e-91  2.223163e-79  3.093874e-80  0.000000e+00
## Q11 4.981130e-268 8.601767e-153  2.643708e-82 1.655959e-131 4.633595e-125
## Q12 2.403960e-231  0.000000e+00 5.764588e-109 7.071640e-216  1.561964e-98
## Q13 1.353745e-109 7.858024e-124  0.000000e+00 2.581509e-186  4.747674e-81
## Q14 7.044729e-195 6.545724e-170 2.485870e-124 2.858794e-201 3.168647e-104
## Q15 1.340087e-134  7.843219e-91  4.328489e-55  4.516727e-61 2.157366e-124
##               Q11           Q12           Q13           Q14           Q15
## Q1  9.404187e-290 6.597467e-173  1.267356e-85 1.472366e-182 6.659505e-160
## Q2  1.293694e-171  0.000000e+00  2.997195e-95 2.659887e-156  6.884895e-95
## Q3   1.548179e-68 4.123361e-116  0.000000e+00 4.304066e-112  1.676489e-41
## Q4  6.597467e-173 1.457557e-242 1.241212e-165 7.808462e-246  2.259693e-92
## Q5  1.600206e-151 1.593420e-150 4.438568e-110 3.206912e-186 1.809173e-123
## Q6  4.831696e-266 2.235683e-229 4.873482e-108 5.847125e-193 6.968453e-133
## Q7  5.333096e-151  0.000000e+00 3.378951e-122 4.582007e-168  1.254915e-89
## Q8   2.908079e-81 1.959960e-107  0.000000e+00 1.093783e-122  1.298547e-54
## Q9  8.114201e-130 6.505909e-214 2.039392e-184 2.458563e-199  2.258363e-60
## Q10 2.131454e-123  3.904910e-97  4.747674e-80 1.013967e-102 9.708145e-123
## Q11  0.000000e+00 1.571210e-193  1.584049e-94 1.610933e-205 1.319712e-186
## Q12 1.870488e-195  0.000000e+00 9.395071e-146 1.350081e-206 3.398356e-100
## Q13  7.920246e-96 1.648258e-147  0.000000e+00 6.585550e-154  2.751475e-52
## Q14 1.851647e-207 1.534183e-208 1.013162e-155  0.000000e+00 2.883420e-130
## Q15 1.629274e-188 1.171847e-101  1.375737e-52 5.766839e-132  0.000000e+00
# Take a look at some correlation data
corr.test(gcbs, use = "pairwise.complete.obs")$ci
##             lower         r     upper             p
## Q1-Q2   0.4970162 0.5259992 0.5538098 1.384140e-177
## Q1-Q3   0.3206223 0.3553928 0.3892067  3.608276e-75
## Q1-Q4   0.4953852 0.5244323 0.5523079 2.359896e-176
## Q1-Q5   0.4503342 0.4810747 0.5106759 1.054746e-144
## Q1-Q6   0.6071117 0.6313131 0.6543444 1.477903e-277
## Q1-Q7   0.4412058 0.4722710 0.5022057 8.142449e-139
## Q1-Q8   0.3564216 0.3902059 0.4229712  1.549786e-91
## Q1-Q9   0.3850453 0.4179718 0.4498355 4.344797e-106
## Q1-Q10  0.4034438 0.4357865 0.4670415 3.550942e-116
## Q1-Q11  0.6199265 0.6435136 0.6659388 9.499179e-292
## Q1-Q12  0.4932727 0.5224025 0.5503620 9.097129e-175
## Q1-Q13  0.3464313 0.3805006 0.4135673  9.052542e-87
## Q1-Q14  0.5059498 0.5345780 0.5620298 1.912163e-184
## Q1-Q15  0.4753633 0.5051815 0.5338405 9.793389e-162
## Q2-Q3   0.3618855 0.3955108 0.4281083  3.282447e-94
## Q2-Q4   0.5062706 0.5348860 0.5623248 1.075388e-184
## Q2-Q5   0.4259018 0.4574975 0.4879788 2.578663e-129
## Q2-Q6   0.5234810 0.5513960 0.5781285 1.757495e-198
## Q2-Q7   0.6501266 0.6722188 0.6931753  0.000000e+00
## Q2-Q8   0.3425926 0.3767693 0.4099501  5.579984e-85
## Q2-Q9   0.4556319 0.4861810 0.5155863 3.376084e-148
## Q2-Q10  0.3464233 0.3804928 0.4135598  9.131376e-87
## Q2-Q11  0.4915283 0.5207263 0.5487548 1.822105e-173
## Q2-Q12  0.6962013 0.7158851 0.7344931  0.000000e+00
## Q2-Q13  0.3667134 0.4001964 0.4326439  1.297778e-96
## Q2-Q14  0.4702225 0.5002339 0.5290898 3.969981e-158
## Q2-Q15  0.3659505 0.3994560 0.4319274  3.129498e-96
## Q3-Q4   0.4693335 0.4993781 0.5282679 1.647531e-157
## Q3-Q5   0.3653695 0.3988923 0.4313817  6.108182e-96
## Q3-Q6   0.3667467 0.4002287 0.4326752  1.248831e-96
## Q3-Q7   0.3904688 0.4232258 0.4549125 5.318107e-109
## Q3-Q8   0.7683496 0.7839542 0.7986273  0.000000e+00
## Q3-Q9   0.4601647 0.4905484 0.5197845 3.104324e-151
## Q3-Q10  0.2853436 0.3209913 0.3557521  6.760094e-61
## Q3-Q11  0.3066780 0.3418064 0.3760050  2.580298e-69
## Q3-Q12  0.4061739 0.4384278 0.4695906 1.005698e-117
## Q3-Q13  0.6919756 0.7118867 0.7307155  0.000000e+00
## Q3-Q14  0.3989973 0.4314834 0.4628876 1.103607e-113
## Q3-Q15  0.2285790 0.2654400 0.3015410  1.676489e-41
## Q4-Q5   0.5438704 0.5709273 0.5967985 8.032837e-216
## Q4-Q6   0.5837641 0.6090539 0.6331630 3.037754e-253
## Q4-Q7   0.5394959 0.5667395 0.5927977 5.260693e-212
## Q4-Q8   0.4589969 0.4894234 0.5187032 1.898345e-150
## Q4-Q9   0.5374441 0.5647747 0.5909202 3.108940e-210
## Q4-Q10  0.3706739 0.4040387 0.4363621  1.298818e-98
## Q4-Q11  0.4932765 0.5224062 0.5503655 9.037626e-175
## Q4-Q12  0.5749365 0.6006273 0.6251350 1.550592e-244
## Q4-Q13  0.4833700 0.5128834 0.5412322 1.798859e-167
## Q4-Q14  0.5782876 0.6038268 0.6281838 8.219433e-248
## Q4-Q15  0.3607035 0.3943633 0.4269973  1.255385e-93
## Q5-Q6   0.4650551 0.4952588 0.5243108 1.470071e-154
## Q5-Q7   0.4142088 0.4461981 0.4770864 2.336455e-122
## Q5-Q8   0.3765708 0.4097576 0.4418941 1.224898e-101
## Q5-Q9   0.4328328 0.4641904 0.4944261 1.462606e-133
## Q5-Q10  0.3951535 0.4277623 0.4592945 1.476449e-111
## Q5-Q11  0.4632435 0.4935141 0.5226345 2.540009e-153
## Q5-Q12  0.4617541 0.4920795 0.5212560 2.612164e-152
## Q5-Q13  0.3953385 0.4279414 0.4594675 1.168044e-111
## Q5-Q14  0.5106389 0.5390785 0.5663399 4.008639e-188
## Q5-Q15  0.4189383 0.4507697 0.4814945 3.849304e-125
## Q6-Q7   0.5120337 0.5404170 0.5676214 3.149502e-189
## Q6-Q8   0.3794902 0.4125879 0.4446310 3.704932e-103
## Q6-Q9   0.4534992 0.4841255 0.5136099 8.755609e-147
## Q6-Q10  0.3747259 0.4079687 0.4401639 1.098605e-100
## Q6-Q11  0.5981808 0.6228032 0.6462508 4.981130e-268
## Q6-Q12  0.5610551 0.5873651 0.6124896 2.403960e-231
## Q6-Q13  0.3915639 0.4242864 0.4559371 1.353745e-109
## Q6-Q14  0.5190730 0.5471694 0.5740847 7.044729e-195
## Q6-Q15  0.4345044 0.4658040 0.4959800 1.340087e-134
## Q7-Q8   0.3795181 0.4126150 0.4446571 3.582463e-103
## Q7-Q9   0.5001718 0.5290301 0.5567146 5.497267e-180
## Q7-Q10  0.3547857 0.3886172 0.4214323  9.585238e-91
## Q7-Q11  0.4624648 0.4927641 0.5219138 8.601767e-153
## Q7-Q12  0.7365820 0.7540288 0.7704729  0.000000e+00
## Q7-Q13  0.4167211 0.4486267 0.4794284 7.858024e-124
## Q7-Q14  0.4867147 0.5160994 0.5443174 6.545724e-170
## Q7-Q15  0.3549662 0.3887925 0.4216021  7.843219e-91
## Q8-Q9   0.4490408 0.4798277 0.5094765 7.372509e-144
## Q8-Q10  0.3302521 0.3647668 0.3983073  2.223163e-79
## Q8-Q11  0.3367608 0.3710987 0.4044508  2.643708e-82
## Q8-Q12  0.3904041 0.4231631 0.4548520 5.764588e-109
## Q8-Q13  0.7398147 0.7570774 0.7733440  0.000000e+00
## Q8-Q14  0.4175690 0.4494462 0.4802185 2.485870e-124
## Q8-Q15  0.2696028 0.3056115 0.3407668  4.328489e-55
## Q9-Q10  0.3321729 0.3666358 0.4001210  3.093874e-80
## Q9-Q11  0.4294991 0.4609717 0.4913259 1.655959e-131
## Q9-Q12  0.5439334 0.5709876 0.5968561 7.071640e-216
## Q9-Q13  0.5083417 0.5368740 0.5642288 2.581509e-186
## Q9-Q14  0.5268510 0.5546263 0.5812182 2.858794e-201
## Q9-Q15  0.2858045 0.3214413 0.3561903  4.516727e-61
## Q10-Q11 0.4188025 0.4506384 0.4813679 4.633595e-125
## Q10-Q12 0.3705162 0.4038857 0.4362140  1.561964e-98
## Q10-Q13 0.3339871 0.3684007 0.4018335  4.747674e-81
## Q10-Q14 0.3815258 0.4145611 0.4465387 3.168647e-104
## Q10-Q15 0.4176732 0.4495470 0.4803157 2.157366e-124
## Q11-Q12 0.5197817 0.5478491 0.5747350 1.870488e-195
## Q11-Q13 0.3651436 0.3986730 0.4311694  7.920246e-96
## Q11-Q14 0.5342028 0.5616704 0.5879532 1.851647e-207
## Q11-Q15 0.5111332 0.5395529 0.5667941 1.629274e-188
## Q12-Q13 0.4545949 0.4851817 0.5146255 1.648258e-147
## Q12-Q14 0.5354702 0.5628844 0.5891136 1.534183e-208
## Q12-Q15 0.3766079 0.4097936 0.4419289 1.171847e-101
## Q13-Q14 0.4667464 0.4968874 0.5258754 1.013162e-155
## Q13-Q15 0.2625236 0.2986885 0.3340155  1.375737e-52
## Q14-Q15 0.4302457 0.4616926 0.4920203 5.766839e-132
# Estimate coefficient alpha
alpha(gcbs)
## 
## Reliability analysis   
## Call: alpha(x = gcbs)
## 
##   raw_alpha std.alpha G6(smc) average_r S/N   ase mean sd median_r
##       0.93      0.93    0.94      0.48  14 0.002  2.9  1     0.47
## 
##  lower alpha upper     95% confidence boundaries
## 0.93 0.93 0.94 
## 
##  Reliability if an item is dropped:
##     raw_alpha std.alpha G6(smc) average_r S/N alpha se  var.r med.r
## Q1       0.93      0.93    0.94      0.48  13   0.0021 0.0105  0.46
## Q2       0.93      0.93    0.94      0.48  13   0.0021 0.0099  0.47
## Q3       0.93      0.93    0.94      0.49  13   0.0020 0.0084  0.48
## Q4       0.93      0.93    0.94      0.47  13   0.0022 0.0105  0.46
## Q5       0.93      0.93    0.94      0.48  13   0.0021 0.0112  0.48
## Q6       0.93      0.93    0.94      0.48  13   0.0021 0.0104  0.46
## Q7       0.93      0.93    0.94      0.48  13   0.0021 0.0098  0.47
## Q8       0.93      0.93    0.94      0.48  13   0.0020 0.0086  0.49
## Q9       0.93      0.93    0.94      0.48  13   0.0021 0.0108  0.46
## Q10      0.93      0.93    0.94      0.49  14   0.0020 0.0102  0.49
## Q11      0.93      0.93    0.94      0.48  13   0.0021 0.0104  0.46
## Q12      0.93      0.93    0.94      0.47  13   0.0022 0.0093  0.46
## Q13      0.93      0.93    0.94      0.48  13   0.0021 0.0092  0.48
## Q14      0.93      0.93    0.94      0.48  13   0.0021 0.0109  0.46
## Q15      0.93      0.93    0.94      0.49  14   0.0020 0.0095  0.49
## 
##  Item statistics 
##        n raw.r std.r r.cor r.drop mean  sd
## Q1  2495  0.73  0.73  0.70   0.68  3.5 1.5
## Q2  2495  0.74  0.74  0.72   0.69  3.0 1.5
## Q3  2495  0.68  0.67  0.66   0.62  2.0 1.4
## Q4  2495  0.78  0.78  0.76   0.74  2.6 1.5
## Q5  2495  0.70  0.70  0.67   0.65  3.3 1.5
## Q6  2495  0.76  0.76  0.74   0.72  3.1 1.5
## Q7  2495  0.75  0.75  0.73   0.70  2.7 1.5
## Q8  2495  0.69  0.69  0.68   0.63  2.5 1.6
## Q9  2495  0.72  0.72  0.69   0.67  2.2 1.4
## Q10 2495  0.61  0.61  0.57   0.55  3.5 1.4
## Q11 2495  0.74  0.74  0.72   0.69  3.3 1.4
## Q12 2495  0.79  0.79  0.79   0.75  2.6 1.5
## Q13 2495  0.71  0.71  0.70   0.66  2.1 1.4
## Q14 2495  0.76  0.76  0.74   0.71  3.0 1.5
## Q15 2495  0.60  0.62  0.58   0.56  4.2 1.1
## 
## Non missing response frequency for each item
##        0    1    2    3    4    5 miss
## Q1  0.00 0.16 0.12 0.12 0.27 0.32    0
## Q2  0.01 0.23 0.19 0.16 0.20 0.22    0
## Q3  0.00 0.55 0.13 0.12 0.10 0.10    0
## Q4  0.00 0.32 0.18 0.15 0.20 0.14    0
## Q5  0.00 0.19 0.14 0.13 0.28 0.26    0
## Q6  0.00 0.23 0.15 0.15 0.23 0.24    0
## Q7  0.00 0.33 0.19 0.13 0.18 0.17    0
## Q8  0.00 0.44 0.12 0.14 0.12 0.18    0
## Q9  0.00 0.45 0.19 0.12 0.12 0.11    0
## Q10 0.00 0.14 0.12 0.14 0.30 0.30    0
## Q11 0.00 0.16 0.14 0.19 0.27 0.24    0
## Q12 0.00 0.34 0.18 0.15 0.17 0.17    0
## Q13 0.01 0.51 0.15 0.15 0.10 0.09    0
## Q14 0.00 0.25 0.17 0.15 0.22 0.20    0
## Q15 0.00 0.05 0.05 0.08 0.27 0.55    0
# Calculate split-half reliability
splitHalf(gcbs)
## Split half reliabilities  
## Call: splitHalf(r = gcbs)
## 
## Maximum split half reliability (lambda 4) =  0.95
## Guttman lambda 6                          =  0.94
## Average split half reliability            =  0.93
## Guttman lambda 3 (alpha)                  =  0.93
## Minimum split half reliability  (beta)    =  0.86
## Average interitem r =  0.48  with median =  0.47

Chapter 2 - Multidimensional EFA

Determining dimensionality:

  • Can use factor analysis to find the “true” number of dimensions being reflected in the data
  • Can use the bfi dataset (“Big Five” personality trait dataset)
    • Six point scale with 1 being very inaccurate and 6 being very accurate
  • Suppose that you do not have a theory underlying the data and instead want to use an empirical approach with eigenvalues
    • bfi_EFA_cor <- cor(bfi_EFA, use = “pairwise.complete.obs”)
    • eigenvals <- eigen(bfi_EFA_cor)
    • eigenvals$values
    • scree(bfi_EFA_cor, factors = FALSE) # eigenvalues greater than 1 are typically the best to use

Understanding multidimensional data:

  • Theory and empirical data may lead to different outcomes - constructs for psychology are an example
  • Factors are the mathematical counterpart of a theoretical construct
    • How well does the hypothesis fit with the data?
  • Can instead run exploratory analysis to try to come up with factors
    • Lack of theoretical grounding can make interpretation of the results complicated
  • Can run the multidimensional analysis using any number of factors
    • EFA_model <- fa(bfi_EFA, nfactors = 6)
    • EFA_model$loadings
    • head(EFA_model$scores)

Investigating model fit:

  • Can look at absolute fit (adequate fit with typical ranges and cutoff values) and relative fit (no set ranges, used mainly for nested models from the same dataset)
  • Goal is to have a non-significant chi-squared test, though that is rare for large datasets
  • The TLI (Tucker-Lewis) should be 0.90+
  • The RMSEA (RMSE approximation) should be 0.05-
  • The BIC is a relative-fit statistic, so it is meaningful only to compare across models (lower BIC is better)
    • bfi_theory <- fa(bfi_EFA, nfactors = 5)
    • bfi_eigen <- fa(bfi_EFA, nfactors = 6)
    • bfi_theory$BIC
    • bfi_eigen$BIC

Example code includes:

data(bfi, package="psych")
glimpse(bfi)
## Observations: 2,800
## Variables: 28
## $ A1        <int> 2, 2, 5, 4, 2, 6, 2, 4, 4, 2, 4, 2, 5, 5, 4, 4, 4, 5...
## $ A2        <int> 4, 4, 4, 4, 3, 6, 5, 3, 3, 5, 4, 5, 5, 5, 5, 3, 6, 5...
## $ A3        <int> 3, 5, 5, 6, 3, 5, 5, 1, 6, 6, 5, 5, 5, 5, 2, 6, 6, 5...
## $ A4        <int> 4, 2, 4, 5, 4, 6, 3, 5, 3, 6, 6, 5, 6, 6, 2, 6, 2, 4...
## $ A5        <int> 4, 5, 4, 5, 5, 5, 5, 1, 3, 5, 5, 5, 4, 6, 1, 3, 5, 5...
## $ C1        <int> 2, 5, 4, 4, 4, 6, 5, 3, 6, 6, 4, 5, 5, 4, 5, 5, 4, 5...
## $ C2        <int> 3, 4, 5, 4, 4, 6, 4, 2, 6, 5, 3, 4, 4, 4, 5, 5, 4, 5...
## $ C3        <int> 3, 4, 4, 3, 5, 6, 4, 4, 3, 6, 5, 5, 3, 4, 5, 5, 4, 5...
## $ C4        <int> 4, 3, 2, 5, 3, 1, 2, 2, 4, 2, 3, 4, 2, 2, 2, 3, 4, 4...
## $ C5        <int> 4, 4, 5, 5, 2, 3, 3, 4, 5, 1, 2, 5, 2, 1, 2, 5, 4, 3...
## $ E1        <int> 3, 1, 2, 5, 2, 2, 4, 3, 5, 2, 1, 3, 3, 2, 3, 1, 1, 2...
## $ E2        <int> 3, 1, 4, 3, 2, 1, 3, 6, 3, 2, 3, 3, 3, 2, 4, 1, 2, 2...
## $ E3        <int> 3, 6, 4, 4, 5, 6, 4, 4, NA, 4, 2, 4, 3, 4, 3, 6, 5, ...
## $ E4        <int> 4, 4, 4, 4, 4, 5, 5, 2, 4, 5, 5, 5, 2, 6, 6, 6, 5, 6...
## $ E5        <int> 4, 3, 5, 4, 5, 6, 5, 1, 3, 5, 4, 4, 4, 5, 5, 4, 5, 6...
## $ N1        <int> 3, 3, 4, 2, 2, 3, 1, 6, 5, 5, 3, 4, 1, 1, 2, 4, 4, 6...
## $ N2        <int> 4, 3, 5, 5, 3, 5, 2, 3, 5, 5, 3, 5, 2, 1, 4, 5, 4, 5...
## $ N3        <int> 2, 3, 4, 2, 4, 2, 2, 2, 2, 5, 4, 3, 2, 1, 2, 4, 4, 5...
## $ N4        <int> 2, 5, 2, 4, 4, 2, 1, 6, 3, 2, 2, 2, 2, 2, 2, 5, 4, 4...
## $ N5        <int> 3, 5, 3, 1, 3, 3, 1, 4, 3, 4, 3, NA, 2, 1, 3, 5, 5, ...
## $ O1        <int> 3, 4, 4, 3, 3, 4, 5, 3, 6, 5, 5, 4, 4, 5, 5, 6, 5, 5...
## $ O2        <int> 6, 2, 2, 3, 3, 3, 2, 2, 6, 1, 3, 6, 2, 3, 2, 6, 1, 1...
## $ O3        <int> 3, 4, 5, 4, 4, 5, 5, 4, 6, 5, 5, 4, 4, 4, 5, 6, 5, 4...
## $ O4        <int> 4, 3, 5, 3, 3, 6, 6, 5, 6, 5, 6, 5, 5, 4, 5, 3, 6, 5...
## $ O5        <int> 3, 3, 2, 5, 3, 1, 1, 3, 1, 2, 3, 4, 2, 4, 5, 2, 3, 4...
## $ gender    <int> 1, 2, 2, 2, 1, 2, 1, 1, 1, 2, 1, 1, 2, 1, 1, 1, 2, 1...
## $ education <int> NA, NA, NA, NA, NA, 3, NA, 2, 1, NA, 1, NA, NA, NA, ...
## $ age       <int> 16, 18, 17, 17, 17, 21, 18, 19, 19, 17, 21, 16, 16, ...
# Establish two sets of indices to split the dataset
N <- nrow(bfi)
indices <- seq(1, N)
indices_EFA <- sample(indices, floor((.5*N)))
indices_CFA <- indices[!(indices %in% indices_EFA)]

# Use those indices to split the dataset into halves for your EFA and CFA
bfi_EFA <- bfi[indices_EFA, ]
bfi_CFA <- bfi[indices_CFA, ]


# Calculate the correlation matrix first
bfi_EFA_cor <- cor(bfi_EFA, use = "pairwise.complete.obs")

# Then use that correlation matrix to calculate eigenvalues
eigenvals <- eigen(bfi_EFA_cor)

# Look at the eigenvalues returned
eigenvals$values
##  [1] 5.0300529 2.8855687 2.1326114 1.8423851 1.5839370 1.3565596 1.1281967
##  [8] 0.8876166 0.8368945 0.7759991 0.7411295 0.7223954 0.6965653 0.6688663
## [15] 0.6495947 0.6406188 0.5569057 0.5550641 0.5408830 0.5243398 0.4913524
## [22] 0.4769243 0.4467000 0.4206217 0.4021440 0.3781987 0.3609526 0.2669220
# Then use that correlation matrix to create the scree plot
scree(bfi_EFA_cor, factors = FALSE)

# Run the EFA with six factors (as indicated by your scree plot)
EFA_model <- fa(bfi_EFA, nfactors=6)
## Loading required namespace: GPArotation
# View results from the model object
EFA_model
## Factor Analysis using method =  minres
## Call: fa(r = bfi_EFA, nfactors = 6)
## Standardized loadings (pattern matrix) based upon correlation matrix
##             MR2   MR5   MR3   MR1   MR4   MR6    h2   u2 com
## A1         0.07 -0.39  0.05 -0.03  0.02  0.51 0.401 0.60 1.9
## A2         0.04  0.60  0.09 -0.04  0.05 -0.19 0.445 0.56 1.3
## A3        -0.04  0.65  0.03 -0.06  0.05 -0.01 0.484 0.52 1.0
## A4        -0.07  0.44  0.19 -0.06 -0.12  0.02 0.267 0.73 1.6
## A5        -0.17  0.59  0.01 -0.12  0.10  0.08 0.494 0.51 1.4
## C1         0.04  0.00  0.54  0.12  0.20  0.10 0.367 0.63 1.4
## C2         0.06  0.12  0.59  0.21  0.11  0.17 0.440 0.56 1.6
## C3         0.01  0.11  0.54  0.12  0.01  0.09 0.316 0.68 1.2
## C4         0.07  0.05 -0.69  0.11  0.04  0.19 0.553 0.45 1.2
## C5         0.11  0.00 -0.57  0.19  0.10  0.01 0.430 0.57 1.4
## E1        -0.13 -0.14  0.07  0.58 -0.10  0.07 0.395 0.61 1.3
## E2         0.07 -0.09 -0.03  0.69 -0.10  0.03 0.593 0.41 1.1
## E3         0.06  0.26 -0.02 -0.30  0.41  0.13 0.471 0.53 2.9
## E4        -0.04  0.38  0.01 -0.48  0.01  0.26 0.567 0.43 2.5
## E5         0.15  0.07  0.24 -0.35  0.31  0.03 0.398 0.60 3.3
## N1         0.80 -0.10 -0.01 -0.09 -0.03  0.04 0.641 0.36 1.1
## N2         0.83 -0.10  0.02 -0.08  0.01 -0.03 0.661 0.34 1.1
## N3         0.70  0.10 -0.07  0.12  0.04  0.02 0.568 0.43 1.1
## N4         0.43  0.08 -0.15  0.38  0.05 -0.04 0.458 0.54 2.3
## N5         0.53  0.22  0.01  0.21 -0.15  0.04 0.419 0.58 1.9
## O1        -0.05 -0.01  0.04  0.00  0.58  0.08 0.358 0.64 1.1
## O2         0.13  0.19 -0.10  0.01 -0.38  0.24 0.254 0.75 2.7
## O3        -0.01  0.06  0.01 -0.07  0.67  0.02 0.507 0.49 1.0
## O4         0.11  0.17 -0.03  0.39  0.35 -0.06 0.279 0.72 2.6
## O5         0.05  0.10 -0.05 -0.01 -0.46  0.28 0.293 0.71 1.8
## gender     0.24  0.23  0.14 -0.11 -0.17 -0.17 0.154 0.85 4.8
## education  0.00 -0.08  0.04 -0.01  0.09 -0.21 0.057 0.94 1.8
## age       -0.03  0.04  0.10 -0.11 -0.01 -0.28 0.109 0.89 1.7
## 
##                        MR2  MR5  MR3  MR1  MR4  MR6
## SS loadings           2.58 2.14 2.05 2.01 1.82 0.78
## Proportion Var        0.09 0.08 0.07 0.07 0.07 0.03
## Cumulative Var        0.09 0.17 0.24 0.31 0.38 0.41
## Proportion Explained  0.23 0.19 0.18 0.18 0.16 0.07
## Cumulative Proportion 0.23 0.41 0.59 0.77 0.93 1.00
## 
##  With factor correlations of 
##       MR2   MR5   MR3   MR1   MR4   MR6
## MR2  1.00 -0.03 -0.21  0.23 -0.02  0.11
## MR5 -0.03  1.00  0.18 -0.26  0.24  0.03
## MR3 -0.21  0.18  1.00 -0.17  0.22  0.00
## MR1  0.23 -0.26 -0.17  1.00 -0.18 -0.05
## MR4 -0.02  0.24  0.22 -0.18  1.00  0.03
## MR6  0.11  0.03  0.00 -0.05  0.03  1.00
## 
## Mean item complexity =  1.8
## Test of the hypothesis that 6 factors are sufficient.
## 
## The degrees of freedom for the null model are  378  and the objective function was  7.67 with Chi Square of  10648.54
## The degrees of freedom for the model are 225  and the objective function was  0.6 
## 
## The root mean square of the residuals (RMSR) is  0.02 
## The df corrected root mean square of the residuals is  0.03 
## 
## The harmonic number of observations is  1375 with the empirical chi square  624.42  with prob <  2.9e-39 
## The total number of observations was  1400  with Likelihood Chi Square =  836.09  with prob <  3.8e-71 
## 
## Tucker Lewis Index of factoring reliability =  0.9
## RMSEA index =  0.044  and the 90 % confidence intervals are  0.041 0.047
## BIC =  -793.86
## Fit based upon off diagonal values = 0.98
## Measures of factor score adequacy             
##                                                    MR2  MR5  MR3  MR1  MR4
## Correlation of (regression) scores with factors   0.93 0.89 0.88 0.89 0.86
## Multiple R square of scores with factors          0.86 0.78 0.78 0.78 0.75
## Minimum correlation of possible factor scores     0.72 0.57 0.56 0.57 0.50
##                                                    MR6
## Correlation of (regression) scores with factors   0.75
## Multiple R square of scores with factors          0.56
## Minimum correlation of possible factor scores     0.12
# Run the EFA with six factors (as indicated by your scree plot)
EFA_model <- fa(bfi_EFA, nfactors=6)

# View items' factor loadings
EFA_model$loadings
## 
## Loadings:
##           MR2    MR5    MR3    MR1    MR4    MR6   
## A1               -0.391                       0.510
## A2                0.600                      -0.192
## A3                0.651                            
## A4                0.440  0.187        -0.124       
## A5        -0.166  0.588        -0.121  0.100       
## C1                       0.542  0.115  0.198       
## C2                0.119  0.591  0.209  0.112  0.170
## C3                0.105  0.539  0.124              
## C4                      -0.687  0.107         0.191
## C5         0.107        -0.573  0.193  0.102       
## E1        -0.125 -0.139         0.576              
## E2                              0.692              
## E3                0.260        -0.296  0.408  0.126
## E4                0.376        -0.479         0.255
## E5         0.151         0.241 -0.354  0.309       
## N1         0.803 -0.101                            
## N2         0.829                                   
## N3         0.695                0.124              
## N4         0.434        -0.148  0.382              
## N5         0.532  0.216         0.208 -0.152       
## O1                                     0.578       
## O2         0.132  0.189               -0.382  0.242
## O3                                     0.674       
## O4         0.108  0.171         0.386  0.353       
## O5                0.103               -0.463  0.281
## gender     0.240  0.232  0.143 -0.109 -0.173 -0.168
## education                                    -0.210
## age                      0.103 -0.108        -0.276
## 
##                  MR2   MR5   MR3   MR1   MR4   MR6
## SS loadings    2.490 1.965 1.919 1.796 1.715 0.777
## Proportion Var 0.089 0.070 0.069 0.064 0.061 0.028
## Cumulative Var 0.089 0.159 0.228 0.292 0.353 0.381
# View the first few lines of examinees' factor scores
head(EFA_model$scores)
##              MR2        MR5         MR3         MR1        MR4        MR6
## 62551         NA         NA          NA          NA         NA         NA
## 67093 -0.7724195  0.5611340 -0.98862424 -0.35665187  0.4818819 1.16616564
## 62162 -1.1613038  0.7091861  0.01602322  0.25442770 -0.3954765 0.61004704
## 61896 -0.1630297  0.3951015  0.20243968 -0.88470545  0.1207347 0.04158926
## 67438  0.1715825 -1.5105203 -0.13152183  0.09266676 -0.3904054 1.04839765
## 63328  1.3551168  0.5068694  1.21405963 -0.52823218  0.7409618 0.74609206
# Run each theorized EFA on your dataset
bfi_theory <- fa(bfi_EFA, nfactors = 5)
bfi_eigen <- fa(bfi_EFA, nfactors = 6)

# Compare the BIC values
bfi_theory$BIC
## [1] -511.141
bfi_eigen$BIC
## [1] -793.8647

Chapter 3 - Confirmatory Factor Analysis

Setting up CFA:

  • Confirmatory analysis is based on explicitly defined factor relationships, to confirm a previously developed theory
  • Can use the results from an EFA as the baseline for a CFA; for example, reversing the wording of items with a negative loading
    • EFA_syn <- structure.sem(EFA_model)
    • EFA_syn # Path goes from factor to item, while an NA for Value means that the starting parameter will be chosen randomly
  • Can also create CFA syntax from theory explicitly, for example
    • theory_syn_eq <- "
    • AGE: A1, A2, A3, A4, A5 #Agreeableness
    • CON: C1, C2, C3, C4, C5 #Conscientiousness
    • EXT: E1, E2, E3, E4, E5 #Extraversion
    • NEU: N1, N2, N3, N4, N5 #Neuroticism
    • OPE: O1, O2, O3, O4, O5 #Openness
    • "
    • theory_syn <- cfa(text = theory_syn_eq, reference.indicators = FALSE) # sets the factor variances to 1 rather than estimating them

Understanding the sem() syntax:

  • Syntax will show the Path, Parameter, and Starting Value
    • Factor variances are shown using <-> arrows, with Start Value of 1 since they have been fixed as 1
    • Factor covariances also use <-> arrows
    • Item-level variances are also shown using <-> arrows
  • Can run the model using the sem() function with the syntax object
    • theory_CFA <- sem(theory_syn, data = bfi_CFA)
    • summary(theory_CFA)

Investigating model fit:

  • The chi-squared test (log-likelihood test) is the only test printed by default, though it will usually be significant for a large dataset size
  • Can change the global options so that additional tests are run
    • options(fit.indices = c(“CFI”, “GFI”, “RMSEA”, “BIC”))
    • summary(theory_CFA)
    • summary(theory_CFA)$BIC # lower BIC is preferred, but is only useful for nested models on the same dataset

Example code includes:

# Conduct a five-factor EFA on the EFA half of the dataset
EFA_model <- fa(bfi_EFA, nfactors = 5)

# Use the wrapper function to create syntax for use with the sem() function
EFA_syn <- structure.sem(EFA_model)


# Set up syntax specifying which items load onto each factor
theory_syn_eq <- "
AGE: A1, A2, A3, A4, A5
CON: C1, C2, C3, C4, C5
EXT: E1, E2, E3, E4, E5
NEU: N1, N2, N3, N4, N5
OPE: O1, O2, O3, O4, O5
"

library(sem)
## 
## Attaching package: 'sem'
## The following objects are masked from 'package:lavaan':
## 
##     cfa, sem
# Feed the syntax in to have variances and covariances automatically added
theory_syn <- cfa(text = theory_syn_eq, reference.indicators = FALSE)
## NOTE: adding 25 variances to the model
# Use the sem() function to run a CFA
theory_CFA <- sem(theory_syn, data = bfi_CFA)
## Warning in sem.semmod(theory_syn, data = bfi_CFA): -289 observations
## removed due to missingness
## Warning in sem.semmod(theory_syn, data = bfi_CFA): The following observed variables are in the input covariance or raw-moment matrix but do not appear in the model:
## gender, education, age
# Use the summary function to view fit information and parameter estimates
summary(theory_CFA)
## 
##  Model Chisquare =  2005.016   Df =  265 Pr(>Chisq) = 2.150816e-264
##  AIC =  2125.016
##  BIC =  146.5663
## 
##  Normalized Residuals
##    Min. 1st Qu.  Median    Mean 3rd Qu.    Max. 
## -6.8135 -0.5790  0.7005  0.9165  2.3369  9.1189 
## 
##  R-square for Endogenous Variables
##     A1     A2     A3     A4     A5     C1     C2     C3     C4     C5 
## 0.1177 0.4221 0.5726 0.2652 0.4584 0.3015 0.3895 0.2854 0.4763 0.3806 
##     E1     E2     E3     E4     E5     N1     N2     N3     N4     N5 
## 0.3100 0.4955 0.4090 0.5185 0.3099 0.6809 0.6209 0.5142 0.3434 0.2209 
##     O1     O2     O3     O4     O5 
## 0.3230 0.2294 0.4473 0.0615 0.2625 
## 
##  Parameter Estimates
##             Estimate    Std Error  z value    Pr(>|z|)                  
## lam[A1:AGE] -0.47310342 0.04469539 -10.585060  3.495553e-26 A1 <--- AGE 
## lam[A2:AGE]  0.74682312 0.03424190  21.810210 1.856211e-105 A2 <--- AGE 
## lam[A3:AGE]  0.97246742 0.03690975  26.347171 5.530212e-153 A3 <--- AGE 
## lam[A4:AGE]  0.73031369 0.04413591  16.546928  1.684830e-61 A4 <--- AGE 
## lam[A5:AGE]  0.84567717 0.03685897  22.943592 1.707357e-116 A5 <--- AGE 
## lam[C1:CON] -0.67102860 0.03893437 -17.234866  1.453902e-66 C1 <--- CON 
## lam[C2:CON] -0.81745260 0.04090714 -19.983130  7.722751e-89 C2 <--- CON 
## lam[C3:CON] -0.67484497 0.04040327 -16.702731  1.252010e-62 C3 <--- CON 
## lam[C4:CON]  0.94244534 0.04196174  22.459632 1.030377e-111 C4 <--- CON 
## lam[C5:CON]  1.00338850 0.05089376  19.715355  1.591951e-86 C5 <--- CON 
## lam[E1:EXT]  0.88897886 0.04856677  18.304263  7.652070e-75 E1 <--- EXT 
## lam[E2:EXT]  1.12282478 0.04596055  24.430185 8.174273e-132 E2 <--- EXT 
## lam[E3:EXT] -0.86265804 0.03985228 -21.646390 6.573210e-104 E3 <--- EXT 
## lam[E4:EXT] -1.04778146 0.04165946 -25.151108 1.374315e-139 E4 <--- EXT 
## lam[E5:EXT] -0.73878674 0.04037337 -18.298864  8.449171e-75 E5 <--- EXT 
## lam[N1:NEU]  1.28350486 0.04147064  30.949724 2.562431e-210 N1 <--- NEU 
## lam[N2:NEU]  1.20126201 0.04131090  29.078570 6.700813e-186 N2 <--- NEU 
## lam[N3:NEU]  1.15489837 0.04498842  25.671017 2.463597e-145 N3 <--- NEU 
## lam[N4:NEU]  0.92407395 0.04646996  19.885404  5.444165e-88 N4 <--- NEU 
## lam[N5:NEU]  0.76200858 0.04958272  15.368429  2.665543e-53 N5 <--- NEU 
## lam[O1:OPE]  0.62901029 0.03848638  16.343713  4.822431e-60 O1 <--- OPE 
## lam[O2:OPE] -0.75677801 0.05522087 -13.704565  9.533735e-43 O2 <--- OPE 
## lam[O3:OPE]  0.79299695 0.04156934  19.076487  3.959980e-81 O3 <--- OPE 
## lam[O4:OPE]  0.30437169 0.04406913   6.906687  4.961028e-12 O4 <--- OPE 
## lam[O5:OPE] -0.68830815 0.04680655 -14.705379  5.953631e-49 O5 <--- OPE 
## C[AGE,CON]  -0.33903475 0.03616712  -9.374116  6.975805e-21 CON <--> AGE
## C[AGE,EXT]  -0.71675158 0.02419566 -29.623150 7.522744e-193 EXT <--> AGE
## C[AGE,NEU]  -0.23767064 0.03540025  -6.713812  1.896045e-11 NEU <--> AGE
## C[AGE,OPE]   0.23285485 0.04030234   5.777700  7.572854e-09 OPE <--> AGE
## C[CON,EXT]   0.38058118 0.03501044  10.870507  1.593130e-27 EXT <--> CON
## C[CON,NEU]   0.25969556 0.03567111   7.280277  3.331352e-13 NEU <--> CON
## C[CON,OPE]  -0.28622586 0.04021418  -7.117536  1.098734e-12 OPE <--> CON
## C[EXT,NEU]   0.27605059 0.03454400   7.991276  1.335494e-15 NEU <--> EXT
## C[EXT,OPE]  -0.34443896 0.03822892  -9.009905  2.062345e-19 OPE <--> EXT
## C[NEU,OPE]  -0.09901255 0.03959699  -2.500507  1.240156e-02 OPE <--> NEU
## V[A1]        1.67705932 0.07357444  22.794048 5.252890e-115 A1 <--> A1  
## V[A2]        0.76354863 0.03963774  19.263174  1.094593e-82 A2 <--> A2  
## V[A3]        0.70576489 0.04510292  15.647875  3.435002e-55 A3 <--> A3  
## V[A4]        1.47810259 0.06883999  21.471570 2.871544e-102 A4 <--> A4  
## V[A5]        0.84511989 0.04553868  18.558285  6.990034e-77 A5 <--> A5  
## V[C1]        1.04294084 0.05130818  20.326989  7.421893e-92 C1 <--> C1  
## V[C2]        1.04727939 0.05588028  18.741486  2.271949e-78 C2 <--> C2  
## V[C3]        1.14007575 0.05541605  20.573025  4.788395e-94 C3 <--> C3  
## V[C4]        0.97670448 0.05854026  16.684321  1.704330e-62 C4 <--> C4  
## V[C5]        1.63858678 0.08658845  18.923849  7.255663e-80 C5 <--> C5  
## V[E1]        1.75863096 0.08303725  21.178820  1.497351e-99 E1 <--> E1  
## V[E2]        1.28369574 0.07018375  18.290498  9.851190e-75 E2 <--> E2  
## V[E3]        1.07543181 0.05412632  19.868927  7.560203e-88 E3 <--> E3  
## V[E4]        1.01968201 0.05734980  17.780043  1.009021e-70 E4 <--> E4  
## V[E5]        1.21546936 0.05738608  21.180563  1.442987e-99 E5 <--> E5  
## V[N1]        0.77202708 0.05416344  14.253656  4.254140e-46 N1 <--> N1  
## V[N2]        0.88100921 0.05399874  16.315365  7.674585e-60 N2 <--> N2  
## V[N3]        1.25987596 0.06631127  18.999423  1.724296e-80 N3 <--> N3  
## V[N4]        1.63271952 0.07642767  21.362938 2.956188e-101 N4 <--> N4  
## V[N5]        2.04833227 0.09152194  22.380779 6.057690e-111 N5 <--> N5  
## V[O1]        0.82913181 0.04602848  18.013452  1.527947e-72 O1 <--> O1  
## V[O2]        1.92399378 0.09536054  20.175996  1.591273e-90 O2 <--> O2  
## V[O3]        0.77711574 0.05441673  14.280824  2.881740e-46 O3 <--> O3  
## V[O4]        1.41350151 0.06190555  22.833195 2.146796e-115 O4 <--> O4  
## V[O5]        1.33126454 0.06832159  19.485268  1.464112e-84 O5 <--> O5  
## 
##  Iterations =  26
# CAUTION THAT THIS WILL SET GLOBAL OPTIONS
# Set the options to include various fit indices so they will print
origFit <- getOption("fit.indices")
options(fit.indices = c("CFI", "GFI", "RMSEA", "BIC"))

# Use the summary function to view fit information and parameter estimates
summary(theory_CFA)
## 
##  Model Chisquare =  2005.016   Df =  265 Pr(>Chisq) = 2.150816e-264
##  Goodness-of-fit index =  0.8594733
##  RMSEA index =  0.07691165   90% CI: (NA, NA)
##  Bentler CFI =  0.7863506
##  BIC =  146.5663
## 
##  Normalized Residuals
##    Min. 1st Qu.  Median    Mean 3rd Qu.    Max. 
## -6.8135 -0.5790  0.7005  0.9165  2.3369  9.1189 
## 
##  R-square for Endogenous Variables
##     A1     A2     A3     A4     A5     C1     C2     C3     C4     C5 
## 0.1177 0.4221 0.5726 0.2652 0.4584 0.3015 0.3895 0.2854 0.4763 0.3806 
##     E1     E2     E3     E4     E5     N1     N2     N3     N4     N5 
## 0.3100 0.4955 0.4090 0.5185 0.3099 0.6809 0.6209 0.5142 0.3434 0.2209 
##     O1     O2     O3     O4     O5 
## 0.3230 0.2294 0.4473 0.0615 0.2625 
## 
##  Parameter Estimates
##             Estimate    Std Error  z value    Pr(>|z|)                  
## lam[A1:AGE] -0.47310342 0.04469539 -10.585060  3.495553e-26 A1 <--- AGE 
## lam[A2:AGE]  0.74682312 0.03424190  21.810210 1.856211e-105 A2 <--- AGE 
## lam[A3:AGE]  0.97246742 0.03690975  26.347171 5.530212e-153 A3 <--- AGE 
## lam[A4:AGE]  0.73031369 0.04413591  16.546928  1.684830e-61 A4 <--- AGE 
## lam[A5:AGE]  0.84567717 0.03685897  22.943592 1.707357e-116 A5 <--- AGE 
## lam[C1:CON] -0.67102860 0.03893437 -17.234866  1.453902e-66 C1 <--- CON 
## lam[C2:CON] -0.81745260 0.04090714 -19.983130  7.722751e-89 C2 <--- CON 
## lam[C3:CON] -0.67484497 0.04040327 -16.702731  1.252010e-62 C3 <--- CON 
## lam[C4:CON]  0.94244534 0.04196174  22.459632 1.030377e-111 C4 <--- CON 
## lam[C5:CON]  1.00338850 0.05089376  19.715355  1.591951e-86 C5 <--- CON 
## lam[E1:EXT]  0.88897886 0.04856677  18.304263  7.652070e-75 E1 <--- EXT 
## lam[E2:EXT]  1.12282478 0.04596055  24.430185 8.174273e-132 E2 <--- EXT 
## lam[E3:EXT] -0.86265804 0.03985228 -21.646390 6.573210e-104 E3 <--- EXT 
## lam[E4:EXT] -1.04778146 0.04165946 -25.151108 1.374315e-139 E4 <--- EXT 
## lam[E5:EXT] -0.73878674 0.04037337 -18.298864  8.449171e-75 E5 <--- EXT 
## lam[N1:NEU]  1.28350486 0.04147064  30.949724 2.562431e-210 N1 <--- NEU 
## lam[N2:NEU]  1.20126201 0.04131090  29.078570 6.700813e-186 N2 <--- NEU 
## lam[N3:NEU]  1.15489837 0.04498842  25.671017 2.463597e-145 N3 <--- NEU 
## lam[N4:NEU]  0.92407395 0.04646996  19.885404  5.444165e-88 N4 <--- NEU 
## lam[N5:NEU]  0.76200858 0.04958272  15.368429  2.665543e-53 N5 <--- NEU 
## lam[O1:OPE]  0.62901029 0.03848638  16.343713  4.822431e-60 O1 <--- OPE 
## lam[O2:OPE] -0.75677801 0.05522087 -13.704565  9.533735e-43 O2 <--- OPE 
## lam[O3:OPE]  0.79299695 0.04156934  19.076487  3.959980e-81 O3 <--- OPE 
## lam[O4:OPE]  0.30437169 0.04406913   6.906687  4.961028e-12 O4 <--- OPE 
## lam[O5:OPE] -0.68830815 0.04680655 -14.705379  5.953631e-49 O5 <--- OPE 
## C[AGE,CON]  -0.33903475 0.03616712  -9.374116  6.975805e-21 CON <--> AGE
## C[AGE,EXT]  -0.71675158 0.02419566 -29.623150 7.522744e-193 EXT <--> AGE
## C[AGE,NEU]  -0.23767064 0.03540025  -6.713812  1.896045e-11 NEU <--> AGE
## C[AGE,OPE]   0.23285485 0.04030234   5.777700  7.572854e-09 OPE <--> AGE
## C[CON,EXT]   0.38058118 0.03501044  10.870507  1.593130e-27 EXT <--> CON
## C[CON,NEU]   0.25969556 0.03567111   7.280277  3.331352e-13 NEU <--> CON
## C[CON,OPE]  -0.28622586 0.04021418  -7.117536  1.098734e-12 OPE <--> CON
## C[EXT,NEU]   0.27605059 0.03454400   7.991276  1.335494e-15 NEU <--> EXT
## C[EXT,OPE]  -0.34443896 0.03822892  -9.009905  2.062345e-19 OPE <--> EXT
## C[NEU,OPE]  -0.09901255 0.03959699  -2.500507  1.240156e-02 OPE <--> NEU
## V[A1]        1.67705932 0.07357444  22.794048 5.252890e-115 A1 <--> A1  
## V[A2]        0.76354863 0.03963774  19.263174  1.094593e-82 A2 <--> A2  
## V[A3]        0.70576489 0.04510292  15.647875  3.435002e-55 A3 <--> A3  
## V[A4]        1.47810259 0.06883999  21.471570 2.871544e-102 A4 <--> A4  
## V[A5]        0.84511989 0.04553868  18.558285  6.990034e-77 A5 <--> A5  
## V[C1]        1.04294084 0.05130818  20.326989  7.421893e-92 C1 <--> C1  
## V[C2]        1.04727939 0.05588028  18.741486  2.271949e-78 C2 <--> C2  
## V[C3]        1.14007575 0.05541605  20.573025  4.788395e-94 C3 <--> C3  
## V[C4]        0.97670448 0.05854026  16.684321  1.704330e-62 C4 <--> C4  
## V[C5]        1.63858678 0.08658845  18.923849  7.255663e-80 C5 <--> C5  
## V[E1]        1.75863096 0.08303725  21.178820  1.497351e-99 E1 <--> E1  
## V[E2]        1.28369574 0.07018375  18.290498  9.851190e-75 E2 <--> E2  
## V[E3]        1.07543181 0.05412632  19.868927  7.560203e-88 E3 <--> E3  
## V[E4]        1.01968201 0.05734980  17.780043  1.009021e-70 E4 <--> E4  
## V[E5]        1.21546936 0.05738608  21.180563  1.442987e-99 E5 <--> E5  
## V[N1]        0.77202708 0.05416344  14.253656  4.254140e-46 N1 <--> N1  
## V[N2]        0.88100921 0.05399874  16.315365  7.674585e-60 N2 <--> N2  
## V[N3]        1.25987596 0.06631127  18.999423  1.724296e-80 N3 <--> N3  
## V[N4]        1.63271952 0.07642767  21.362938 2.956188e-101 N4 <--> N4  
## V[N5]        2.04833227 0.09152194  22.380779 6.057690e-111 N5 <--> N5  
## V[O1]        0.82913181 0.04602848  18.013452  1.527947e-72 O1 <--> O1  
## V[O2]        1.92399378 0.09536054  20.175996  1.591273e-90 O2 <--> O2  
## V[O3]        0.77711574 0.05441673  14.280824  2.881740e-46 O3 <--> O3  
## V[O4]        1.41350151 0.06190555  22.833195 2.146796e-115 O4 <--> O4  
## V[O5]        1.33126454 0.06832159  19.485268  1.464112e-84 O5 <--> O5  
## 
##  Iterations =  26
# Run a CFA using the EFA syntax you created earlier
EFA_CFA <- sem(EFA_syn, data = bfi_CFA)
## Warning in sem.semmod(EFA_syn, data = bfi_CFA): -289 observations removed
## due to missingness
# Locate the BIC in the fit statistics of the summary output
summary(EFA_CFA)$BIC
## [1] 480.1274
# Compare EFA_CFA BIC to the BIC from the CFA based on theory
summary(theory_CFA)$BIC
## [1] 146.5663
# Reset to baseline
options(fit.indices = origFit)

Chapter 4 - Refining Your Measure and Model

EFA vs CFA Revisited:

  • EFA is exploratory and looks at many possible relationships
  • CFA is confirmatory and based only on the loadings defined by a theoretical relationship; will have different loadings than EFA dur to different number of variables
  • Due to the rotations involved in EFA, the variables may have non-intuitive names
    • EFA_scores <- EFA_model$scores
    • CFA_scores <- fscores(EFA_CFA, data = bfi_EFA)
    • plot(density(EFA_scores[,1], na.rm = TRUE), xlim = c(-3, 3), ylim = c(0, 1), col = “blue”)
    • lines(density(CFA_scores[,1], na.rm = TRUE), xlim = c(-3, 3), ylim = c(0, 1), col = “red”)

Adding Loadings to Improve Fit:

  • Poor model fits are sometimes due to excluded loadings
  • Can alter the syntax to add the new loadings desired; OK to have some items theorized to load on to multiple factors
  • Can then run the updated model and look at the ANOVA
    • anova(theory_CFA, theory_CFA_add)

Improving Fit by Removing Loadings:

  • Can delete loadings rather than add loadings
    • theory_syn_del <- "
    • AGE: A1, A2, A3, A4, A5
    • CON: C1, C2, C3, C4, C5
    • EXT: E1, E2, E3, E4, E5
    • NEU: N1, N2, N3, N4, N5
    • OPE: O1, O2, O3, O5
    • "
    • theory_syn3 <- cfa(text = theory_syn_del, reference.indicators = FALSE)
    • theory_CFA_del <- sem(model = theory_syn3, data = bfi_CFA)

Wrap-Up:

  • Unidimensional and multideimensional models
  • EFA (exploratory) and CFA (confirmatory)
  • The psych and sem packages are available also

Example code includes:

# CAUTION THAT THIS WILL SET GLOBAL OPTIONS
# Set the options to include various fit indices so they will print
origFit <- getOption("fit.indices")
options(fit.indices = c("CFI", "GFI", "RMSEA", "BIC"))

# View the first five rows of the EFA loadings
EFA_model$loadings[1:5, ]
##             MR2        MR3          MR1        MR5         MR4
## A1  0.194806449 0.08286748 -0.150193662 -0.4264281 -0.01822345
## A2 -0.007392792 0.06744147 -0.009306157  0.6261111  0.04454954
## A3 -0.028215628 0.02767518 -0.105034038  0.6441602  0.02841403
## A4 -0.049129621 0.18695432 -0.091956712  0.4276816 -0.14686861
## A5 -0.123184595 0.01709411 -0.191147915  0.5553174  0.06932404
# View the first five loadings from the CFA estimated from the EFA results
summary(EFA_CFA)$coeff[1:5, ]
##        Estimate  Std Error   z value      Pr(>|z|)            
## F4A1 -0.5184257 0.04528396 -11.44833  2.397187e-30 A1 <--- MR5
## F4A2  0.7768131 0.03524249  22.04195 1.141266e-107 A2 <--- MR5
## F4A3  0.9968771 0.03885030  25.65944 3.317365e-145 A3 <--- MR5
## F4A4  0.7235088 0.04521136  16.00281  1.221362e-57 A4 <--- MR5
## F4A5  0.7768296 0.03870116  20.07251  1.283512e-89 A5 <--- MR5
# Extracting factor scores from the EFA model
EFA_scores <- EFA_model$scores

# Calculating factor scores by applying the CFA parameters to the EFA dataset
CFA_scores <- fscores(EFA_CFA, data = bfi_EFA)

# Comparing factor scores from the EFA and CFA results from the bfi_EFA dataset
plot(density(EFA_scores[,1], na.rm = TRUE), 
    xlim = c(-3, 3), ylim = c(0, 1), col = "blue")
lines(density(CFA_scores[,1], na.rm = TRUE), 
    xlim = c(-3, 3), ylim = c(0, 1), col = "red")

# Add some plausible item/factor loadings to the syntax
theory_syn_add <- "
AGE: A1, A2, A3, A4, A5
CON: C1, C2, C3, C4, C5
EXT: E1, E2, E3, E4, E5, N4
NEU: N1, N2, N3, N4, N5, E3
OPE: O1, O2, O3, O4, O5
"

# Convert your equations to sem-compatible syntax
theory_syn2 <- cfa(text = theory_syn_add, reference.indicators = FALSE)
## NOTE: adding 25 variances to the model
# Run a CFA with the revised syntax
theory_CFA_add <- sem(model = theory_syn2, data = bfi_CFA)
## Warning in sem.semmod(model = theory_syn2, data = bfi_CFA): -289
## observations removed due to missingness
## Warning in sem.semmod(model = theory_syn2, data = bfi_CFA): The following observed variables are in the input covariance or raw-moment matrix but do not appear in the model:
## gender, education, age
# Conduct a likelihood ratio test
anova(theory_CFA, theory_CFA_add)
## LR Test for Difference Between Models
## 
##                Model Df Model Chisq Df LR Chisq Pr(>Chisq)    
## theory_CFA          265      2005.0                           
## theory_CFA_add      263      1901.8  2   103.19  < 2.2e-16 ***
## ---
## Signif. codes:  0 '***' 0.001 '**' 0.01 '*' 0.05 '.' 0.1 ' ' 1
# Compare the comparative fit indices - higher is better!
summary(theory_CFA)$CFI
## [1] 0.7863506
summary(theory_CFA_add)$CFI
## [1] 0.7987748
# Compare the RMSEA values - lower is better!
summary(theory_CFA)$RMSEA
## [1] 0.07691165         NA         NA 0.90000000
summary(theory_CFA_add)$RMSEA
## [1] 0.07492514         NA         NA 0.90000000
# Compare BIC values
summary(theory_CFA)$BIC
## [1] 146.5663
summary(theory_CFA_add)$BIC
## [1] 57.40664
# Remove the weakest factor loading from the syntax
theory_syn_del <- "
AGE: A1, A2, A3, A4, A5
CON: C1, C2, C3, C4, C5
EXT: E1, E2, E3, E4, E5
NEU: N1, N2, N3, N4, N5
OPE: O1, O2, O3, O5
"

# Convert your equations to sem-compatible syntax
theory_syn3 <- cfa(text = theory_syn_del, reference.indicators = FALSE)
## NOTE: adding 24 variances to the model
# Run a CFA with the revised syntax
theory_CFA_del <- sem(model = theory_syn3, data = bfi_CFA)
## Warning in sem.semmod(model = theory_syn3, data = bfi_CFA): -289
## observations removed due to missingness
## Warning in sem.semmod(model = theory_syn3, data = bfi_CFA): The following observed variables are in the input covariance or raw-moment matrix but do not appear in the model:
## O4, gender, education, age
# Compare the comparative fit indices - higher is better!
summary(theory_CFA)$CFI
## [1] 0.7863506
summary(theory_CFA_del)$CFI
## [1] 0.7983846
# Compare the RMSEA values - lower is better!
summary(theory_CFA)$RMSEA
## [1] 0.07691165         NA         NA 0.90000000
summary(theory_CFA_del)$RMSEA
## [1] 0.07732379         NA         NA 0.90000000
# Compare BIC values
summary(theory_CFA)$BIC
## [1] 146.5663
summary(theory_CFA_del)$BIC
## [1] 150.9206
# Reset to baseline
options(fit.indices = origFit)

Generalized Linear Models in R

Chapter 1 - GLM - Extension of Regression Toolbox

Limitations of linear models:

  • Linear models are workhorses of data science - explaining variability with linear combinations of variables
    • lm(y ~ x, data = dat)
  • Linear models assume linear relationships, and normally distributed residuals
    • lm(formula = weight ~ Diet, data = ChickWeightEnd) # ChickWeightEnd is the FINAL endpoint
  • Sometimes want to model counts or survival or the like, where the basic linear model is not appropriate
    • Poisson family for count data
    • Binomial family for survival data
    • Link functions to convert the linear model to the relevant family
  • Can run GLM in R
    • glm( y ~ x, data = data, family = “gaussian”) # this is the same as lm()

Poisson regression:

  • The Poisson model is good for modeling count data - scores, visitors, cells, etc.
  • The Poisson distribution is always a non-negative integer, and with the same mean and variance
    • glm(goal ~ player, data = scores, family = “poisson”) # global intercept and then delta goals for player vs. reference level
    • glm(goal ~ player -1, data = scores, family = “poisson”) # average goals per player

Basic lm() functions with glm():

  • R gives some useful shortcuts when working with lm() and glm(); for example, automatic output printing
  • The summary() call on a regression model provides additional details about the regression
    • Can further use broom::tidy() to extract key data in a tidy format
    • Can use coef() and confint() to get the coefficients and the confidence intervals
  • Can also make predictions based on an existing model
    • predict(model, newData)

Example code includes:

data(ChickWeight, package="datasets")
ChickWeightEnd <- ChickWeight %>% 
    mutate(Chick=as.factor(as.integer(Chick))) %>%
    group_by(Chick) %>% 
    filter(Time==max(Time), !(Chick %in% c(1, 2, 3, 8, 41))) %>%
    ungroup()
glimpse(ChickWeightEnd)
## Observations: 45
## Variables: 4
## $ weight <dbl> 205, 215, 202, 157, 223, 157, 305, 98, 124, 175, 205, 9...
## $ Time   <dbl> 21, 21, 21, 21, 21, 21, 21, 21, 21, 21, 21, 21, 21, 21,...
## $ Chick  <fct> 15, 17, 14, 11, 18, 12, 20, 5, 7, 13, 16, 4, 19, 9, 10,...
## $ Diet   <fct> 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 2, 2, 2...
# Fit a lm()
lm(formula = weight ~ Diet, data = ChickWeightEnd)
## 
## Call:
## lm(formula = weight ~ Diet, data = ChickWeightEnd)
## 
## Coefficients:
## (Intercept)        Diet2        Diet3        Diet4  
##      177.75        36.95        92.55        60.81
# Fit a glm()
glm( formula = weight ~ Diet , data = ChickWeightEnd, family = 'gaussian')
## 
## Call:  glm(formula = weight ~ Diet, family = "gaussian", data = ChickWeightEnd)
## 
## Coefficients:
## (Intercept)        Diet2        Diet3        Diet4  
##      177.75        36.95        92.55        60.81  
## 
## Degrees of Freedom: 44 Total (i.e. Null);  41 Residual
## Null Deviance:       225000 
## Residual Deviance: 167800    AIC: 507.8
dat <- data.frame(time=1:30, 
                  count=c(0, 0, 0, 0, 1, 0, 0, 1, 0, 0, 2, 0, 1, 0, 0, 1, 0, 0, 0, 2, 2, 1, 1, 4, 1, 1, 1, 1, 0, 0)
                  )
dat
##    time count
## 1     1     0
## 2     2     0
## 3     3     0
## 4     4     0
## 5     5     1
## 6     6     0
## 7     7     0
## 8     8     1
## 9     9     0
## 10   10     0
## 11   11     2
## 12   12     0
## 13   13     1
## 14   14     0
## 15   15     0
## 16   16     1
## 17   17     0
## 18   18     0
## 19   19     0
## 20   20     2
## 21   21     2
## 22   22     1
## 23   23     1
## 24   24     4
## 25   25     1
## 26   26     1
## 27   27     1
## 28   28     1
## 29   29     0
## 30   30     0
# fit y predicted by x with data.frame dat using the poisson family
poissonOut <- glm(count ~ time, data=dat, family="poisson")

# print the output
print(poissonOut)
## 
## Call:  glm(formula = count ~ time, family = "poisson", data = dat)
## 
## Coefficients:
## (Intercept)         time  
##    -1.43036      0.05815  
## 
## Degrees of Freedom: 29 Total (i.e. Null);  28 Residual
## Null Deviance:       35.63 
## Residual Deviance: 30.92     AIC: 66.02
# Fit a glm with count predicted by time using data.frame dat and gaussian family
lmOut <- glm(count ~ time, data=dat, family="gaussian")

summary(lmOut)
## 
## Call:
## glm(formula = count ~ time, family = "gaussian", data = dat)
## 
## Deviance Residuals: 
##     Min       1Q   Median       3Q      Max  
## -1.2022  -0.5190  -0.1497   0.2595   3.0194  
## 
## Coefficients:
##             Estimate Std. Error t value Pr(>|t|)  
## (Intercept)  0.09425    0.32891   0.287   0.7766  
## time         0.03693    0.01853   1.993   0.0561 .
## ---
## Signif. codes:  0 '***' 0.001 '**' 0.01 '*' 0.05 '.' 0.1 ' ' 1
## 
## (Dispersion parameter for gaussian family taken to be 0.7714815)
## 
##     Null deviance: 24.667  on 29  degrees of freedom
## Residual deviance: 21.601  on 28  degrees of freedom
## AIC: 81.283
## 
## Number of Fisher Scoring iterations: 2
summary(poissonOut)
## 
## Call:
## glm(formula = count ~ time, family = "poisson", data = dat)
## 
## Deviance Residuals: 
##     Min       1Q   Median       3Q      Max  
## -1.6547  -0.9666  -0.7226   0.3830   2.3022  
## 
## Coefficients:
##             Estimate Std. Error z value Pr(>|z|)  
## (Intercept) -1.43036    0.59004  -2.424   0.0153 *
## time         0.05815    0.02779   2.093   0.0364 *
## ---
## Signif. codes:  0 '***' 0.001 '**' 0.01 '*' 0.05 '.' 0.1 ' ' 1
## 
## (Dispersion parameter for poisson family taken to be 1)
## 
##     Null deviance: 35.627  on 29  degrees of freedom
## Residual deviance: 30.918  on 28  degrees of freedom
## AIC: 66.024
## 
## Number of Fisher Scoring iterations: 5
scores <- data.frame(player=rep(c("Sam", "Lou"), each=5), 
                     goal=c(1, 2, 0, 4, 3, 0, 0, 1, 0, 0)
                     )
scores
##    player goal
## 1     Sam    1
## 2     Sam    2
## 3     Sam    0
## 4     Sam    4
## 5     Sam    3
## 6     Lou    0
## 7     Lou    0
## 8     Lou    1
## 9     Lou    0
## 10    Lou    0
# Fit a glm() that estimates the difference between players
summary(glm(goal ~ player, data=scores, family="poisson"))
## 
## Call:
## glm(formula = goal ~ player, family = "poisson", data = scores)
## 
## Deviance Residuals: 
##     Min       1Q   Median       3Q      Max  
## -2.0000  -0.6325  -0.6325   0.4934   1.2724  
## 
## Coefficients:
##             Estimate Std. Error z value Pr(>|z|)  
## (Intercept)  -1.6094     0.9999  -1.610   0.1075  
## playerSam     2.3026     1.0487   2.196   0.0281 *
## ---
## Signif. codes:  0 '***' 0.001 '**' 0.01 '*' 0.05 '.' 0.1 ' ' 1
## 
## (Dispersion parameter for poisson family taken to be 1)
## 
##     Null deviance: 18.3578  on 9  degrees of freedom
## Residual deviance:  9.8105  on 8  degrees of freedom
## AIC: 26.682
## 
## Number of Fisher Scoring iterations: 5
# Fit a glm() that estimates an intercept for each player 
summary(glm(goal ~ player - 1, data=scores, family="poisson"))
## 
## Call:
## glm(formula = goal ~ player - 1, family = "poisson", data = scores)
## 
## Deviance Residuals: 
##     Min       1Q   Median       3Q      Max  
## -2.0000  -0.6325  -0.6325   0.4934   1.2724  
## 
## Coefficients:
##           Estimate Std. Error z value Pr(>|z|)  
## playerLou  -1.6094     0.9999  -1.610   0.1075  
## playerSam   0.6931     0.3162   2.192   0.0284 *
## ---
## Signif. codes:  0 '***' 0.001 '**' 0.01 '*' 0.05 '.' 0.1 ' ' 1
## 
## (Dispersion parameter for poisson family taken to be 1)
## 
##     Null deviance: 18.4546  on 10  degrees of freedom
## Residual deviance:  9.8105  on  8  degrees of freedom
## AIC: 26.682
## 
## Number of Fisher Scoring iterations: 5
dat2 <- data.frame(Date=as.Date("2005-01-09")+1:4368, Number=0L) %>%
    mutate(Month=as.factor(lubridate::month(Date)))

eq1 <- c(1, 2, 6, 22, 42, 47, 48, 86, 96, 109, 113, 119, 190, 192, 208, 248, 264, 278, 306, 333, 334, 336, 368, 375, 392, 393, 408, 417, 424, 429, 439, 449, 455, 456, 500, 523, 536, 544, 545, 548, 550, 551, 586, 590, 597, 598, 673, 678, 700, 717, 740, 750, 755, 756, 767, 775, 793, 831, 859, 865, 866, 877, 885, 887, 895, 937, 1086, 1101, 1107, 1111, 1112, 1154, 1157, 1183, 1213, 1235, 1247, 1251, 1269, 1272, 1288, 1295, 1300, 1320, 1342, 1350, 1424, 1454, 1457, 1460, 1476, 1522, 1589, 1598, 1608, 1627, 1642, 1665, 1697, 1709, 1733, 1746, 1749, 1766, 1799, 1830, 1866, 1895, 1914, 1920, 1934, 1942, 1953, 1960, 1961, 1966, 1969, 1989, 2007, 2041, 2051, 2087, 2092, 2096, 2106, 2122, 2129, 2138, 2156, 2159, 2174, 2176, 2177, 2180, 2191, 2214, 2217, 2218, 2251, 2276, 2286, 2302, 2308, 2340, 2352, 2361, 2382, 2416, 2419, 2421, 2464, 2468, 2492, 2522, 2526, 2548, 2550, 2573, 2620, 2625, 2627, 2629, 2698, 2706, 2721, 2726, 2760, 2768, 2787, 2796, 2813, 2854, 2858, 2890, 2900, 2909, 2932, 2933, 2955, 2960, 2966, 2997, 3032, 3057, 3063, 3080, 3090, 3095, 3098, 3122, 3130, 3154, 3160, 3199, 3205, 3215, 3227, 3229, 3243, 3244, 3254, 3302, 3340, 3350, 3469, 3506, 3519, 3525, 3535, 3542, 3584, 3604, 3653, 3660, 3673, 3692, 3694, 3706, 3763, 3792, 3801, 3808, 3812, 3814, 3822, 3884, 3892, 4001, 4084, 4194, 4210, 4220, 4229, 4242, 4265, 4267, 4296, 4302, 4325, 4334, 4338, 4341, 4353, 4354, 4357, 4368)
eq2 <- c(21, 195, 308, 505, 522, 560, 913, 1202, 1353, 1439, 1473, 1484, 1614, 1717, 1808, 1940, 2110, 2391, 2407, 2535, 2716, 2748, 2949, 3313, 3421, 3671, 3967, 3991, 4281)
eq3 <- c(624, 776, 1364, 1585, 2063, 2109, 2196, 2569, 2576, 2607, 3399, 3533, 3607)
eq4 <- c(463, 1918, 2417, 3064, 3606)
eq5 <- c(13, 3826)
eq6 <- c(701, 2097)
eq7 <- c(2509, 4276)
eq9 <- c(1637)

dat2[eq1, "Number"] <- 1L
dat2[eq2, "Number"] <- 2L
dat2[eq3, "Number"] <- 3L
dat2[eq4, "Number"] <- 4L
dat2[eq5, "Number"] <- 5L
dat2[eq6, "Number"] <- 6L
dat2[eq7, "Number"] <- 7L
dat2[eq9, "Number"] <- 9L

str(dat2)
## 'data.frame':    4368 obs. of  3 variables:
##  $ Date  : Date, format: "2005-01-10" "2005-01-11" ...
##  $ Number: int  1 1 0 0 0 1 0 0 0 0 ...
##  $ Month : Factor w/ 12 levels "1","2","3","4",..: 1 1 1 1 1 1 1 1 1 1 ...
table(dat2$Number)
## 
##    0    1    2    3    4    5    6    7    9 
## 4068  246   29   13    5    2    2    2    1
table(dat2$Month)
## 
##   1   2   3   4   5   6   7   8   9  10  11  12 
## 363 339 372 360 372 360 372 372 360 372 360 366
# build your models
lmOut <- lm(Number ~ Month, data=dat2) 
poissonOut <- glm(Number ~ Month, data=dat2, family="poisson")

# examine the outputs using print
print(lmOut)
## 
## Call:
## lm(formula = Number ~ Month, data = dat2)
## 
## Coefficients:
## (Intercept)       Month2       Month3       Month4       Month5  
##    0.129477    -0.038031    -0.078401    -0.057254    -0.032702  
##      Month6       Month7       Month8       Month9      Month10  
##   -0.043365    -0.005821    -0.051520    -0.023921    -0.054208  
##     Month11      Month12  
##   -0.023921    -0.022919
print(poissonOut)
## 
## Call:  glm(formula = Number ~ Month, family = "poisson", data = dat2)
## 
## Coefficients:
## (Intercept)       Month2       Month3       Month4       Month5  
##     -2.0443      -0.3478      -0.9302      -0.5838      -0.2911  
##      Month6       Month7       Month8       Month9      Month10  
##     -0.4079      -0.0460      -0.5073      -0.2043      -0.5424  
##     Month11      Month12  
##     -0.2043      -0.1948  
## 
## Degrees of Freedom: 4367 Total (i.e. Null);  4356 Residual
## Null Deviance:       2325 
## Residual Deviance: 2303  AIC: 2976
# examine the outputs using summary
summary(lmOut)
## 
## Call:
## lm(formula = Number ~ Month, data = dat2)
## 
## Residuals:
##     Min      1Q  Median      3Q     Max 
## -0.1295 -0.1056 -0.0914 -0.0753  8.8763 
## 
## Coefficients:
##              Estimate Std. Error t value Pr(>|t|)    
## (Intercept)  0.129477   0.022770   5.686 1.38e-08 ***
## Month2      -0.038031   0.032767  -1.161   0.2458    
## Month3      -0.078401   0.032007  -2.450   0.0143 *  
## Month4      -0.057254   0.032269  -1.774   0.0761 .  
## Month5      -0.032702   0.032007  -1.022   0.3070    
## Month6      -0.043365   0.032269  -1.344   0.1791    
## Month7      -0.005821   0.032007  -0.182   0.8557    
## Month8      -0.051520   0.032007  -1.610   0.1075    
## Month9      -0.023921   0.032269  -0.741   0.4586    
## Month10     -0.054208   0.032007  -1.694   0.0904 .  
## Month11     -0.023921   0.032269  -0.741   0.4586    
## Month12     -0.022919   0.032136  -0.713   0.4758    
## ---
## Signif. codes:  0 '***' 0.001 '**' 0.01 '*' 0.05 '.' 0.1 ' ' 1
## 
## Residual standard error: 0.4338 on 4356 degrees of freedom
## Multiple R-squared:  0.00249,    Adjusted R-squared:  -2.927e-05 
## F-statistic: 0.9884 on 11 and 4356 DF,  p-value: 0.4542
summary(poissonOut)
## 
## Call:
## glm(formula = Number ~ Month, family = "poisson", data = dat2)
## 
## Deviance Residuals: 
##     Min       1Q   Median       3Q      Max  
## -0.5089  -0.4595  -0.4277  -0.3880   7.7086  
## 
## Coefficients:
##             Estimate Std. Error z value Pr(>|z|)    
## (Intercept)  -2.0443     0.1459 -14.015  < 2e-16 ***
## Month2       -0.3478     0.2314  -1.503 0.132839    
## Month3       -0.9302     0.2719  -3.422 0.000623 ***
## Month4       -0.5837     0.2444  -2.388 0.016923 *  
## Month5       -0.2911     0.2215  -1.314 0.188706    
## Month6       -0.4079     0.2314  -1.763 0.077939 .  
## Month7       -0.0460     0.2074  -0.222 0.824486    
## Month8       -0.5073     0.2361  -2.149 0.031671 *  
## Month9       -0.2043     0.2182  -0.936 0.349112    
## Month10      -0.5424     0.2387  -2.272 0.023075 *  
## Month11      -0.2043     0.2182  -0.936 0.349112    
## Month12      -0.1948     0.2166  -0.899 0.368434    
## ---
## Signif. codes:  0 '***' 0.001 '**' 0.01 '*' 0.05 '.' 0.1 ' ' 1
## 
## (Dispersion parameter for poisson family taken to be 1)
## 
##     Null deviance: 2325.3  on 4367  degrees of freedom
## Residual deviance: 2302.7  on 4356  degrees of freedom
## AIC: 2975.6
## 
## Number of Fisher Scoring iterations: 6
# examine the outputs using tidy
broom::tidy(lmOut)
## # A tibble: 12 x 5
##    term        estimate std.error statistic      p.value
##    <chr>          <dbl>     <dbl>     <dbl>        <dbl>
##  1 (Intercept)  0.129      0.0228     5.69  0.0000000138
##  2 Month2      -0.0380     0.0328    -1.16  0.246       
##  3 Month3      -0.0784     0.0320    -2.45  0.0143      
##  4 Month4      -0.0573     0.0323    -1.77  0.0761      
##  5 Month5      -0.0327     0.0320    -1.02  0.307       
##  6 Month6      -0.0434     0.0323    -1.34  0.179       
##  7 Month7      -0.00582    0.0320    -0.182 0.856       
##  8 Month8      -0.0515     0.0320    -1.61  0.108       
##  9 Month9      -0.0239     0.0323    -0.741 0.459       
## 10 Month10     -0.0542     0.0320    -1.69  0.0904      
## 11 Month11     -0.0239     0.0323    -0.741 0.459       
## 12 Month12     -0.0229     0.0321    -0.713 0.476
broom::tidy(poissonOut)
## # A tibble: 12 x 5
##    term        estimate std.error statistic  p.value
##    <chr>          <dbl>     <dbl>     <dbl>    <dbl>
##  1 (Intercept)  -2.04       0.146   -14.0   1.27e-44
##  2 Month2       -0.348      0.231    -1.50  1.33e- 1
##  3 Month3       -0.930      0.272    -3.42  6.23e- 4
##  4 Month4       -0.584      0.244    -2.39  1.69e- 2
##  5 Month5       -0.291      0.221    -1.31  1.89e- 1
##  6 Month6       -0.408      0.231    -1.76  7.79e- 2
##  7 Month7       -0.0460     0.207    -0.222 8.24e- 1
##  8 Month8       -0.507      0.236    -2.15  3.17e- 2
##  9 Month9       -0.204      0.218    -0.936 3.49e- 1
## 10 Month10      -0.542      0.239    -2.27  2.31e- 2
## 11 Month11      -0.204      0.218    -0.936 3.49e- 1
## 12 Month12      -0.195      0.217    -0.899 3.68e- 1
# Extract the regression coefficients
coef(poissonOut)
## (Intercept)      Month2      Month3      Month4      Month5      Month6 
## -2.04425523 -0.34775767 -0.93019964 -0.58375226 -0.29111968 -0.40786159 
##      Month7      Month8      Month9     Month10     Month11     Month12 
## -0.04599723 -0.50734279 -0.20426264 -0.54243411 -0.20426264 -0.19481645
# Extract the confidence intervals
confint(poissonOut)
## Waiting for profiling to be done...
##                  2.5 %      97.5 %
## (Intercept) -2.3444432 -1.77136313
## Month2      -0.8103027  0.10063404
## Month3      -1.4866061 -0.41424128
## Month4      -1.0762364 -0.11342457
## Month5      -0.7311289  0.14051326
## Month6      -0.8704066  0.04053012
## Month7      -0.4542037  0.36161360
## Month8      -0.9807831 -0.05092540
## Month9      -0.6367321  0.22171492
## Month10     -1.0218277 -0.08165226
## Month11     -0.6367321  0.22171492
## Month12     -0.6237730  0.22851779
# use the model to predict with new data 
newDat <- data.frame(Month=as.factor(6:8))
predOut <- predict(object = poissonOut, newdata = newDat, type = "response")

# print the predictions
print(predOut)
##          1          2          3 
## 0.08611111 0.12365591 0.07795699

Chapter 2 - Logistic Regression

Overview of logistic regression:

  • Commonly used for making win/loss or survive/die predictions - binary data such as 0/1, Coke/Pepsi, W/L, etc.
  • The logistic regression is the default for GLM with family “binomial”
    • The logit link transforms probabilities to log-odds, while the inverse logit transforms log-odds to probabilities
  • Can fit the logistic regression in R using the default link in the glm()
    • glm(y ~ x, data = dat, family = ‘binomial’)

Bernoulli vs. Binomial Distribution:

  • Binomial and Bernoulli distributions are the foundation of logistic regression
    • Bernoulli models a single event (for example, the likelihood of heads in 1 coin flip)
    • Binomial models multiple events at the same time (for example, the number of heads in 10 coin flips)
  • Several options for entering data in R for use in logistic regression
    • Long format (Bernoulli) - vector of outcomes
    • Wide format (binomial) - proportions of success with weights, such as looking at groups
  • The appropriate input structure depends on the underlying data - groups vs. individuals

Link functions - probit compared with logit:

  • Link functions are important for understanding and simulating GLMs
  • The probit link function is another option (rather than logit) for the link function of the binomial
    • The “probit” is an abbreviation for probability unit, and is computattionally easier than the logit which was important when computers were slower
    • The probit returns a z-score, but with thinner tails than the probit (so the logit is often better for modeling outliers)
  • Need to convert z-scores to probabilities, then can run the rbinom function

Example code includes:

busData <- readr::read_csv("./RInputFiles/busData.csv")
## Parsed with column specification:
## cols(
##   CommuteDays = col_integer(),
##   MilesOneWay = col_double(),
##   Bus = col_character()
## )
bus <- busData %>%
    mutate(Bus=factor(Bus, levels=c("No", "Yes")))
glimpse(bus)
## Observations: 15,892
## Variables: 3
## $ CommuteDays <int> 5, 5, 5, 5, 3, 4, 5, 5, 5, 5, 5, 5, 5, 5, 5, 5, 5,...
## $ MilesOneWay <dbl> 19.54675, 19.54675, 19.54675, 19.54675, 19.54675, ...
## $ Bus         <fct> Yes, Yes, Yes, Yes, Yes, Yes, No, No, No, No, No, ...
# Build a glm that models Bus predicted by CommuteDays
# using data.frame bus. Remember to use a binomial family.
busOut <- glm(Bus ~ CommuteDays, data=bus, family="binomial")

# Print the busOut (be sure to use the print() function)
print(busOut)
## 
## Call:  glm(formula = Bus ~ CommuteDays, family = "binomial", data = bus)
## 
## Coefficients:
## (Intercept)  CommuteDays  
##     -1.4549       0.1299  
## 
## Degrees of Freedom: 15891 Total (i.e. Null);  15890 Residual
## Null Deviance:       19570 
## Residual Deviance: 19540     AIC: 19540
# Look at the summary() of busOut
summary(busOut)
## 
## Call:
## glm(formula = Bus ~ CommuteDays, family = "binomial", data = bus)
## 
## Deviance Residuals: 
##     Min       1Q   Median       3Q      Max  
## -0.9560  -0.8595  -0.8595   1.5330   1.7668  
## 
## Coefficients:
##             Estimate Std. Error z value Pr(>|z|)    
## (Intercept) -1.45493    0.11471 -12.683  < 2e-16 ***
## CommuteDays  0.12985    0.02312   5.616 1.96e-08 ***
## ---
## Signif. codes:  0 '***' 0.001 '**' 0.01 '*' 0.05 '.' 0.1 ' ' 1
## 
## (Dispersion parameter for binomial family taken to be 1)
## 
##     Null deviance: 19568  on 15891  degrees of freedom
## Residual deviance: 19536  on 15890  degrees of freedom
## AIC: 19540
## 
## Number of Fisher Scoring iterations: 4
# Look at the tidy() output of busOut
broom::tidy(busOut)
## # A tibble: 2 x 5
##   term        estimate std.error statistic  p.value
##   <chr>          <dbl>     <dbl>     <dbl>    <dbl>
## 1 (Intercept)   -1.45     0.115     -12.7  7.32e-37
## 2 CommuteDays    0.130    0.0231      5.62 1.96e- 8
# Simulate 1 draw with a sample size of 100
binomialSim <- rbinom(n=1, size=100, prob=0.5)

# Simulate 100 draw with a sample size of 1 
BernoulliSim <- rbinom(n=100, size=1, prob=0.5)

# Print the results from the binomial
print(binomialSim)
## [1] 47
# Sum the results from the Bernoulli
sum(BernoulliSim)
## [1] 46
dataLong <- data.frame(x=factor(rep(c("a", "b"), each=14), levels=c("a", "b")), 
                       y=factor(c('fail', 'fail', 'fail', 'fail', 'success', 'fail', 'fail', 'fail', 'fail', 'fail', 'fail', 'fail', 'fail', 'success', 'success', 'fail', 'success', 'success', 'success', 'success', 'success', 'success', 'success', 'success', 'success', 'fail', 'success', 'fail'), levels=c("fail", "success"))
                       )
str(dataLong)
## 'data.frame':    28 obs. of  2 variables:
##  $ x: Factor w/ 2 levels "a","b": 1 1 1 1 1 1 1 1 1 1 ...
##  $ y: Factor w/ 2 levels "fail","success": 1 1 1 1 2 1 1 1 1 1 ...
# Fit a a long format logistic regression
lr_1 <- glm(y ~ x, data=dataLong, family="binomial")
print(lr_1)
## 
## Call:  glm(formula = y ~ x, family = "binomial", data = dataLong)
## 
## Coefficients:
## (Intercept)           xb  
##      -1.792        3.091  
## 
## Degrees of Freedom: 27 Total (i.e. Null);  26 Residual
## Null Deviance:       38.67 
## Residual Deviance: 26.03     AIC: 30.03
dataWide <- dataLong %>%
    group_by(x) %>%
    summarize(fail=sum(y=="fail"), success=sum(y=="success"), Total=n(), successProportion = success/Total)
dataWide
## # A tibble: 2 x 5
##   x      fail success Total successProportion
##   <fct> <int>   <int> <int>             <dbl>
## 1 a        12       2    14             0.143
## 2 b         3      11    14             0.786
# Fit a wide form logistic regression
lr_2 <- glm(cbind(fail, success) ~ x, data=dataWide, family="binomial")

# Fit a a weighted form logistic regression
lr_3 <- glm(successProportion ~ x, weights=Total, data=dataWide, family="binomial")

# print your results
print(lr_2)
## 
## Call:  glm(formula = cbind(fail, success) ~ x, family = "binomial", 
##     data = dataWide)
## 
## Coefficients:
## (Intercept)           xb  
##       1.792       -3.091  
## 
## Degrees of Freedom: 1 Total (i.e. Null);  0 Residual
## Null Deviance:       12.64 
## Residual Deviance: -4.441e-16    AIC: 9.215
print(lr_3)
## 
## Call:  glm(formula = successProportion ~ x, family = "binomial", data = dataWide, 
##     weights = Total)
## 
## Coefficients:
## (Intercept)           xb  
##      -1.792        3.091  
## 
## Degrees of Freedom: 1 Total (i.e. Null);  0 Residual
## Null Deviance:       12.64 
## Residual Deviance: 4.441e-15     AIC: 9.215
# Fit a GLM with a logit link and save it as busLogit
busLogit <- glm(Bus ~ CommuteDays, data = bus, family = binomial(link = "logit"))

# Fit a GLM with probit link and save it as busProbit
busProbit <- glm(Bus ~ CommuteDays, data = bus, family = binomial(link = "probit"))

# Print model summaries
summary(busLogit)
## 
## Call:
## glm(formula = Bus ~ CommuteDays, family = binomial(link = "logit"), 
##     data = bus)
## 
## Deviance Residuals: 
##     Min       1Q   Median       3Q      Max  
## -0.9560  -0.8595  -0.8595   1.5330   1.7668  
## 
## Coefficients:
##             Estimate Std. Error z value Pr(>|z|)    
## (Intercept) -1.45493    0.11471 -12.683  < 2e-16 ***
## CommuteDays  0.12985    0.02312   5.616 1.96e-08 ***
## ---
## Signif. codes:  0 '***' 0.001 '**' 0.01 '*' 0.05 '.' 0.1 ' ' 1
## 
## (Dispersion parameter for binomial family taken to be 1)
## 
##     Null deviance: 19568  on 15891  degrees of freedom
## Residual deviance: 19536  on 15890  degrees of freedom
## AIC: 19540
## 
## Number of Fisher Scoring iterations: 4
summary(busProbit)
## 
## Call:
## glm(formula = Bus ~ CommuteDays, family = binomial(link = "probit"), 
##     data = bus)
## 
## Deviance Residuals: 
##     Min       1Q   Median       3Q      Max  
## -0.9545  -0.8596  -0.8596   1.5328   1.7706  
## 
## Coefficients:
##             Estimate Std. Error z value Pr(>|z|)    
## (Intercept) -0.88951    0.06833 -13.017  < 2e-16 ***
## CommuteDays  0.07810    0.01380   5.658 1.53e-08 ***
## ---
## Signif. codes:  0 '***' 0.001 '**' 0.01 '*' 0.05 '.' 0.1 ' ' 1
## 
## (Dispersion parameter for binomial family taken to be 1)
## 
##     Null deviance: 19568  on 15891  degrees of freedom
## Residual deviance: 19536  on 15890  degrees of freedom
## AIC: 19540
## 
## Number of Fisher Scoring iterations: 4
# Convert from the logit scale to a probability
p <- dlogis(0)

# Simulate a logit 
rbinom(n=10, size=1, prob=p)
##  [1] 0 0 1 0 0 0 0 0 0 0
# Convert from the probit scale to a probability
p <- pnorm(0)

# Simulate a probit
rbinom(n=10, size=1, prob=p)
##  [1] 0 0 0 1 0 0 1 0 1 1

Chapter 3 - Interpreting and Visualizing GLMs

Poisson Regression Coefficients:

  • Linear models are additive, but we may want to use the linear model with a link to an exponential (multiplicative)
  • The Poisson model is multiplicative while the linear model is additive
    • poissonOut <- glm(y ~ x, family = ‘poisson’)
    • tidy(poissonOut, exponentiate = TRUE) # exponentiate the coefficients
  • A significant Poisson coefficient should be statistically different from 1 (since this is exp(0))

Plotting Poisson Regression:

  • Can use either a geom_smooth() or a boxplot()
  • Example of using simulated does data on cancer cells
    • ggplot(data = dat, aes(x = dose, y = cells)) + geom_point()
    • ggplot(data = dat, aes(x = dose, y = cells)) + geom_jitter(width = 0.05, height = 0.05)
    • ggplot(data=dat, aes(x = dose, y = cells)) + geom_jitter(width = 0.05, height = 0.05) geom_smooth()
    • ggplot(data = dat, aes(x = dose, y = cells)) + geom_jitter(width = 0.05, height = 0.05) + geom_smooth(method = ‘glm’, method.args = list(family = ‘poisson’)) # Poisson GLM

Understanding output from logistic regression:

  • Linear model results are the easiest to communicate
  • Poisson model results are multiplicative rather than additive, and are relatively easy to communicate
  • Logistic model results are in log-odds form, which are harder to communicate
    • The odds ratio is p(win) / p(loss)
    • The log-odds are the logit, and are ln( p/(1-p) ), and this is the logit function
    • The odds are exp(log-odds)
    • The odds ratio is exp(Beta-1) - if the odds ratio is 1, there is no impact (odds ratios greater than 1 mean a greater chance of something occuring)
  • Can extract confidence intervals and coefficients from the binomial GLM
    • glmOut <- glm(y ~ x, family = ‘binomial’)
    • coef(glmOut)
    • exp(coef(glmOut))
    • confint(glmOut)
    • exp(confint(glmOut))
    • tidy(glmOut, exponentiate = TRUE, conf.int= TRUE) # get everything at once from the broom::tidy() package

ggplot2 and binomial regression:

  • Can look at plots for the underlying data for a ggplot2
    • ggplot(bus, aes(x = MilesOneWay, y = Bus)) + geom_point()
    • ggJitter <- ggplot(bus, aes(x = MilesOneWay, y = Bus)) + geom_jitter(width = 0, height = 0.05)
    • ggJitter + geom_smooth() # does not work!
    • bus\(Bus2 <- as.numeric(bus\)Bus) - 1 # convert factor to numeric
    • ggJitter + geom_smooth() # still not really right
    • ggJitter + geom_smooth(method = ‘glm’, method.args = list(family = “binomial”)) # much better!
  • Can use graphs to compare probit and logit
    • ggJitter + geom_smooth(method = ‘glm’, method.args = list(family = binomial(link = ‘logit’)), se = FALSE, color = ‘red’) + geom_smooth(method = ‘glm’, method.args = list(family = binomial(link = ‘probit’)), se = FALSE, color = ‘blue’)

Example code includes:

# extract the coeffients from lmOut
(lmCoef <- coef(lmOut))
## (Intercept)      Month2      Month3      Month4      Month5      Month6 
##  0.12947658 -0.03803116 -0.07840132 -0.05725436 -0.03270239 -0.04336547 
##      Month7      Month8      Month9     Month10     Month11     Month12 
## -0.00582067 -0.05151959 -0.02392103 -0.05420777 -0.02392103 -0.02291921
# extract the coefficients from poisosnOut
(poissonCoef <- coef(poissonOut))
## (Intercept)      Month2      Month3      Month4      Month5      Month6 
## -2.04425523 -0.34775767 -0.93019964 -0.58375226 -0.29111968 -0.40786159 
##      Month7      Month8      Month9     Month10     Month11     Month12 
## -0.04599723 -0.50734279 -0.20426264 -0.54243411 -0.20426264 -0.19481645
# take the exponetial using exp()
(poissonCoefExp <- exp(poissonCoef))
## (Intercept)      Month2      Month3      Month4      Month5      Month6 
##   0.1294766   0.7062700   0.3944749   0.5578014   0.7474262   0.6650709 
##      Month7      Month8      Month9     Month10     Month11     Month12 
##   0.9550446   0.6020933   0.8152482   0.5813315   0.8152482   0.8229857
# This is because the Poisson coefficients are multiplicative
# Notice that 0.129 * 0.706 = 0.091 from the Poisson coefficents is the same as 0.129-0.038 = 0.091 from the linear model

cellData <- data.frame(dose=c(1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 2, 2, 2, 2, 2, 2, 2, 2, 2, 2, 3, 3, 3, 3, 3, 3, 3, 3, 3, 3, 4, 4, 4, 4, 4, 4, 4, 4, 4, 4, 5, 5, 5, 5, 5, 5, 5, 5, 5, 5, 6, 6, 6, 6, 6, 6, 6, 6, 6, 6, 7, 7, 7, 7, 7, 7, 7, 7, 7, 7, 8, 8, 8, 8, 8, 8, 8, 8, 8, 8, 9, 9, 9, 9, 9, 9, 9, 9, 9, 9, 10, 10, 10, 10, 10, 10, 10, 10, 10, 10), 
                       cells=c(1, 0, 0, 0, 0, 2, 0, 1, 2, 0, 3, 0, 2, 2, 1, 0, 1, 2, 2, 2, 2, 3, 5, 3, 0, 3, 6, 2, 4, 4, 2, 2, 8, 4, 4, 4, 7, 2, 6, 5, 2, 5, 8, 4, 7, 4, 4, 7, 9, 3, 6, 7, 9, 5, 3, 5, 5, 3, 4, 11, 2, 7, 9, 3, 4, 2, 6, 5, 5, 6, 4, 5, 8, 10, 11, 9, 8, 8, 11, 7, 10, 12, 9, 12, 10, 12, 9, 17, 6, 9, 15, 11, 11, 10, 4, 9, 13, 8, 8, 13)
                       )

# Use geom_smooth to plot a continuous predictor variable
ggplot(data = cellData, aes(x = dose, y = cells)) + 
    geom_jitter(width = 0.05, height = 0.05) + 
    geom_smooth(method = 'glm', method.args = list(family = 'poisson'))

# Extract out the coefficients 
coefOut <- coef(busOut)

# Convert the coefficients to odds-ratios 
exp(coefOut)
## (Intercept) CommuteDays 
##   0.2334164   1.1386623
# use tidy on busOut and exponentiate the results and extract the confidence interval
broom::tidy(busOut, exponentiate=TRUE, conf.int=TRUE)
## # A tibble: 2 x 7
##   term        estimate std.error statistic  p.value conf.low conf.high
##   <chr>          <dbl>     <dbl>     <dbl>    <dbl>    <dbl>     <dbl>
## 1 (Intercept)    0.233    0.115     -12.7  7.32e-37    0.186     0.292
## 2 CommuteDays    1.14     0.0231      5.62 1.96e- 8    1.09      1.19
str(bus)
## Classes 'tbl_df', 'tbl' and 'data.frame':    15892 obs. of  3 variables:
##  $ CommuteDays: int  5 5 5 5 3 4 5 5 5 5 ...
##  $ MilesOneWay: num  19.5 19.5 19.5 19.5 19.5 ...
##  $ Bus        : Factor w/ 2 levels "No","Yes": 2 2 2 2 2 2 1 1 1 1 ...
bus <- bus %>%
    mutate(Bus2 = as.integer(Bus)-1)
str(bus)
## Classes 'tbl_df', 'tbl' and 'data.frame':    15892 obs. of  4 variables:
##  $ CommuteDays: int  5 5 5 5 3 4 5 5 5 5 ...
##  $ MilesOneWay: num  19.5 19.5 19.5 19.5 19.5 ...
##  $ Bus        : Factor w/ 2 levels "No","Yes": 2 2 2 2 2 2 1 1 1 1 ...
##  $ Bus2       : num  1 1 1 1 1 1 0 0 0 0 ...
# add in the missing parts of the ggplot
ggJitter <- ggplot(data = bus, aes(x = MilesOneWay, y = Bus2)) + 
    geom_jitter(width = 0, height = 0.05)

# add in geom_smooth()
ggJitter + geom_smooth()
## `geom_smooth()` using method = 'gam' and formula 'y ~ s(x, bs = "cs")'

# add in the missing parts of the ggplot
ggJitter + geom_smooth(method =  "glm" , method.args = list(family="binomial"))

# add in the missing parts of the ggplot
ggJitter + 
    geom_smooth(method = 'glm', method.args = list(family = binomial(link="probit")), 
                color = 'red', se = FALSE
                ) +
    geom_smooth(method = 'glm', method.args = list(family = binomial(link="logit")), 
                color = 'blue', se = FALSE
                )


Chapter 4 - Multiple Regression with GLMs

Multiple logistic regression:

  • Can use multiple predictors in the logistic regression
    • Risks of over-fitting as the number of predictor variables increases - typical target of observations >= 10*predictors
    • glm(Bus ~ CommuteDay + MilesOneWay, data = bus, family = ‘binomial’)
  • When there is correlation in the predictors, the coefficients may change depending on the order in which they appear in the equation

Formulas in R:

  • The model.matrix() is the cornerstone of the regression process; often run behind the scenes
  • With multiple intercepts, the default is to have the global intercept as the first group, and all other groups being the intercept relative to the reference group

Assumptions of multiple logistic regression:

  • Simpson’s paradox can be a confounder - need to include all the relevant grouping variables
    • Example of the UC Berkeley admission data - key to include the “by department” variable
  • Assumptions of linear and monotonic responses
  • Predictors and response variables should be independent
  • Over-dispersion can cause issues - too many zeroes, too many ones, changing variances over x, etc.

Wrap up:

  • GLM extensions of LM - count data, logits, plotting, etc.

Example code includes:

# Build a logistic regression with Bus predicted by CommuteDays and MilesOneWay
busBoth <- glm(Bus ~ CommuteDays + MilesOneWay, data=bus, family="binomial")

# Look at the summary of the output
summary(busBoth)
## 
## Call:
## glm(formula = Bus ~ CommuteDays + MilesOneWay, family = "binomial", 
##     data = bus)
## 
## Deviance Residuals: 
##     Min       1Q   Median       3Q      Max  
## -1.0732  -0.9035  -0.7816   1.3968   2.5066  
## 
## Coefficients:
##              Estimate Std. Error z value Pr(>|z|)    
## (Intercept) -0.707515   0.119719  -5.910 3.42e-09 ***
## CommuteDays  0.066084   0.023181   2.851  0.00436 ** 
## MilesOneWay -0.059571   0.003218 -18.512  < 2e-16 ***
## ---
## Signif. codes:  0 '***' 0.001 '**' 0.01 '*' 0.05 '.' 0.1 ' ' 1
## 
## (Dispersion parameter for binomial family taken to be 1)
## 
##     Null deviance: 19568  on 15891  degrees of freedom
## Residual deviance: 19137  on 15889  degrees of freedom
## AIC: 19143
## 
## Number of Fisher Scoring iterations: 4
# Build a logistic regression with Bus predicted by CommuteDays
busDays <- glm(Bus ~ CommuteDays, data=bus, family="binomial")

# Build a logistic regression with Bus predicted by MilesOneWay
busMiles <- glm(Bus ~ MilesOneWay, data=bus, family="binomial")


# Build a glm with CommuteDays first and MilesOneWay second
busOne <- glm(Bus ~ CommuteDays + MilesOneWay, data=bus, family="binomial")

# Build a glm with MilesOneWay first and CommuteDays second
busTwo <- glm(Bus ~ MilesOneWay + CommuteDays, data=bus, family="binomial")

# Print model summaries
summary(busOne)
## 
## Call:
## glm(formula = Bus ~ CommuteDays + MilesOneWay, family = "binomial", 
##     data = bus)
## 
## Deviance Residuals: 
##     Min       1Q   Median       3Q      Max  
## -1.0732  -0.9035  -0.7816   1.3968   2.5066  
## 
## Coefficients:
##              Estimate Std. Error z value Pr(>|z|)    
## (Intercept) -0.707515   0.119719  -5.910 3.42e-09 ***
## CommuteDays  0.066084   0.023181   2.851  0.00436 ** 
## MilesOneWay -0.059571   0.003218 -18.512  < 2e-16 ***
## ---
## Signif. codes:  0 '***' 0.001 '**' 0.01 '*' 0.05 '.' 0.1 ' ' 1
## 
## (Dispersion parameter for binomial family taken to be 1)
## 
##     Null deviance: 19568  on 15891  degrees of freedom
## Residual deviance: 19137  on 15889  degrees of freedom
## AIC: 19143
## 
## Number of Fisher Scoring iterations: 4
summary(busTwo)
## 
## Call:
## glm(formula = Bus ~ MilesOneWay + CommuteDays, family = "binomial", 
##     data = bus)
## 
## Deviance Residuals: 
##     Min       1Q   Median       3Q      Max  
## -1.0732  -0.9035  -0.7816   1.3968   2.5066  
## 
## Coefficients:
##              Estimate Std. Error z value Pr(>|z|)    
## (Intercept) -0.707515   0.119719  -5.910 3.42e-09 ***
## MilesOneWay -0.059571   0.003218 -18.512  < 2e-16 ***
## CommuteDays  0.066084   0.023181   2.851  0.00436 ** 
## ---
## Signif. codes:  0 '***' 0.001 '**' 0.01 '*' 0.05 '.' 0.1 ' ' 1
## 
## (Dispersion parameter for binomial family taken to be 1)
## 
##     Null deviance: 19568  on 15891  degrees of freedom
## Residual deviance: 19137  on 15889  degrees of freedom
## AIC: 19143
## 
## Number of Fisher Scoring iterations: 4
size <- c(1.1, 2.2, 3.3)
count <- c(10, 4, 2)

# use model matrix with size
model.matrix(~ size)
##   (Intercept) size
## 1           1  1.1
## 2           1  2.2
## 3           1  3.3
## attr(,"assign")
## [1] 0 1
# use model matirx with count
model.matrix(~ size + count)
##   (Intercept) size count
## 1           1  1.1    10
## 2           1  2.2     4
## 3           1  3.3     2
## attr(,"assign")
## [1] 0 1 2
color <- c("red", "blue", "green")

# create a matrix that includes a reference intercept
model.matrix(~ color)
##   (Intercept) colorgreen colorred
## 1           1          0        1
## 2           1          0        0
## 3           1          1        0
## attr(,"assign")
## [1] 0 1 1
## attr(,"contrasts")
## attr(,"contrasts")$color
## [1] "contr.treatment"
# create a matrix that includes an intercept for each group
model.matrix(~ color - 1)
##   colorblue colorgreen colorred
## 1         0          0        1
## 2         1          0        0
## 3         0          1        0
## attr(,"assign")
## [1] 1 1 1
## attr(,"contrasts")
## attr(,"contrasts")$color
## [1] "contr.treatment"
shape <- c("square", "square", "circle")

# create a matrix that includes color and shape  
model.matrix(~ color + shape - 1)
##   colorblue colorgreen colorred shapesquare
## 1         0          0        1           1
## 2         1          0        0           1
## 3         0          1        0           0
## attr(,"assign")
## [1] 1 1 1 2
## attr(,"contrasts")
## attr(,"contrasts")$color
## [1] "contr.treatment"
## 
## attr(,"contrasts")$shape
## [1] "contr.treatment"
# create a matrix that includes shape and color 
model.matrix(~ shape + color - 1)
##   shapecircle shapesquare colorgreen colorred
## 1           0           1          0        1
## 2           0           1          0        0
## 3           1           0          1        0
## attr(,"assign")
## [1] 1 1 2 2
## attr(,"contrasts")
## attr(,"contrasts")$shape
## [1] "contr.treatment"
## 
## attr(,"contrasts")$color
## [1] "contr.treatment"
data("UCBAdmissions", package="datasets")
UCBdata <- as.data.frame(UCBAdmissions) %>%
    mutate(Gender=factor(Gender, levels=c("Female", "Male")), Dept=factor(Dept, levels=LETTERS[1:6])) %>%
    tidyr::spread(Admit, Freq) %>%
    arrange(Dept, Gender)

# build a binomial glm where Admitted and Rejected are predicted by Gender
glm1 <- glm(cbind(Admitted, Rejected) ~ Gender, data=UCBdata, family="binomial")
summary(glm1)
## 
## Call:
## glm(formula = cbind(Admitted, Rejected) ~ Gender, family = "binomial", 
##     data = UCBdata)
## 
## Deviance Residuals: 
##      Min        1Q    Median        3Q       Max  
## -16.7915   -4.7613   -0.4365    5.1025   11.2022  
## 
## Coefficients:
##             Estimate Std. Error z value Pr(>|z|)    
## (Intercept) -0.83049    0.05077 -16.357   <2e-16 ***
## GenderMale   0.61035    0.06389   9.553   <2e-16 ***
## ---
## Signif. codes:  0 '***' 0.001 '**' 0.01 '*' 0.05 '.' 0.1 ' ' 1
## 
## (Dispersion parameter for binomial family taken to be 1)
## 
##     Null deviance: 877.06  on 11  degrees of freedom
## Residual deviance: 783.61  on 10  degrees of freedom
## AIC: 856.55
## 
## Number of Fisher Scoring iterations: 4
# build a binomial glm where Admitted and Rejected are predicted by Gender and Dept
glm2 <- glm(cbind(Admitted, Rejected) ~ Gender + Dept, data=UCBdata, family="binomial")
summary(glm2)
## 
## Call:
## glm(formula = cbind(Admitted, Rejected) ~ Gender + Dept, family = "binomial", 
##     data = UCBdata)
## 
## Deviance Residuals: 
##       1        2        3        4        5        6        7        8  
##  3.7189  -1.2487   0.2706  -0.0560  -0.9243   1.2533  -0.0858   0.0826  
##       9       10       11       12  
## -0.8509   1.2205   0.2052  -0.2076  
## 
## Coefficients:
##             Estimate Std. Error z value Pr(>|z|)    
## (Intercept)  0.68192    0.09911   6.880 5.97e-12 ***
## GenderMale  -0.09987    0.08085  -1.235    0.217    
## DeptB       -0.04340    0.10984  -0.395    0.693    
## DeptC       -1.26260    0.10663 -11.841  < 2e-16 ***
## DeptD       -1.29461    0.10582 -12.234  < 2e-16 ***
## DeptE       -1.73931    0.12611 -13.792  < 2e-16 ***
## DeptF       -3.30648    0.16998 -19.452  < 2e-16 ***
## ---
## Signif. codes:  0 '***' 0.001 '**' 0.01 '*' 0.05 '.' 0.1 ' ' 1
## 
## (Dispersion parameter for binomial family taken to be 1)
## 
##     Null deviance: 877.056  on 11  degrees of freedom
## Residual deviance:  20.204  on  5  degrees of freedom
## AIC: 103.14
## 
## Number of Fisher Scoring iterations: 4
# Add a non-linear equation to a geom_smooth
ggJitter + 
  geom_smooth(method = 'glm', method.args = list(family = 'binomial'), formula = y~I(x^2), color = 'red')


Introduction to Bioconductor

Chapter 1 - What is Bioconductor?

Introduction to the Bioconductor Project:

  • Bioconductor is open-source software - datasets and packages for analyzing biological data
    • Typically for measuring either the structure or the function (or the interactions of these) for biological elements
  • Bioconductor has its own repository and means of installing packages
  • Bioconductor is constantly in development
    • library(packageName)
    • BiocInstaller::biocVersion()
    • sessionInfo()
    • packageVersion(“packageName”)
    • BiocInstaller::biocValid()

Role of S4 in Bioconductor:

  • R uses S3 and S4; Bioconductor inherits from S4
  • The S3 system is simple and powerful, and is typically used for CRAN
    • S3 often uses generic functions such as plot() and print() which behave differently depending on the object type
  • The S4 system implements OOP by defining objects that are generalized to classes
    • S4 classes have a formal definition and inheritance, making type checking much easier
    • mydescriptor <- new(“GenomeDescription”)
    • The S4 class is more complex than S3; higher setup costs but easier to share and reuse
  • Can check whether an object is from an S4 class
    • isS4(mydescriptor)
    • str(mydescriptor) # will show a formal class with slots
  • The S4 class has a name, slots (methods/fields), and inheritance (often from “contains”)
  • There are S4 accessors for getting the slots (methods/fields)
    • .S4methods(class = “GenomeDescription”)
    • showMethods(classes = “GenomeDescription”, where = search())
    • show(myDescriptor) # sort of like str() but for objects

Biology of Genomic Datasets:

  • Organisms are complex and interconnected and can be unicellular or multicellular
  • All organisms have a genome (complete genetic material, stored mostly in the chromosomes) - the “blueprint”
    • TAGC are the building blocks
  • The genome can be thought of as a genetic DNA alphabet
    • Genes contain heredity instructions
    • Coding genes are expressed through proteins - DNA to RNA (transcription) and RNA to protein (translation)
    • Non-coding genes are not expressed
  • Yeast is a single-cell organism that is frequently used in food and beverage creation
    • library(BSgenome.Scerevisiae.UCSC.sacCer3)
    • yeast <- BSgenome.Scerevisiae.UCSC.sacCer3
    • available.genomes()
    • length(yeast)
    • names(yeast)
    • seqlengths(yeast)
    • getSeq(yeast)
    • getSeq(yeast, “chrM”) # get chromosomes
    • getSeq(yeast, end = 10) # first 10 base pairs of each chromosome

Example code includes:

# Load the BiocInstaller package
library(BiocInstaller)

# Explicit syntax to check the Bioconductor version
BiocInstaller::biocVersion() 

# When BiocInstaller is loaded use biocVersion alone
biocVersion()


# Load the BSgenome package
library(BSgenome)

# Check the version of the BSgenome package
packageVersion("BSgenome")

# Investigate about the a_genome using show()
# show(a_genome)

# Investigate some other accesors
# organism(a_genome)
# provider(a_genome)
# seqinfo(a_genome)


# Load the yeast genome
library(BSgenome.Scerevisiae.UCSC.sacCer3)

# Assign data to the yeastGenome object
yeastGenome <- BSgenome.Scerevisiae.UCSC.sacCer3

# Get the head of seqnames and tail of seqlengths for yeastGenome
head(seqnames(yeastGenome))
tail(seqlengths(yeastGenome))

# Select chromosome M, alias chrM
yeastGenome$chrM

# Count characters of the chrM sequence
nchar(yeastGenome$chrM)


# Assign data to the yeastGenome object
yeastGenome <- BSgenome.Scerevisiae.UCSC.sacCer3

# Get the first 30 bases of each chromosome
getSeq(yeastGenome, start=1, end=30)

Chapter 2 - Biostrings and When to Use Them

Introduction to Biostrings:

  • Biostrings has method for quickly processing biological strings
    • Memory efficient
    • Conatiners that can be inherited
    • showClass(“XString”)
    • showClass(“BString”)
    • showClass(“BStringSet”)
  • There are bases for DNA and RNA available for use
    • DNA_BASES # DNA 4 bases
    • RNA_BASES # RNA 4 bases
    • AA_STANDARD # 20 Amino acids
    • DNA_ALPHABET # contains IUPAC_CODE_MAP
    • RNA_ALPHABET # contains IUPAC_CODE_MAP
    • AA_ALPHABET # contains AMINO_ACID_CODE
  • The general process for gene expression includes
    • Double-strand DNA splits, and is RNA transcribed (T becomes A, A becomes U, C -> G, G -> C)
    • Each three RNA translate to an amino acid
    • dna_seq <- DNAString(“ATGATCTCGTAA”)
    • rna_seq <- RNAString(dna_seq)
    • rna_seq # will give seq: AUGAUCUCGUAA
    • aa_seq <- translate(rna_seq) # Translation RNA to AA
    • aa_seq # seq: MIS*
    • translate(dna_seq) # translate() also goes directly from DNA to AA (shortcut to the RNA and translate process)

Sequence handling:

  • Can use XString to store a single sequence
  • Can use XStrinSet to store multiple sequences, each of varying lengths
    • zikaVirus <- readDNAStringSet(“data/zika.fa”)
    • zikaVirus_seq <- unlist(zikaVirus) # to collate the sequence use unlist
    • zikaSet <- DNAStringSet(zikaVirus_seq, start = c(1, 101, 201), end = c(100, 200, 300)) # to create a new set from a single sequence
    • complement(a_seq) # the complementary sequence
  • Can use rev to reverse a sequence
    • rev(zikaShortSet) # the last list will become first
    • reverse(zikaShortSet) # reverse from right to left for each of the sequences in the set
    • reverseComplement(rna_seq) # same as reverseComplement(rna_seq) but more memory efficient

Why we are interested in patterns:

  • Can learn more about patterns using sequencing - frequency, occurences, etc.
  • Can use Biostring string matching functions
    • matchPattern(pattern, subject) # 1 string to 1 string
    • vmatchPattern(pattern, subject) # 1 set of strings to 1 string OR 1 string to a set of strings
  • Palindromes can be important in biology - binding sites
    • findPalindromes() # find palindromic regions in a single sequence
  • There are six possibilities with translation based on the start of the sequence - reverseComplements and amino acids (based on 3 bases) depending on where the window starts
    • [1] 30 ACATGGGCCTACCATGGGAGCTACGAAGCC # original sequence
    • 6 possible reading frames, DNAStringSet

    • [1] 30 ACATGGGCCTACCATGGGAGCTACGAAGCC + 1
    • [2] 30 GGCTTCGTAGCTCCCATGGTAGGCCCATGT - 1
    • [3] 29 CATGGGCCTACCATGGGAGCTACGAAGCC + 2
    • [4] 29 GCTTCGTAGCTCCCATGGTAGGCCCATGT - 2
    • [5] 28 ATGGGCCTACCATGGGAGCTACGAAGCC + 3
    • [6] 28 CTTCGTAGCTCCCATGGTAGGCCCATGT - 3

Example code includes:

# Load packages
library(Biostrings)

# Check the alphabet of the zikaVirus
alphabet(zikaVirus)

# Check the alphabetFrequency of the zikaVirus
alphabetFrequency(zikaVirus)

# Check alphabet of the zikaVirus using baseOnly = TRUE
alphabet(zikaVirus, baseOnly = TRUE)


# Unlist the set and select the first 21 letters as dna_seq, then print it
dna_seq <- DNAString(subseq(as.character(zikaVirus), end = 21))
dna_seq

# 1.1 Transcribe dna_seq as rna_seq, then print it
rna_seq <- RNAString(dna_seq) 
rna_seq

# 1.2 Translate rna_seq as aa_seq, then print it
aa_seq <- translate(rna_seq)
aa_seq

# 2.1 Translate dna_seq as aa_seq_2, then print it
aa_seq_2 <- translate(dna_seq)
aa_seq_2


# Create zikv with one collated sequence using `zikaVirus`
zikv <- unlist(zikaVirus)

# Check the length of zikaVirus and zikv
length(zikaVirus)
length(zikv)

# Check the width of zikaVirus
width(zikaVirus)

# Subset zikv to only the first 30 bases
subZikv <- subseq(zikv, end = 30)
subZikv


# The reverse of zikv is
reverse(zikv)

# The complement of zikv is
complement(zikv)

# The reverse complement of zikv is
reverseComplement(zikv)

# The translation of zikv is
translate(zikv)


# Find palindromes in zikv
findPalindromes(zikv)


# print the rnaframesZikaSet 
rnaframesZikaSet

# translate all 6 reading frames 
AAzika6F <- translate(rnaframesZikaSet)
AAzika6F

# Count the matches allowing 15 mistmatches
vcountPattern(pattern = ns5, subject = AAzika6F, max.mismatch = 15)

# Select the frame that contains the match
selectedSet <- AAzika6F[3]

#Convert this frame into a single sequence
selectedSeq <- unlist(selectedSet)


# Use vmatchPattern with the set
vmatchPattern(pattern = ns5, subject = selectedSet, max.mismatch = 15)

# Use matchPattern with the single sequence
matchPattern(pattern = ns5, subject = selectedSeq, max.mismatch = 15)

Chapter 3 - IRanges and GenomicRanges

IRanges and Genomic Structures:

  • Can sequence millions of genes for cheap, so there is need for analyzing large sequence data
  • Sequence ranges are a core component of the analysis
    • library(IRanges)
    • myIRanges <- IRanges(start = 20, end = 30)
    • (myIRanges_width <- IRanges(start = c(1, 20), width = c(30, 11)))
    • (myIRanges_end <- IRanges(start = c(1, 20), end = 30))
    • Note that width = end - start + 1
  • Can also use RLE - run length encoding
    • General S4 containers for saving large and repetitive vectors
    • (some_numbers <- c(3, 2, 2, 2, 3, 3, 4, 2))
    • (Rle(some_numbers)) # numeric-Rle of length 8 with 5 runs
  • Can also create using logical vectors for keep or skip
    • IRanges(start = c(FALSE, FALSE, TRUE, TRUE)) # will pull items 3 and 4 for a range of width 2
    • gi <- c(TRUE, TRUE, FALSE, FALSE, TRUE, TRUE, TRUE)
    • myRle <- Rle(logi)
  • The Irange is hierarchical and can hold metadata

Gene of Interest:

  • Genomic sequences can be split over numerous chromosomes; may want to extract with sequential ranges
    • library(GenomicRanges)
    • (myGR <- GRanges(“chr1:200-300”)) # name:start-end as a character (each range is associated to a chromosome)
    • methods(class = “GRanges”) # to check available accessors
    • seqnames(gr) # used for chromosome names
    • ranges(gr) # returns an IRanges object for ranges
    • mcols(gr) # stores metadata columns
    • seqinfo(gr) # generic function to store sequence information
    • genome(gr) # stores the genome name
  • Accessors can be inherited across S4 classes
  • One of the genes of interest is ABCD1 (end of the X chromosome long arm)
    • library(TxDb.Hsapiens.UCSC.hg38.knownGene)
    • hg <- TxDb.Hsapiens.UCSC.hg38.knownGene
    • hg_chrXg <- genes(hg, filter = list(tx_chrom = c(“chrX”)))

Manipulating collections of GRanges:

  • The GRangesList-class is a container for storing a collection of GRanges
    • as(mylist, “GRangesList”)
    • GRangesList(myGranges1, myGRanges2, …)
    • unlist(myGRangesList) # convert back to Granges
    • methods(class = “GRangesList”)
  • Multiple GRanges objects may be combined into a GRangesList
    • GRanges in a list will be taken as compound features of a larger object
    • transcripts by gene, exons by transcripts, read alignments, sliding windows
  • Can break a region in to smaller regions
    • hg_chrX
    • slidingWindows(hg_chrX, width = 20000, step = 10000) # there is overlap of 10000 and the last range will (typically) be shorter
  • Can grab known genomic features
    • library(TxDb.Hsapiens.UCSC.hg38.knownGene)
    • (hg <- TxDb.Hsapiens.UCSC.hg38.knownGene)
  • Can then extract gebomic features
    • seqlevels(hg) <- c(“chrX”)
    • transcripts(hg, columns = c(“tx_id”, “tx_name”), filter = NULL)
    • exons(hg, columns = c(“tx_id”, “exon_id”), filter = list(tx_id = “179161”))
    • exonsBytx <- exonsBy(hg, by = “tx”) # exons by transcript
    • abcd1_179161 <- exonsBytx[[“179161”]] # transcript id
  • Can also find genes of interest in the overlaps
    • countOverlaps(query, subject)
    • findOverlaps(query, subject)
    • subsetByOverlaps(query, subject)

Example code includes:

# load package IRanges
library(IRanges)

# start vector 1 to 5 and end 100 
IRnum1 <- IRanges(start=1:5, end=100)

# end 100 and width 89 and 10
IRnum2 <- IRanges(end=100, width=c(89, 10))

# logical argument start = Rle(c(F, T, T, T, F, T, T, T))
IRlog1 <- IRanges(start = Rle(c(FALSE, TRUE, TRUE, TRUE, FALSE, TRUE, TRUE, TRUE)))

# Printing objects in a list
print(list(IRnum1 = IRnum1, IRnum2 = IRnum2, IRlog1 = IRlog1))


# Load Package Genomic Ranges
library(GenomicRanges)

# Print the GRanges object
myGR

# Check the metadata, if any
mcols(myGR)


# load human reference genome hg38
library(TxDb.Hsapiens.UCSC.hg38.knownGene)

# assign hg38 to hg, then print it
hg <- TxDb.Hsapiens.UCSC.hg38.knownGene
hg

# extract all the genes in chromosome X as hg_chrXg, then print it
hg_chrXg <- genes(hg, filter = list(tx_chrom = c("chrX")))
hg_chrXg

# extract all positive stranded genes in chromosome X as hg_chrXgp, then sort it
hg_chrXgp <- genes(hg, filter = list(tx_chrom = c("chrX"), tx_strand = "+"))
sort(hg_chrXgp)


# load the human transcripts DB to hg
library(TxDb.Hsapiens.UCSC.hg38.knownGene)
hg <- TxDb.Hsapiens.UCSC.hg38.knownGene

# prefilter chromosome X
seqlevels(hg) <- c("chrX")

# get all transcripts by gene
hg_chrXt <- transcriptsBy(hg, by="gene")

# select gene `215` from the transcripts
hg_chrXt[[215]]


# load the human transcripts DB to hg
library(TxDb.Hsapiens.UCSC.hg38.knownGene)
hg <- TxDb.Hsapiens.UCSC.hg38.knownGene

# prefilter chromosome X
seqlevels(hg) <- c("chrX")

# get all transcripts by gene
hg_chrXt <- transcriptsBy(hg, by="gene")

# select gene `215` from the transcripts
hg_chrXt[['215']]


# Store the overlapping range in rangefound
rangefound <- subsetByOverlaps(hg_chrX, ABCD1)

# Check names of rangefound
names(rangefound)

# Check the geneOfInterest 
ABCD1

# Check rangefound
rangefound

Chapter 4 - Introducing ShortRead

Sequence Files:

  • Plant genomes tend to be large datasets; one of the plants has 135 million base pairs
  • Can store with text formats fastq (quality encoding per sequence letter) and fasta
  • The fastq format includes
    • @ unique sequence identifier
    • raw sequence string
      • optional id
    • quality encoding per sequence letter
  • The fasta (fasta, fa, seq) format is shorter and includes
    • unique sequence identifier

    • raw sequence string
  • Can read in the fasta files using
    • library(ShortRead)
    • fasample <- readFasta(dirPath = “data/”, pattern = “fasta”) # print fasample
    • methods(class = “ShortRead”)
    • writeFasta(fasample, file = “data/sample.fasta”)
  • Can read in the fastq files using
    • fqsample <- readFastq(dirPath = “data/”, pattern = “fastq”)
    • methods(class = “ShortReadQ”)
    • writeFastq(fqsample, file = “data/sample.fastq.gz”)
  • Sometimes valuable to set the seed and run a FastqSampler()
    • set.seed(123)
    • sampler <- FastqSampler(“data/SRR1971253.fastq”, 500)
    • sample_small <- yield(sampler)

Sequence Quality:

  • Quality scores are lograithmic somewhat like earthquake magnitudes
    • 10 = 1 in 10 wrong
    • 20 = 1 in 100 wrong
    • 30 = 1 in 1,000 wrong (often considered to be the cutoff for “good”)
    • 50 = 1 in 100,000 wrong
    • etc.
    • encoding(ShortRead::quality(fqsample))
    • ShortRead::quality(fqsample)
    • sread(fqsample)[1]
    • quality(fqsample)[1] # quality encoding values
    • pq <- PhredQuality(quality(fqsample)) ## PhredQuality instance
    • qs <- as(pq, “IntegerList”) # transform encoding into scores
  • Can run a quality assessment process on files that have been read in
    • qaSummary <- qa(fqsample, lane = 1) # optional lane
    • names(qaSummary)
    • browseURL(report(qaSummary)) # HTML report
    • alphabet(sread(fullSample))
    • abc <- alphabetByCycle(sread(fullSample))
    • nucByCycle <- t(abc[1:4,])
    • nucByCycle <- nucByCycle %>%
    • as.tibble() %>% # convert to tibble
    • mutate(cycle = 1:50) # add cycle numbers

Match and Filter:

  • Can run the match and filter process while reading in a large file
  • Duplicate sequences can result from a biological process, PCR amplification, sequencing more than onbce, etc.
    • Duplicates should generally be marked, and an acceptable threshhold set
    • table(srduplicated(dfqsample))
    • cleanReads <- mydReads[srduplicated(mydReads) == FALSE]
    • table(srduplicated(cleanReads))
  • Can create your own filters using srFilter
    • readWidthCutOff <- srFilter(function(x) {width(x) >= minWidth}, name = “MinWidth”)
    • minWidth <- 51
    • fqsample[readWidthCutOff(fqsample)]
    • myFilter <- nFilter(threshold = 10, .name = “cleanNFilter”)
    • filtered <- readFastq(dirPath = “data”, pattern = “.fastq”, filter = myFilter)
  • Can also use idFilter and polynFilter
    • myFilterID <- idFilter(regex = “:3:1”)
    • filtered <- readFastq(dirPath = “data”, pattern = “.fastq”, filter = myFilterID)
    • myFilterPolyA <- polynFilter(threshold = 10, nuc = c(“A”))
    • filtered[myFilterPolyA(filtered)]

Multiple Assessment:

  • Desire to save time and resources when reading in high volume data - parallel processing
    • library(Rqc) # uses many of the basic Bioconductor packages as well as some of the basic CRAN packages
    • qaRqc <- rqcQA(files) # pass a file list as the files object
    • class(qaRqc) # “list”
    • names(qaRqc) # name of the input files
    • qaRqc[1]
    • qaRqc <- rqcQA(files, workers = 4)) # run it in parallel, saving only the quality assessment
  • Can also save a sample of the parallel reads, using a seed for reproducibility
    • set.seed(1111)
    • qaRqc_sample <- rqcQA(files, workers = 4, sample = TRUE, n = 500))
  • Can also build paired files using the pair= argument
    • pfiles <- “data/seq_11.fq” “data/seq1_2.fq” “data/seq2_1.fq” “data/seq2_2.fq”
    • qaRqc_paired <- rqcQA(pfiles, workers = 4, pair = c(1, 1, 2, 2)))
    • reportFile <- rqcReport(qaRqc, templateFile = “myReport.Rmd”)
    • browseURL(reportFile)
    • qaRqc <- rqcQA(files, workers = 4))
    • perFileInformation(qaRqc)

Introduction to Bioconductor:

  • Installing packages from Bioconductor
  • Basic techniques for reading, manipulating, filtering, raw genomic data
  • BSGenome and TxDb built-in datasets
  • Check the quality of sequence files using ShortRead and Rqc
  • Explored variety of organisms

Example code includes:

# load ShortRead
library(ShortRead)

# print fqsample
fqsample

# class of fqsample
class(fqsample)

# class sread fqsample
class(sread(fqsample))

# id fqsample
id(fqsample)


qaSummary <- qa(fqsample, type = "fastq", lane = 1)

# load ShortRead
library(ShortRead)

# Check quality
quality(fqsample)

# Check encoding
encoding(quality(fqsample))

# Check baseQuality
qaSummary[["baseQuality"]]


# glimpse nucByCycle
glimpse(nucByCycle)

# make an awesome plot!
nucByCycle %>% 
  # gather the nucleotide letters in alphabet and get a new count column
  gather(key = alphabet, value = count , -cycle) %>% 
  ggplot(aes(x = cycle, y =  count, colour = alphabet)) +
  geom_line(size = 0.5 ) +
  labs(y = "Frequency") +
  theme_bw() +
  theme(panel.grid.major.x = element_blank())


myStartFilter <- srFilter(function(x) substr(sread(x), 1, 5) == "ATGCA")

# Load package ShortRead
library(ShortRead)

# Check class of fqsample
class(fqsample)

# filter reads into selectedReads using myStartFilter
selectedReads <- fqsample[myStartFilter(fqsample)]

# Check class of selectedReads
class(selectedReads)

# Check detail of selectedReads
detail(selectedReads)


# Load package Rqc
library(Rqc)

# Average per cycle quality plot
rqcCycleAverageQualityPlot(qa)

# Average per cycle quality plot with white background
rqcCycleAverageQualityPlot(qa) + theme_minimal()

# Read quality plot with white background
rqcReadQualityPlot(qa) + theme_minimal()

Non-Linear Modeling in R with GAM

Chapter 1 - Introduction to Generalized Additive Models

Introduction:

  • There are trade-offs between model power (e.g., ML) and parsimony (e.g., linear regression), with GAM being a middle-ground solution
  • GAM allows for flexibly modeling non-linear relationships
    • linear_mod <- lm(y ~ x, data = my_data)
    • library(mgcv)
    • gam_mod <- gam(y ~ s(x), data = my_data) # s() is the smoothing function
  • The flexible smooth is built up from simpler basis functions
    • The overall smooth is the sum of the simpler basis functions
    • coef(gam_mod)

Basis functions and smoothing:

  • Because the GAM often has many basis coefficients, there is a meaningful risk of over-fitting
    • Fit = Likelihood - lambda * Wiggliness (lambda is the smoothing parameter, and is optimized while R fits the data to the GAM)
  • Can fit the smoothing parameter using arguments in the gam() function call
    • gam(y ~ s(x), data = dat, sp = 0.1) # global sp argument
    • gam(y ~ s(x, sp = 0.1), data = dat) # sp argument specific to a term
    • gam(y ~ s(x), data = dat, method = “REML”) # select smoothing using Restricted Maximum Likelihood
  • The number of basis functions also drives both fit to the the training data and risk of over-fitting
    • gam(y ~ s(x, k = 3), data = dat, method = “REML”)
    • gam(y ~ s(x, k = 10), data = dat, method = “REML”) # even if the k is “too high”, the REML will help prevent overfits
    • gam(y ~ s(x), data = dat, method = “REML”) # defaults

Multivariate GAMs:

  • Can run the GAM using multiple independent variables - smooths, categoricals, etc.
  • Can start with a simple model
    • model <- gam(hw.mpg ~ s(weight), data = mpg, method = “REML”)
  • Can then extend the simple model to include additional predictors
    • model2 <- gam(hw.mpg ~ s(weight) + s(length), data = mpg, method = “REML”)
    • model2 <- gam(hw.mpg ~ s(weight) + length, data = mpg, method = “REML”) # combined linear and non-linear terms since length is not enclosed in an s()
    • model2b <- gam(hw.mpg ~ s(weight) + s(length, sp = 1000), data = mpg, method = “REML”) # will be linear since there is strong smoothing due to sp=1000
  • Linear terms are especially valuable with categorical predictors
    • model3 <- gam(hw.mpg ~ s(weight) + fuel, data = mpg, method = “REML”) # fuel needs to be a factor; mgcv will not handle characters
    • model4 <- gam(hw.mpg ~ s(weight, by = fuel), data = mpg, method = “REML”) # smooths will be by categories of fuel
    • model4b <- gam(hw.mpg ~ s(weight, by = fuel) + fuel, data = mpg, method = “REML”) # add intercept as well as smooth by vategory of fuel

Example code includes:

data(mcycle, package="MASS")

# Examine the mcycle data frame
head(mcycle)
##   times accel
## 1   2.4   0.0
## 2   2.6  -1.3
## 3   3.2  -2.7
## 4   3.6   0.0
## 5   4.0  -2.7
## 6   6.2  -2.7
plot(mcycle)

# Fit a linear model
lm_mod <- lm(accel ~ times, data = mcycle)

# Visualize the model
termplot(lm_mod, partial.resid = TRUE, se = TRUE)

# Load mgcv
library(mgcv)
## Loading required package: nlme
## 
## Attaching package: 'nlme'
## The following object is masked from 'package:forecast':
## 
##     getResponse
## The following object is masked from 'package:lme4':
## 
##     lmList
## The following object is masked from 'package:dplyr':
## 
##     collapse
## This is mgcv 1.8-24. For overview type 'help("mgcv-package")'.
# Fit the model
gam_mod <- gam(accel ~ s(times), data = mcycle)

# Plot the results
plot(gam_mod, residuals = TRUE, pch = 1)

# Extract the model coefficients
coef(gam_mod)
## (Intercept)  s(times).1  s(times).2  s(times).3  s(times).4  s(times).5 
##  -25.545865  -63.718008   43.475644 -110.350132  -22.181006   35.034423 
##  s(times).6  s(times).7  s(times).8  s(times).9 
##   93.176458   -9.283018 -111.661472   17.603782
# Fit a GAM with 3 basis functions
gam_mod_k3 <- gam(accel ~ s(times, k = 3), data = mcycle)

# Fit with 20 basis functions
gam_mod_k20 <- gam(accel ~ s(times, k = 20), data = mcycle)

# Visualize the GAMs
par(mfrow = c(1, 2))
plot(gam_mod_k3, residuals = TRUE, pch = 1)
plot(gam_mod_k20, residuals = TRUE, pch = 1)

par(mfrow = c(1, 1))


# Extract the smoothing parameter
gam_mod <- gam(accel ~ s(times), data = mcycle, method = "REML")
gam_mod$sp
##     s(times) 
## 0.0007758036
# Fix the smoothing paramter at 0.1
gam_mod_s1 <- gam(accel ~ s(times), data = mcycle, sp = 0.1)

# Fix the smoothing paramter at 0.0001
gam_mod_s2 <- gam(accel ~ s(times), data = mcycle, sp = 0.0001)

# Plot both models
par(mfrow = c(2, 1))
plot(gam_mod_s1, residuals = TRUE, pch = 1)
plot(gam_mod_s2, residuals = TRUE, pch = 1)

par(mfrow = c(1, 1))


# Fit the GAM
gam_mod_sk <- gam(accel ~ s(times, k=50), sp=0.0001, data=mcycle)

#Visualize the model
plot(gam_mod_sk, residuals = TRUE, pch = 1)

data(mpg, package="gamair")

# Examine the data
head(mpg)
##   symbol loss        make fuel aspir doors       style drive eng.loc   wb
## 1      3   NA alfa-romero  gas   std   two convertible   rwd   front 88.6
## 2      3   NA alfa-romero  gas   std   two convertible   rwd   front 88.6
## 3      1   NA alfa-romero  gas   std   two   hatchback   rwd   front 94.5
## 4      2  164        audi  gas   std  four       sedan   fwd   front 99.8
## 5      2  164        audi  gas   std  four       sedan   4wd   front 99.4
## 6      2   NA        audi  gas   std   two       sedan   fwd   front 99.8
##   length width height weight eng.type cylinders eng.cc fuel.sys bore
## 1  168.8  64.1   48.8   2548     dohc      four    130     mpfi 3.47
## 2  168.8  64.1   48.8   2548     dohc      four    130     mpfi 3.47
## 3  171.2  65.5   52.4   2823     ohcv       six    152     mpfi 2.68
## 4  176.6  66.2   54.3   2337      ohc      four    109     mpfi 3.19
## 5  176.6  66.4   54.3   2824      ohc      five    136     mpfi 3.19
## 6  177.3  66.3   53.1   2507      ohc      five    136     mpfi 3.19
##   stroke comp.ratio  hp  rpm city.mpg hw.mpg price
## 1   2.68        9.0 111 5000       21     27 13495
## 2   2.68        9.0 111 5000       21     27 16500
## 3   3.47        9.0 154 5000       19     26 16500
## 4   3.40       10.0 102 5500       24     30 13950
## 5   3.40        8.0 115 5500       18     22 17450
## 6   3.40        8.5 110 5500       19     25 15250
str(mpg)
## 'data.frame':    205 obs. of  26 variables:
##  $ symbol    : int  3 3 1 2 2 2 1 1 1 0 ...
##  $ loss      : int  NA NA NA 164 164 NA 158 NA 158 NA ...
##  $ make      : Factor w/ 22 levels "alfa-romero",..: 1 1 1 2 2 2 2 2 2 2 ...
##  $ fuel      : Factor w/ 2 levels "diesel","gas": 2 2 2 2 2 2 2 2 2 2 ...
##  $ aspir     : Factor w/ 2 levels "std","turbo": 1 1 1 1 1 1 1 1 2 2 ...
##  $ doors     : Factor w/ 2 levels "four","two": 2 2 2 1 1 2 1 1 1 2 ...
##  $ style     : Factor w/ 5 levels "convertible",..: 1 1 3 4 4 4 4 5 4 3 ...
##  $ drive     : Factor w/ 3 levels "4wd","fwd","rwd": 3 3 3 2 1 2 2 2 2 1 ...
##  $ eng.loc   : Factor w/ 2 levels "front","rear": 1 1 1 1 1 1 1 1 1 1 ...
##  $ wb        : num  88.6 88.6 94.5 99.8 99.4 ...
##  $ length    : num  169 169 171 177 177 ...
##  $ width     : num  64.1 64.1 65.5 66.2 66.4 66.3 71.4 71.4 71.4 67.9 ...
##  $ height    : num  48.8 48.8 52.4 54.3 54.3 53.1 55.7 55.7 55.9 52 ...
##  $ weight    : int  2548 2548 2823 2337 2824 2507 2844 2954 3086 3053 ...
##  $ eng.type  : Factor w/ 7 levels "dohc","dohcv",..: 1 1 6 4 4 4 4 4 4 4 ...
##  $ cylinders : Factor w/ 7 levels "eight","five",..: 3 3 4 3 2 2 2 2 2 2 ...
##  $ eng.cc    : int  130 130 152 109 136 136 136 136 131 131 ...
##  $ fuel.sys  : Factor w/ 8 levels "1bbl","2bbl",..: 6 6 6 6 6 6 6 6 6 6 ...
##  $ bore      : num  3.47 3.47 2.68 3.19 3.19 3.19 3.19 3.19 3.13 3.13 ...
##  $ stroke    : num  2.68 2.68 3.47 3.4 3.4 3.4 3.4 3.4 3.4 3.4 ...
##  $ comp.ratio: num  9 9 9 10 8 8.5 8.5 8.5 8.3 7 ...
##  $ hp        : int  111 111 154 102 115 110 110 110 140 160 ...
##  $ rpm       : int  5000 5000 5000 5500 5500 5500 5500 5500 5500 5500 ...
##  $ city.mpg  : int  21 21 19 24 18 19 19 19 17 16 ...
##  $ hw.mpg    : int  27 27 26 30 22 25 25 25 20 22 ...
##  $ price     : int  13495 16500 16500 13950 17450 15250 17710 18920 23875 NA ...
# Fit the model
mod_city <- gam(city.mpg ~ s(weight) + s(length) + s(price), data = mpg, method = "REML")

# Plot the model
plot(mod_city, pages = 1)

# Fit the model
mod_city2 <- gam(city.mpg ~ s(weight) + s(length) + s(price) + fuel + drive + style, data = mpg, method = "REML")

# Plot the model
plot(mod_city2, all.terms = TRUE, pages = 1)

# Fit the model
mod_city3 <- gam(city.mpg ~ s(weight, by=drive) + s(length, by=drive) + s(price, by=drive) + drive, 
                 data = mpg, method = "REML"
                 )

# Plot the model
plot(mod_city3, pages = 1)


Chapter 2 - Interpreting and Visualizing GAMs

Interpreting GAM Outputs:

  • Can get summaries of model output by way of the summary() function
    • mod_hwy <- gam(hw.mpg ~ s(weight) + s(rpm) + s(price) + s(comp.ratio) + s(width) + fuel + cylinders, data = mpg, method = “REML”)
    • summary(mod_hwy)
    • The first component of the summary shows the model family, link, and formula
    • The second component shows the parametric coefficients and significances
    • The third components shows the approximate significance of the smooths # edf of 1 is equivalent to a straight line, edf of 2 is equivalent to a parabola, etc.
    • Generally, a significant smooth can be thought of as one where a straight, horizontal line cannot be drawn through the 95% confidence interval

Visualizing GAMs:

  • Visualizations are a powerful way to inspect and communicate results
    • ?plot.gam
  • The mgcv plots are “partial effects” plots - the components that add up to the overall model
    • plot(gam_model, select = c(2, 3)) # default is that all smoothed terms are selected, can override with select
    • plot(gam_model, pages = 1) # default is as many pages as needed
    • plot(gam_model, pages = 1, all.terms = TRUE) # The all.terms will show the non-smoothed terms also
    • plot(gam_model, residuals = TRUE) # show the partial residuals
    • plot(gam_model, rug = TRUE) # show the rug on the x-axis
    • plot(gam_model, rug = TRUE, residuals = TRUE, pch = 1, cex = 1) # pch for shape and cex for size
    • plot(gam_model, shade = TRUE) # 95% CI is shaded rather than shown in dotted lines
    • plot(gam_model, shade = TRUE, shade.col = “lightblue”) # color of shading
    • plot(gam_model, seWithMean = TRUE)
    • plot(gam_model, seWithMean = TRUE, shift = coef(gam_model)[1]) # brings in the intercept, which is the first coefficient of the model

Model checking with gam.check():

  • There are many potential pitfalls to be checked
    • Inadequate basis number
  • There is an automated call to look at the model results
    • gam.check(mod)
    • Convergence - if it has not converged, it is likely wrong
    • The p-values for the residuals - should not be significant, though this is only an approximate test
    • Standard regression residuals plots

Checking concurvity:

  • There can be collinearity concerns with a linear model, which can result in poor models with large confidence intervals
  • The GAM can have a concurvity concern, where one variable is a smooth of another variable (such as x and x**2)
    • concurvity(m1, full = TRUE)
    • Generally, a concurvity worst case of 0.8+ is an area for concern
    • concurvity(m1, full = FALSE) # get the pairwise concurvities

Example code includes:

# Fit the model
mod_city4 <- gam(city.mpg ~ s(weight) + s(length) + s(price) + s(rpm) + s(width),
                 data = mpg, method = "REML")

# View the summary
summary(mod_city4)
## 
## Family: gaussian 
## Link function: identity 
## 
## Formula:
## city.mpg ~ s(weight) + s(length) + s(price) + s(rpm) + s(width)
## 
## Parametric coefficients:
##             Estimate Std. Error t value Pr(>|t|)    
## (Intercept)   25.201      0.188     134   <2e-16 ***
## ---
## Signif. codes:  0 '***' 0.001 '**' 0.01 '*' 0.05 '.' 0.1 ' ' 1
## 
## Approximate significance of smooth terms:
##             edf Ref.df      F  p-value    
## s(weight) 5.620  6.799 17.524  < 2e-16 ***
## s(length) 2.943  3.759  0.904    0.420    
## s(price)  1.000  1.000 16.647 6.68e-05 ***
## s(rpm)    7.751  8.499 16.486  < 2e-16 ***
## s(width)  1.003  1.005  0.006    0.939    
## ---
## Signif. codes:  0 '***' 0.001 '**' 0.01 '*' 0.05 '.' 0.1 ' ' 1
## 
## R-sq.(adj) =  0.831   Deviance explained = 84.7%
## -REML = 496.47  Scale est. = 7.0365    n = 199
# Fit the model
mod <- gam(accel ~ s(times), data = mcycle, method = "REML")

# Make the plot with residuals
plot(mod, residuals=TRUE)

# Change shape of residuals
plot(mod, residuals=TRUE, pch=1, cex=1)

# Fit the model
mod <- gam(hw.mpg ~ s(weight) + s(rpm) + s(price) + comp.ratio, 
           data = mpg, method = "REML")

# Plot the price effect
plot(mod, select=c(3))

# Plot all effects
plot(mod, all.terms=TRUE, pages=1)

# Plot the weight effect with colored shading
plot(mod, select = 1, shade=TRUE, shade.col="hotpink")

# Add the intercept value and uncertainty
plot(mod, select = 1, shade=TRUE, shade.col="hotpink", seWithMean=TRUE, shift=coef(mod)[1])

dat <- data.frame(y=c(11.17, 2.81, 12.9, 5.68, 5.58, -1.09, 5.42, 12.13, 4.73, 6.29, 5.74, 8.32, 9.76, 4.78, 9.08, 10.5, 9.4, 9.51, 14.58, 13.84, 4.01, 3.31, 5.32, 6.6, 10.54, 13.19, 10.06, 8.6, -0.62, 4.78, 5.98, 2.75, 1.36, 8.51, 8.12, 4.18, 10.65, 5.92, -0.03, 6.48, 9.12, 6.57, 15.38, 11.76, 7.47, 12, 3.4, 3.39, 0.95, 5.49, 7.92, 8.04, 8.81, 6.65, 8.93, 0.55, 6.73, 3.38, 4.42, 8.23, 12.2, 14.45, 2.82, 5.58, 8.74, 14.14, 5.74, 4.59, 14.54, 6.65, 4.21, 8.71, 1.76, 6.22, 8.87, 10.3, 9.18, 5.05, 5.44, 4.86, 3.25, 4.59, 12.01, 6.69, 6.3, 6.85, 5.45, 15.43, -0.9, 3.43, 9.83, 1.04, 1.16, 16.7, 9.16, 8.46, 7.81, 4.97, 7.46, 1.49, 8.01, 9.48, 9.43, 3.92, 6.2, 7.63, 8.56, 11.53, 9.98, 2.49, 5.67, 3.48, 7.92, 8.62, 7.44, 6.35, 10.88, 9.74, 3.79, 15.43, 6.56, 2.5, 6.66, 9.75, 12.72, 14.64, 8.9, 10.74, 5.93, 2.53, 3.69, 15.25, 0.5, 11.8, 13.19, 6.05, -1.26, 9.09, 9.78, 7.23, 11.67, 12.54, -0.36, 9.4, 7.87, 13.46, 9.33, 2.55, 9.23, 5.95, 10.46, 3.39, 3.81, 7.25, 3.94, 10.18, 8.63, 11.51, 2.42, 9.44, 5.95, 7.75, 10.16, 16.11, 5.16, 3.13, 7.75, 9.96, 7.27, 14.62, 3.88, 10.2, 5.86, 16.18, 5.4, 1.55, 2.91, 9.16, 9.77, 2.25, 5.01, 8.79, 3.34, 7.09, 8.18, 3.34, 8.02, 8.12, 6.69, 3.22, 8.15, 5.01, 11.51, 6.62, 7.07, 0.52, 10.26, 7.99, 8.98, 9.87), 
                  x0=c(0.9, 0.27, 0.37, 0.57, 0.91, 0.2, 0.9, 0.94, 0.66, 0.63, 0.06, 0.21, 0.18, 0.69, 0.38, 0.77, 0.5, 0.72, 0.99, 0.38, 0.78, 0.93, 0.21, 0.65, 0.13, 0.27, 0.39, 0.01, 0.38, 0.87, 0.34, 0.48, 0.6, 0.49, 0.19, 0.83, 0.67, 0.79, 0.11, 0.72, 0.41, 0.82, 0.65, 0.78, 0.55, 0.53, 0.79, 0.02, 0.48, 0.73, 0.69, 0.48, 0.86, 0.44, 0.24, 0.07, 0.1, 0.32, 0.52, 0.66, 0.41, 0.91, 0.29, 0.46, 0.33, 0.65, 0.26, 0.48, 0.77, 0.08, 0.88, 0.34, 0.84, 0.35, 0.33, 0.48, 0.89, 0.86, 0.39, 0.78, 0.96, 0.43, 0.71, 0.4, 0.33, 0.76, 0.2, 0.71, 0.12, 0.25, 0.14, 0.24, 0.06, 0.64, 0.88, 0.78, 0.8, 0.46, 0.41, 0.81, 0.6, 0.65, 0.35, 0.27, 0.99, 0.63, 0.21, 0.13, 0.48, 0.92, 0.6, 0.98, 0.73, 0.36, 0.43, 0.15, 0.01, 0.72, 0.1, 0.45, 0.64, 0.99, 0.5, 0.48, 0.17, 0.75, 0.45, 0.51, 0.21, 0.23, 0.6, 0.57, 0.08, 0.04, 0.64, 0.93, 0.6, 0.56, 0.53, 0.99, 0.51, 0.68, 0.6, 0.24, 0.26, 0.73, 0.45, 0.18, 0.75, 0.1, 0.86, 0.61, 0.56, 0.33, 0.45, 0.5, 0.18, 0.53, 0.08, 0.28, 0.21, 0.28, 0.9, 0.45, 0.78, 0.88, 0.41, 0.06, 0.34, 0.72, 0.34, 0.63, 0.84, 0.86, 0.39, 0.38, 0.9, 0.64, 0.74, 0.61, 0.9, 0.29, 0.19, 0.89, 0.5, 0.88, 0.19, 0.76, 0.72, 0.94, 0.55, 0.71, 0.39, 0.1, 0.93, 0.28, 0.59, 0.11, 0.84, 0.32),
                  x1=c(0.78, 0.27, 0.22, 0.52, 0.27, 0.18, 0.52, 0.56, 0.13, 0.26, 0.72, 0.96, 0.1, 0.76, 0.95, 0.82, 0.31, 0.65, 0.95, 0.95, 0.34, 0.26, 0.17, 0.32, 0.51, 0.92, 0.51, 0.31, 0.05, 0.42, 0.85, 0.35, 0.13, 0.37, 0.63, 0.39, 0.69, 0.69, 0.55, 0.43, 0.45, 0.31, 0.58, 0.91, 0.14, 0.42, 0.21, 0.43, 0.13, 0.46, 0.94, 0.76, 0.93, 0.47, 0.6, 0.48, 0.11, 0.25, 0.5, 0.37, 0.93, 0.52, 0.32, 0.28, 0.79, 0.7, 0.17, 0.06, 0.75, 0.62, 0.17, 0.06, 0.11, 0.38, 0.17, 0.3, 0.19, 0.26, 0.18, 0.48, 0.77, 0.03, 0.53, 0.88, 0.37, 0.05, 0.14, 0.32, 0.15, 0.13, 0.22, 0.23, 0.13, 0.98, 0.33, 0.51, 0.68, 0.1, 0.12, 0.05, 0.93, 0.67, 0.09, 0.49, 0.46, 0.38, 0.99, 0.18, 0.81, 0.07, 0.4, 0.14, 0.19, 0.84, 0.72, 0.27, 0.5, 0.08, 0.35, 0.97, 0.62, 0.66, 0.31, 0.41, 1, 0.86, 0.95, 0.81, 0.78, 0.27, 0.76, 0.99, 0.29, 0.4, 0.81, 0.08, 0.36, 0.44, 0.16, 0.58, 0.97, 0.99, 0.18, 0.54, 0.38, 0.68, 0.27, 0.47, 0.17, 0.37, 0.73, 0.49, 0.06, 0.78, 0.42, 0.98, 0.28, 0.85, 0.08, 0.89, 0.47, 0.11, 0.33, 0.84, 0.28, 0.59, 0.84, 0.07, 0.7, 0.7, 0.46, 0.44, 0.56, 0.93, 0.23, 0.22, 0.42, 0.33, 0.86, 0.18, 0.49, 0.43, 0.56, 0.66, 0.98, 0.23, 0.24, 0.8, 0.83, 0.11, 0.96, 0.15, 0.14, 0.93, 0.51, 0.15, 0.35, 0.66, 0.31, 0.35), 
                  x2=c(0.15, 0.66, 0.19, 0.95, 0.9, 0.94, 0.72, 0.37, 0.78, 0.01, 0.94, 0.99, 0.36, 0.75, 0.79, 0.71, 0.48, 0.49, 0.31, 0.7, 0.82, 0.43, 0.51, 0.66, 0.14, 0.34, 0.41, 0.09, 0.93, 0.84, 0.88, 0.94, 0.07, 0.38, 0.54, 0.11, 0.8, 0.74, 0.05, 0.48, 0.92, 0.04, 0.29, 0.5, 0.61, 0.26, 0.42, 0.37, 0.94, 0.12, 0.07, 0.96, 0.44, 0.37, 0.14, 0.05, 0.66, 0.58, 0.99, 0.6, 0.06, 0.16, 0.48, 0, 0.44, 0.26, 0.94, 0.72, 0.16, 0.48, 0.69, 0.46, 0.96, 0.71, 0.4, 0.12, 0.24, 0.86, 0.44, 0.5, 0.69, 0.76, 0.16, 0.85, 0.95, 0.59, 0.5, 0.19, 0, 0.88, 0.13, 0.02, 0.94, 0.29, 0.16, 0.4, 0.46, 0.43, 0.52, 0.85, 0.06, 0.55, 0.69, 0.66, 0.66, 0.47, 0.97, 0.4, 0.85, 0.76, 0.53, 0.87, 0.47, 0.01, 0.73, 0.72, 0.19, 0.65, 0.54, 0.34, 0.64, 0.83, 0.71, 0.35, 0.13, 0.39, 0.93, 0.8, 0.76, 0.96, 0.99, 0.61, 0.03, 0.34, 0.28, 0.12, 0.04, 0.37, 0.34, 0.17, 0.62, 0.4, 0.96, 0.65, 0.33, 0.2, 0.12, 1, 0.38, 0.56, 0.73, 0.87, 0.57, 0.01, 0.91, 0.77, 0.38, 0.09, 0.05, 0.82, 0.83, 0.65, 0.13, 0.34, 0.73, 0.91, 0.7, 0.24, 0.64, 0.28, 0.96, 0.16, 0.42, 0.25, 0.09, 0.83, 0.53, 0.67, 0.41, 0.84, 0.74, 0.35, 0.95, 0.65, 0.04, 0.6, 0.42, 0.08, 0.53, 0.96, 0.71, 0.55, 0.24, 0.78, 0.65, 0.83, 0.65, 0.48, 0.5, 0.38), 
                  x3=c(0.45, 0.81, 0.93, 0.15, 0.75, 0.98, 0.97, 0.35, 0.39, 0.95, 0.11, 0.93, 0.35, 0.53, 0.54, 0.71, 0.41, 0.15, 0.34, 0.63, 0.06, 0.85, 0.21, 0.77, 0.14, 0.32, 0.62, 0.26, 0.63, 0.49, 0.94, 0.86, 0.37, 0.31, 0.83, 0.45, 0.32, 0.1, 0.06, 0.69, 0.67, 0.9, 0.3, 0.93, 0.2, 0.79, 0.22, 0.03, 0.86, 0.69, 0.94, 0.68, 0.84, 0.36, 0.39, 0.57, 0.1, 0.19, 0.59, 0.75, 0.87, 0.37, 0.8, 0.06, 0.62, 0.36, 0.59, 0.91, 0.2, 0.37, 0.67, 0.77, 0.52, 0.83, 0.53, 0.5, 0.42, 0.36, 0.12, 0.3, 0.28, 0.79, 0.78, 0.14, 0.52, 0.6, 0.51, 0.39, 0.43, 0.01, 0.92, 0.08, 0.51, 0.82, 0.6, 0.42, 0.56, 0.79, 0.17, 0.97, 0.47, 0.93, 0.9, 0.75, 0.68, 0.65, 0.07, 0.42, 0.53, 0.94, 0.71, 0.72, 0.47, 0.12, 0.78, 0.44, 0.43, 0.03, 0.15, 0.42, 0.77, 0, 0.6, 0.91, 0.71, 0.26, 0.85, 0.33, 0.58, 0.43, 0.05, 0.73, 0.55, 0.75, 0.05, 0.71, 0.3, 0.28, 0.83, 0.09, 0.04, 0.35, 0.54, 0.61, 0.27, 0.21, 0.38, 0.47, 0.84, 0.12, 0.68, 0.5, 0.9, 0.55, 0.13, 0.44, 0.19, 0.43, 0.23, 0.96, 0.45, 0.78, 0.16, 0.87, 0.21, 0.18, 0.16, 0.57, 0.73, 0.88, 0.71, 0.48, 0.82, 0.02, 1, 0.63, 0.43, 0.03, 0.75, 0.21, 1, 0.91, 0.71, 0.73, 0.47, 0.86, 0.17, 0.62, 0.29, 0.46, 0.05, 0.18, 0.06, 0.94, 0.34, 0.52, 0.63, 0.24, 0.52, 0.81)
                  )
str(dat)
## 'data.frame':    200 obs. of  5 variables:
##  $ y : num  11.17 2.81 12.9 5.68 5.58 ...
##  $ x0: num  0.9 0.27 0.37 0.57 0.91 0.2 0.9 0.94 0.66 0.63 ...
##  $ x1: num  0.78 0.27 0.22 0.52 0.27 0.18 0.52 0.56 0.13 0.26 ...
##  $ x2: num  0.15 0.66 0.19 0.95 0.9 0.94 0.72 0.37 0.78 0.01 ...
##  $ x3: num  0.45 0.81 0.93 0.15 0.75 0.98 0.97 0.35 0.39 0.95 ...
# Fit the model
mod <- gam(y ~ s(x0, k = 5) + s(x1, k = 5) + s(x2, k = 5) + s(x3, k = 5),
           data = dat, method = "REML")

# Run the check function
gam.check(mod)

## 
## Method: REML   Optimizer: outer newton
## full convergence after 10 iterations.
## Gradient range [-0.0001426464,0.0001241444]
## (score 461.1064 & scale 5.242973).
## Hessian positive definite, eigenvalue range [0.0001426384,97.53228].
## Model rank =  17 / 17 
## 
## Basis dimension (k) checking results. Low p-value (k-index<1) may
## indicate that k is too low, especially if edf is close to k'.
## 
##         k'  edf k-index p-value    
## s(x0) 4.00 2.53    0.92    0.12    
## s(x1) 4.00 2.22    1.07    0.80    
## s(x2) 4.00 3.94    0.84  <2e-16 ***
## s(x3) 4.00 1.00    1.01    0.48    
## ---
## Signif. codes:  0 '***' 0.001 '**' 0.01 '*' 0.05 '.' 0.1 ' ' 1
# Fit the model
mod <- gam(y ~ s(x0, k = 3) + s(x1, k = 3) + s(x2, k = 3) + s(x3, k = 3),
           data = dat, method = "REML")

# Check the diagnostics
gam.check(mod)

## 
## Method: REML   Optimizer: outer newton
## full convergence after 10 iterations.
## Gradient range [-0.0002159481,0.0007368124]
## (score 493.6694 & scale 7.805066).
## Hessian positive definite, eigenvalue range [0.0002170151,97.50484].
## Model rank =  9 / 9 
## 
## Basis dimension (k) checking results. Low p-value (k-index<1) may
## indicate that k is too low, especially if edf is close to k'.
## 
##         k'  edf k-index p-value    
## s(x0) 2.00 1.85    0.97    0.30    
## s(x1) 2.00 1.71    1.06    0.75    
## s(x2) 2.00 1.97    0.57  <2e-16 ***
## s(x3) 2.00 1.00    1.09    0.85    
## ---
## Signif. codes:  0 '***' 0.001 '**' 0.01 '*' 0.05 '.' 0.1 ' ' 1
# Refit to fix issues
mod2 <- gam(y ~ s(x0, k = 3) + s(x1, k = 3) + s(x2, k = 12) + s(x3, k = 3),
           data = dat, method = "REML")

# Check the new model
gam.check(mod2)

## 
## Method: REML   Optimizer: outer newton
## full convergence after 9 iterations.
## Gradient range [-0.0001262011,0.0001907036]
## (score 452.0731 & scale 4.569005).
## Hessian positive definite, eigenvalue range [0.01536015,97.63581].
## Model rank =  18 / 18 
## 
## Basis dimension (k) checking results. Low p-value (k-index<1) may
## indicate that k is too low, especially if edf is close to k'.
## 
##          k'   edf k-index p-value
## s(x0)  2.00  1.93    0.91    0.10
## s(x1)  2.00  1.89    1.12    0.97
## s(x2) 11.00  8.07    0.97    0.29
## s(x3)  2.00  1.18    1.04    0.76
# Fit the model
mod <- gam(hw.mpg ~ s(length) + s(width) + s(height) + s(weight), 
           data = mpg, method = "REML")

# Check overall concurvity
concurvity(mod, full=TRUE)
##                  para s(length)  s(width) s(height) s(weight)
## worst    1.079374e-20 0.9303404 0.9322887 0.6723705 0.9603887
## observed 1.079374e-20 0.7534619 0.8757513 0.4869308 0.8793300
## estimate 1.079374e-20 0.8353324 0.7943374 0.4452676 0.8567519
# Check pairwise concurvity
concurvity(mod, full=FALSE)
## $worst
##                   para    s(length)     s(width)    s(height)    s(weight)
## para      1.000000e+00 4.799804e-26 5.458174e-21 4.926340e-23 3.221614e-25
## s(length) 4.759962e-26 1.000000e+00 8.336513e-01 6.058015e-01 8.797217e-01
## s(width)  5.458344e-21 8.336513e-01 1.000000e+00 4.099837e-01 8.953662e-01
## s(height) 4.927251e-23 6.058015e-01 4.099837e-01 1.000000e+00 3.665831e-01
## s(weight) 3.233688e-25 8.797217e-01 8.953662e-01 3.665831e-01 1.000000e+00
## 
## $observed
##                   para    s(length)     s(width)    s(height)    s(weight)
## para      1.000000e+00 1.128295e-29 4.467995e-32 9.887661e-34 6.730965e-31
## s(length) 4.759962e-26 1.000000e+00 7.511142e-01 2.827977e-01 8.232449e-01
## s(width)  5.458344e-21 5.077384e-01 1.000000e+00 1.186126e-01 7.813743e-01
## s(height) 4.927251e-23 2.284116e-01 3.313152e-01 1.000000e+00 2.900361e-01
## s(weight) 3.233688e-25 6.052819e-01 7.863555e-01 1.494913e-01 1.000000e+00
## 
## $estimate
##                   para    s(length)     s(width)    s(height)    s(weight)
## para      1.000000e+00 1.564968e-28 1.740649e-23 3.448567e-25 1.481483e-27
## s(length) 4.759962e-26 1.000000e+00 6.415191e-01 2.271285e-01 7.209033e-01
## s(width)  5.458344e-21 6.477497e-01 1.000000e+00 1.054762e-01 7.241891e-01
## s(height) 4.927251e-23 3.303484e-01 2.644827e-01 1.000000e+00 2.669300e-01
## s(weight) 3.233688e-25 7.235198e-01 6.913221e-01 1.390568e-01 1.000000e+00

Chapter 3 - Spatial GAMs and Interactions

Two-dimensional smooths and spatial data:

  • Can expand models to include smooths of multiple variables, including their interactions
    • y = s(x1, x2)
    • gam(y ~ s(x1, x2), data = dat, method = “REML”)
    • gam(y ~ s(x1, x2) + s(x3) + x4, data = dat, method = “REML”)
  • Will use the meuse dataset, which is about heavy metals in the soil near a river
    • ?sp::meuse

Plotting and interpreting GAM interactions:

  • Can see interactions using plot(mod_2d)
    • plot(mod_2d)
    • Creates a topographic map of predicted values
    • plot(mod_2d, scheme = 1) # will show the 3D perspective plot
    • plot(mod_2d, scheme = 2) # heat map
    • vis.gam(x, view = NULL, cond = list(), n.grid = 30, too.far = 0, col = NA, color = “heat”, contour.col = NULL, se = -1, type = “link”, plot.type = “persp”, zlim = NULL, nCol = 50, …) # customizes plots
  • Can run custom plots using the vis.gam() functions
    • vis.gam(x = mod, view = c(“x1”, “x2”), plot.type = “persp”) # scheme=1
    • vis.gam(x = mod, view = c(“x1”, “x2”), plot.type = “contour”) # scheme=2
    • vis.gam(mod, view = c(“x1”, “x2”), plot.type = “contour”, too.far = 0.1) # set a range for not making predictions due to distance from training data
    • vis.gam(x = mod, view = c(“x1”, “x2”), plot.type = “persp”, se = 2) # see confidence intervals for the plots
    • vis.gam(g, view = c(“x1”, “x2”), plot.type = “persp”, theta = 220) # horizontal rotation
    • vis.gam(g, view = c(“x1”, “x2”), plot.type = “persp”, phi = 55) # vertical rotation
    • vis.gam(g, view = c(“x1”, “x2”), plot.type = “persp”, r = 0.1) # zoom level (low r can lead to distortions or parallax)
  • Additional options are available for contour plots
    • vis.gam(g, view = c(“x1”, “x2”), plot.type = “contour”, color = “gray”)
    • vis.gam(g, view = c(“x1”, “x2”), plot.type = “contour”, contour.col = “blue”)
    • vis.gam(g, view = c(“x1”, “x2”), plot.type = “contour”, nlevels = 20)

Visualizing categorical-continuous interactions:

  • The categorical-continuous interaction was previously modeled using s(x1, by=“x2”)
  • Can instead use a factor smooth with argument bs=“fs” (best for controlling for categories that may have an impact but are not the primary categories of interest)
    • model4c <- gam(hw.mpg ~ s(weight, fuel, bs = “fs”) + fuel, data = mpg, method = “REML”)
    • plot(model4c)
    • vis.gam(model4c, theta = 125, plot.type = “persp”)

Interactions with different scales: Tensors:

  • Tensor smooths allow for interactions on different scales, such as space and time
  • Within the meuse data, horizontal and vertical dstances may have very different wiggliness (incomparable impacts)
  • A tensor has two smoothing parameters, one for each of it variables
    • gam(y ~ te(x1, x2), data = data, method = “REML”)
    • gam(y ~ te(x1, x2, k = c(10, 20)), data = data, method = “REML”)
  • Tensor smooths can also help to tease out interactions and independent effects
    • gam(y ~ te(x1) + te(x2) + ti(x1, x2), data = data, method = “REML”)
    • gam(y ~ s(x1) + s(x2) + ti(x1, x2), data = data, method = “REML”)

Example code includes:

# Inspect the data
data(meuse, package="sp")
head(meuse)
##        x      y cadmium copper lead zinc  elev       dist   om ffreq soil
## 1 181072 333611    11.7     85  299 1022 7.909 0.00135803 13.6     1    1
## 2 181025 333558     8.6     81  277 1141 6.983 0.01222430 14.0     1    1
## 3 181165 333537     6.5     68  199  640 7.800 0.10302900 13.0     1    1
## 4 181298 333484     2.6     81  116  257 7.655 0.19009400  8.0     1    2
## 5 181307 333330     2.8     48  117  269 7.480 0.27709000  8.7     1    2
## 6 181390 333260     3.0     61  137  281 7.791 0.36406700  7.8     1    2
##   lime landuse dist.m
## 1    1      Ah     50
## 2    1      Ah     30
## 3    1      Ah    150
## 4    0      Ga    270
## 5    0      Ah    380
## 6    0      Ga    470
str(meuse)
## 'data.frame':    155 obs. of  14 variables:
##  $ x      : num  181072 181025 181165 181298 181307 ...
##  $ y      : num  333611 333558 333537 333484 333330 ...
##  $ cadmium: num  11.7 8.6 6.5 2.6 2.8 3 3.2 2.8 2.4 1.6 ...
##  $ copper : num  85 81 68 81 48 61 31 29 37 24 ...
##  $ lead   : num  299 277 199 116 117 137 132 150 133 80 ...
##  $ zinc   : num  1022 1141 640 257 269 ...
##  $ elev   : num  7.91 6.98 7.8 7.66 7.48 ...
##  $ dist   : num  0.00136 0.01222 0.10303 0.19009 0.27709 ...
##  $ om     : num  13.6 14 13 8 8.7 7.8 9.2 9.5 10.6 6.3 ...
##  $ ffreq  : Factor w/ 3 levels "1","2","3": 1 1 1 1 1 1 1 1 1 1 ...
##  $ soil   : Factor w/ 3 levels "1","2","3": 1 1 1 2 2 2 2 1 1 2 ...
##  $ lime   : Factor w/ 2 levels "0","1": 2 2 2 1 1 1 1 1 1 1 ...
##  $ landuse: Factor w/ 15 levels "Aa","Ab","Ag",..: 4 4 4 11 4 11 4 2 2 15 ...
##  $ dist.m : num  50 30 150 270 380 470 240 120 240 420 ...
# Fit the 2-D model
mod2d <- gam(cadmium ~ s(x, y), data=meuse, method="REML")

# Inspect the model
summary(mod2d)
## 
## Family: gaussian 
## Link function: identity 
## 
## Formula:
## cadmium ~ s(x, y)
## 
## Parametric coefficients:
##             Estimate Std. Error t value Pr(>|t|)    
## (Intercept)   3.2458     0.1774    18.3   <2e-16 ***
## ---
## Signif. codes:  0 '***' 0.001 '**' 0.01 '*' 0.05 '.' 0.1 ' ' 1
## 
## Approximate significance of smooth terms:
##          edf Ref.df     F p-value    
## s(x,y) 23.48  27.24 8.667  <2e-16 ***
## ---
## Signif. codes:  0 '***' 0.001 '**' 0.01 '*' 0.05 '.' 0.1 ' ' 1
## 
## R-sq.(adj) =  0.607   Deviance explained = 66.7%
## -REML = 372.07  Scale est. = 4.8757    n = 155
coef(mod2d)
## (Intercept)    s(x,y).1    s(x,y).2    s(x,y).3    s(x,y).4    s(x,y).5 
##   3.2458065   0.8686658 -10.2154908   6.4161781  -2.6784725   9.1807111 
##    s(x,y).6    s(x,y).7    s(x,y).8    s(x,y).9   s(x,y).10   s(x,y).11 
##   3.7004932 -10.4780937  -8.9821840  -0.6218677  -4.6789789  -5.4267313 
##   s(x,y).12   s(x,y).13   s(x,y).14   s(x,y).15   s(x,y).16   s(x,y).17 
##   7.4996452   8.1962843  -7.6311640   4.5829340  -0.9734724   0.7634059 
##   s(x,y).18   s(x,y).19   s(x,y).20   s(x,y).21   s(x,y).22   s(x,y).23 
##   8.8112827  -4.8639552  -6.8085148   3.8059356   6.3499868   6.4701169 
##   s(x,y).24   s(x,y).25   s(x,y).26   s(x,y).27   s(x,y).28   s(x,y).29 
##  -8.1556061   7.2050985   0.1567317 -53.4384704  -4.2860149   5.5212533
# Models of this form (s(x,y) + s(v1) + ...) are a great way to model spatial data because they incorporate spatial relationships as well as independent predictors

# Fit the model
mod2da <- gam(cadmium ~ s(x, y) +s(elev) + s(dist), 
              data = meuse, method = "REML")

# Inspect the model
summary(mod2da)
## 
## Family: gaussian 
## Link function: identity 
## 
## Formula:
## cadmium ~ s(x, y) + s(elev) + s(dist)
## 
## Parametric coefficients:
##             Estimate Std. Error t value Pr(>|t|)    
## (Intercept)   3.2458     0.1238   26.21   <2e-16 ***
## ---
## Signif. codes:  0 '***' 0.001 '**' 0.01 '*' 0.05 '.' 0.1 ' ' 1
## 
## Approximate significance of smooth terms:
##            edf Ref.df      F  p-value    
## s(x,y)  20.398 24.599  2.324  0.00078 ***
## s(elev)  1.282  1.496 28.868 6.52e-08 ***
## s(dist)  6.609  7.698 13.677 5.25e-15 ***
## ---
## Signif. codes:  0 '***' 0.001 '**' 0.01 '*' 0.05 '.' 0.1 ' ' 1
## 
## R-sq.(adj) =  0.809   Deviance explained = 84.4%
## -REML = 321.06  Scale est. = 2.3762    n = 155
# Contour plot
plot(mod2da, pages = 1)

# 3D surface plot
plot(mod2da, scheme=1, pages = 1)

# Colored heat map
plot(mod2da, scheme=2, pages=1)

# Make the perspective plot with error surfaces
vis.gam(mod2d, view = c("x", "y"), plot.type="persp", se=2)

# Rotate the same plot
vis.gam(mod2d, view = c("x", "y"), plot.type="persp", se=2, theta=135)

# Make plot with 5% extrapolation
vis.gam(mod2d, view = c("x", "y"), plot.type = "contour", too.far=0.05)

# Overlay data
points(meuse)

# Make plot with 10% extrapolation
vis.gam(mod2d, view = c("x", "y"), plot.type="contour", too.far=0.1)

# Overlay data
points(meuse)

# Make plot with 25% extrapolation
vis.gam(mod2d, view = c("x", "y"), 
        plot.type = "contour", too.far = 0.25)

# Overlay data
points(meuse)

# Fit a model with separate smooths for each land-use level
mod_sep <- gam(copper ~ s(dist, by = landuse), data = meuse, method = "REML")

# Examine the summary
summary(mod_sep)
## 
## Family: gaussian 
## Link function: identity 
## 
## Formula:
## copper ~ s(dist, by = landuse)
## 
## Parametric coefficients:
##             Estimate Std. Error t value Pr(>|t|)    
## (Intercept)   36.726      1.371   26.78   <2e-16 ***
## ---
## Signif. codes:  0 '***' 0.001 '**' 0.01 '*' 0.05 '.' 0.1 ' ' 1
## 
## Approximate significance of smooth terms:
##                      edf Ref.df      F  p-value    
## s(dist):landuseAa  1.371  1.605  0.493  0.43082    
## s(dist):landuseAb  1.000  1.000  1.674  0.19792    
## s(dist):landuseAg  1.514  1.815  0.940  0.28255    
## s(dist):landuseAh  2.496  3.081  8.783 1.96e-05 ***
## s(dist):landuseAm  1.000  1.000  8.606  0.00395 ** 
## s(dist):landuseB   1.000  1.000  1.207  0.27401    
## s(dist):landuseBw  1.000  1.000  0.007  0.93520    
## s(dist):landuseDEN 1.000  1.000  0.230  0.63255    
## s(dist):landuseFh  1.000  1.000  0.698  0.40494    
## s(dist):landuseFw  2.754  3.377  5.289  0.00120 ** 
## s(dist):landuseGa  2.791  2.958  3.720  0.01092 *  
## s(dist):landuseSPO 1.000  1.000  1.101  0.29599    
## s(dist):landuseSTA 1.245  1.430  0.179  0.65089    
## s(dist):landuseTv  1.000  1.000  0.698  0.40495    
## s(dist):landuseW   4.333  5.289 37.857  < 2e-16 ***
## ---
## Signif. codes:  0 '***' 0.001 '**' 0.01 '*' 0.05 '.' 0.1 ' ' 1
## 
## R-sq.(adj) =  0.642   Deviance explained = 69.9%
## -REML = 580.91  Scale est. = 195.07    n = 154
# Fit a model with a factor-smooth interaction
mod_fs <- gam(copper ~ s(dist, landuse, bs="fs"), data = meuse, method = "REML")

# Examine the summary
summary(mod_fs)
## 
## Family: gaussian 
## Link function: identity 
## 
## Formula:
## copper ~ s(dist, landuse, bs = "fs")
## 
## Parametric coefficients:
##             Estimate Std. Error t value Pr(>|t|)    
## (Intercept)    30.07       3.33   9.031 1.43e-15 ***
## ---
## Signif. codes:  0 '***' 0.001 '**' 0.01 '*' 0.05 '.' 0.1 ' ' 1
## 
## Approximate significance of smooth terms:
##                   edf Ref.df     F p-value    
## s(dist,landuse) 16.37     71 2.463  <2e-16 ***
## ---
## Signif. codes:  0 '***' 0.001 '**' 0.01 '*' 0.05 '.' 0.1 ' ' 1
## 
## R-sq.(adj) =  0.533   Deviance explained = 58.3%
## -REML = 659.94  Scale est. = 254.2     n = 154
# Plot both the models with plot()
plot(mod_sep, pages=1)

plot(mod_fs, pages=1)

# Plot both the models with vis.gam()
vis.gam(mod_sep, view = c("dist", "landuse"), plot.type = "persp")

vis.gam(mod_fs, view = c("dist", "landuse"), plot.type = "persp")

# Fit the model
tensor_mod <- gam(cadmium ~ te(x, y, elev), data=meuse, method="REML")

# Summarize and plot
summary(tensor_mod)
## 
## Family: gaussian 
## Link function: identity 
## 
## Formula:
## cadmium ~ te(x, y, elev)
## 
## Parametric coefficients:
##             Estimate Std. Error t value Pr(>|t|)    
## (Intercept)   3.2458     0.1329   24.43   <2e-16 ***
## ---
## Signif. codes:  0 '***' 0.001 '**' 0.01 '*' 0.05 '.' 0.1 ' ' 1
## 
## Approximate significance of smooth terms:
##                edf Ref.df     F p-value    
## te(x,y,elev) 38.29  45.86 11.87  <2e-16 ***
## ---
## Signif. codes:  0 '***' 0.001 '**' 0.01 '*' 0.05 '.' 0.1 ' ' 1
## 
## R-sq.(adj) =   0.78   Deviance explained = 83.4%
## -REML = 318.09  Scale est. = 2.7358    n = 155
plot(tensor_mod)

# Fit the model
tensor_mod2 <- gam(cadmium ~ ti(x, y) + te(elev) + ti(x, y, elev), data=meuse, method="REML")

# Summarize and plot
summary(tensor_mod2)
## 
## Family: gaussian 
## Link function: identity 
## 
## Formula:
## cadmium ~ ti(x, y) + te(elev) + ti(x, y, elev)
## 
## Parametric coefficients:
##             Estimate Std. Error t value Pr(>|t|)    
## (Intercept)   3.5102     0.4311   8.143 3.61e-13 ***
## ---
## Signif. codes:  0 '***' 0.001 '**' 0.01 '*' 0.05 '.' 0.1 ' ' 1
## 
## Approximate significance of smooth terms:
##                edf Ref.df      F  p-value    
## ti(x,y)      10.80 12.132  6.026 7.40e-09 ***
## te(elev)      2.79  3.099 11.317 1.14e-06 ***
## ti(x,y,elev) 17.20 22.376  2.759  0.00017 ***
## ---
## Signif. codes:  0 '***' 0.001 '**' 0.01 '*' 0.05 '.' 0.1 ' ' 1
## 
## R-sq.(adj) =  0.714   Deviance explained = 77.1%
## -REML = 349.54  Scale est. = 3.5476    n = 155
plot(tensor_mod2, pages = 1)

par(mfrow=c(1, 1))

Chapter 4 - Logistic GAM for Classification

Types of model outcome:

  • Can also use GAM for making classifications (binary regression)
    • GAM output is converted to probability using the logistic function - log-odds - plogis()
    • The logit function converts probabilities to log-odds - qlogis()
    • gam(y ~ x1 + s(x2), data = dat, family = binomial, # Add for binary outcomes method = “REML”)
  • The csale dataset has anonymized insurance data

Visualizing logistic GAMs:

  • Can plot the log-odds
    • plot(binom_mod) # on the log-odds scale
    • plot(binom_mod, pages = 1, trans = plogis) # convert to probability scale
    • plot(binom_mod, pages = 1, trans = plogis, shift = coef(binom_mod)[1]) # add the intercept
    • plot(binom_mod, pages = 1, trans = plogis, shift = coef(binom_mod)[1], seWithMean = TRUE) # adds intercept uncertainty to smooth uncertainty
    • plot(binom_mod, pages = 1, trans = plogis, shift = coef(binom_mod)[1], seWithMean = TRUE, rug = FALSE, shade = TRUE, shade.col = “lightgreen”, col = “purple”)

Making predictions:

  • Can use the fitted models for making predictions
    • predict(log_mod2) # vector of predictions for the model data; returned on the link scale by default (log-odds for logistic)
    • predict(log_mod2, type=“response”) # return on the probability scale
    • predict(log_mod2, type = “link”, se.fit = TRUE) # first element of the list is the predictions and second element is approx. SE
  • For standard errors, use the link (log-odds) scale, then convert to the probability scales
  • Can also make predictions based on new data
    • test_predictions <- predict(trained_model, type = “response”, newdata = test_df)
    • predict(log_mod2, type = “terms”) # will show a column for the impact of each of the smooths (sum across columns plus intercept would be prediction)
    • plogis( sum(predict(log_mod2, type = “terms”)[1, ]) + coef(log_mod2)[1] )

Wrap up and next steps:

  • Basic theory of smooths for GAMs
  • Interpreting GAMs and plotting partial effects
  • Building and visualizing GAMs with interactions
  • Logistic GAMs for binary classification and predictions
  • Can extend to using the Tidyverse tools - broom, caret, etc.
  • Can further extend the smooths - see the help files in mgcv

Example code includes:

csale <- readRDS("./RInputFiles/csale.rds")

# Examine the csale data frame
head(csale)
## # A tibble: 6 x 8
##   purchase n_acts bal_crdt_ratio avg_prem_balance retail_crdt_rat~
##      <dbl>  <dbl>          <dbl>            <dbl>            <dbl>
## 1        0     11            0              2494.              0  
## 2        0      0           36.1            2494.             11.5
## 3        0      6           17.6            2494.              0  
## 4        0      8           12.5            2494.              0.8
## 5        0      8           59.1            2494.             20.8
## 6        0      1           90.1            2494.             11.5
## # ... with 3 more variables: avg_fin_balance <dbl>, mortgage_age <dbl>,
## #   cred_limit <dbl>
str(csale)
## Classes 'tbl_df', 'tbl' and 'data.frame':    1779 obs. of  8 variables:
##  $ purchase         : num  0 0 0 0 0 0 0 0 1 0 ...
##  $ n_acts           : num  11 0 6 8 8 1 5 0 9 18 ...
##  $ bal_crdt_ratio   : num  0 36.1 17.6 12.5 59.1 ...
##  $ avg_prem_balance : num  2494 2494 2494 2494 2494 ...
##  $ retail_crdt_ratio: num  0 11.5 0 0.8 20.8 ...
##  $ avg_fin_balance  : num  1767 1767 0 1021 797 ...
##  $ mortgage_age     : num  182 139 139 139 93 ...
##  $ cred_limit       : num  12500 0 0 0 0 0 0 0 11500 16000 ...
# Fit a logistic model
log_mod <- gam(purchase ~ s(mortgage_age), data = csale, family=binomial, method = "REML")

# Fit a logistic model
log_mod2 <- gam(purchase ~ s(n_acts) + s(bal_crdt_ratio) + s(avg_prem_balance) + 
    s(retail_crdt_ratio) + s(avg_fin_balance) + s(mortgage_age) + 
    s(cred_limit), data = csale, family = binomial, method = "REML")

# View the summary
summary(log_mod2)
## 
## Family: binomial 
## Link function: logit 
## 
## Formula:
## purchase ~ s(n_acts) + s(bal_crdt_ratio) + s(avg_prem_balance) + 
##     s(retail_crdt_ratio) + s(avg_fin_balance) + s(mortgage_age) + 
##     s(cred_limit)
## 
## Parametric coefficients:
##             Estimate Std. Error z value Pr(>|z|)    
## (Intercept) -1.64060    0.07557  -21.71   <2e-16 ***
## ---
## Signif. codes:  0 '***' 0.001 '**' 0.01 '*' 0.05 '.' 0.1 ' ' 1
## 
## Approximate significance of smooth terms:
##                        edf Ref.df Chi.sq  p-value    
## s(n_acts)            3.474  4.310 93.670  < 2e-16 ***
## s(bal_crdt_ratio)    4.308  5.257 18.386  0.00318 ** 
## s(avg_prem_balance)  2.275  2.816  7.800  0.04958 *  
## s(retail_crdt_ratio) 1.001  1.001  1.422  0.23343    
## s(avg_fin_balance)   1.850  2.202  2.506  0.27895    
## s(mortgage_age)      4.669  5.710  9.656  0.13401    
## s(cred_limit)        1.001  1.002 23.066 1.58e-06 ***
## ---
## Signif. codes:  0 '***' 0.001 '**' 0.01 '*' 0.05 '.' 0.1 ' ' 1
## 
## R-sq.(adj) =  0.184   Deviance explained = 18.4%
## -REML = 781.37  Scale est. = 1         n = 1779
# Plot on the log-odds scale
plot(log_mod2, pages=1)

# Plot on the probability scale
plot(log_mod2, pages = 1, trans = plogis)

# Plot with the intercept
plot(log_mod2, pages = 1, trans = plogis, shift = coef(log_mod2)[1])

# Plot with intercept uncertainty
plot(log_mod2, pages = 1, trans = plogis, shift = coef(log_mod2)[1], seWithMean = TRUE)

new_credit_data <- data.frame(matrix(data=c(1, 0, 0, 0, 0, 0, 0, 2, 19, 0, 0, 1, 6, 3, 0.3, 4.2, 36.095, 36.095, 25.7, 45.6, 10.8, 61, 967, 2494.414, 2494.414, 2494.414, 195, 2494.414, 11.491, 0, 11.491, 11.491, 11.491, 0, 11.491, 1767.197, 249, 1767.197, 1767.197, 1767.197, 0, 1767.197, 155, 65, 138.96, 138.96, 138.96, 13, 138.96, 0, 10000, 0, 0, 0, 13800, 0), ncol=8, nrow=7, byrow=FALSE))
names(new_credit_data) <- c('purchase', 'n_acts', 'bal_crdt_ratio', 'avg_prem_balance', 'retail_crdt_ratio', 'avg_fin_balance', 'mortgage_age', 'cred_limit')
new_credit_data
##   purchase n_acts bal_crdt_ratio avg_prem_balance retail_crdt_ratio
## 1        1      2          0.300           61.000            11.491
## 2        0     19          4.200          967.000             0.000
## 3        0      0         36.095         2494.414            11.491
## 4        0      0         36.095         2494.414            11.491
## 5        0      1         25.700         2494.414            11.491
## 6        0      6         45.600          195.000             0.000
## 7        0      3         10.800         2494.414            11.491
##   avg_fin_balance mortgage_age cred_limit
## 1        1767.197       155.00          0
## 2         249.000        65.00      10000
## 3        1767.197       138.96          0
## 4        1767.197       138.96          0
## 5        1767.197       138.96          0
## 6           0.000        13.00      13800
## 7        1767.197       138.96          0
# Calculate predictions and errors
predictions <- predict(log_mod2, newdata = new_credit_data, 
                       type = "link", se.fit = TRUE)

# Calculate high and low predictions intervals
high_pred <- predictions$fit + 2*predictions$se.fit
low_pred <- predictions$fit - 2*predictions$se.fit

# Convert intervals to probability scale
high_prob <- 1 / (1/exp(high_pred) + 1)
low_prob <- 1 / (1/exp(low_pred) + 1)

# Inspect
high_prob
##          1          2          3          4          5          6 
## 0.29534339 0.80264652 0.07015439 0.07015439 0.12907886 0.37928666 
##          7 
## 0.27248599
low_prob
##          1          2          3          4          5          6 
## 0.15023805 0.53570264 0.03758807 0.03758807 0.06804119 0.11279970 
##          7 
## 0.15491807
# Predict from the model
prediction_1 <- predict(log_mod2, newdata = new_credit_data[1, ,drop=FALSE], type = "terms")

# Inspect
prediction_1
##    s(n_acts) s(bal_crdt_ratio) s(avg_prem_balance) s(retail_crdt_ratio)
## 1 -0.3626621         0.3352521            0.369506         -0.007531015
##   s(avg_fin_balance) s(mortgage_age) s(cred_limit)
## 1        -0.04057248      -0.1774484     0.2229033
## attr(,"constant")
## (Intercept) 
##   -1.640601

Machine Learning in the Tidyverse

Chapter 1 - Foundations of Tidy Machine Learning

Introduction:

  • Tidyverse tools center around the tibble, which includes a “list” column that can store complex objects
  • There is also a list-column workflow of nest() - map() - unnest()
  • Course will use a more granular form of the gapminder dataset - 77 countries x 52 years x 6 features per observation
  • The nest makes each portion of the data in to a row of a new tibble
    • nested <- gapminder %>% group_by(country) %>% nest() # new column data is created; will contain the relevant data
    • nested$data[[4]] # will show the Austria data
    • nested %>% unnest(data) # will convert back to a normal tibble, using column data

Map family of functions:

  • The map family of functions help to fulfill the second and third elements of the workflows
  • The map functions are all of the form map_(.x=, .f=)
    • .x is the vector or list
    • .f is the function
    • output will be a list
    • .f = ~mean(.x) and .f=mean will do the same thing
  • Can use the map functions on a nested file
    • map(.x = nested\(data, .f = ~mean(.x\)population))
    • pop_df <- nested %>% mutate(pop_mean = map(data, ~mean(.x$population)))
    • pop_df %>% unnest(pop_mean) # gets back the numbers rather than a column of lists
  • Can also use a map function that specifies a requested vector return of a specific type or a list of models such as an lm
    • nested %>% mutate(pop_mean = map_dbl(data, ~mean(.x$population))) # return will be a vector of doubles rather than a list
    • nested %>% mutate(model = map(data, ~lm(formula = population~fertility, data = .x)))

Tidy models with broom:

  • Several packages can help with the analysis of the list columns - broom, yardstick, rsample, etc.
  • The core of the broom is to extract relevant data from models
    • tidy - statistical fundings such as coefficients
    • glance - concise one-row summary
    • augment - adds prediction columns to the data being modeled
  • Example of using tidy to extract data from the lm() used previously in the chapter
    • tidy(algeria_model)
    • glance(algeria_model)
    • augment(algeria_model)
  • Plotting the augmented data can give a sense for model fits - predictions vs. actuals
    • augment(algeria_model) %>% ggplot(mapping = aes(x = year)) + geom_point(mapping = aes(y = life_expectancy)) + geom_line(mapping = aes(y = .fitted), color = “red”)

Example code includes:

# Explore gapminder
data(gapminder, package="gapminder")
head(gapminder)

# Prepare the nested dataframe gap_nested
gap_nested <- gapminder %>% 
  group_by(country) %>% 
  nest()

# Explore gap_nested
head(gap_nested)


# Create the unnested dataframe called gap_unnnested
gap_unnested <- gap_nested %>% 
  unnest()
  
# Confirm that your data was not modified  
identical(gapminder, gap_unnested)


# Extract the data of Algeria
algeria_df <- gap_nested$data[[which(gap_nested$country=="Algeria")]]

# Calculate the minimum of the population vector
min(algeria_df$pop)

# Calculate the maximum of the population vector
max(algeria_df$pop)

# Calculate the mean of the population vector
mean(algeria_df$pop)


# Calculate the mean population for each country
pop_nested <- gap_nested %>%
  mutate(mean_pop = map(.x=data, .f=~mean(.x$pop)))

# Take a look at pop_nested
head(pop_nested)

# Extract the mean_pop value by using unnest
pop_mean <- pop_nested %>% 
  unnest(mean_pop)

# Take a look at pop_mean
head(pop_mean)


# Calculate mean population and store result as a double
pop_mean <- gap_nested %>%
  mutate(mean_pop = map_dbl(.x=data, ~mean(.x$pop)))

# Take a look at pop_mean
head(pop_mean)


# Build a linear model for each country
gap_models <- gap_nested %>%
    mutate(model = map(.x=data, .f=~lm(formula = lifeExp ~ year, data = .x)))
    
# Extract the model for Algeria    
algeria_model <- gap_models$model[[which(gap_models$country=="Algeria")]]

# View the summary for the Algeria model
summary(algeria_model)


# Extract the coefficients of the algeria_model as a dataframe
broom::tidy(algeria_model)

# Extract the statistics of the algeria_model as a dataframe
broom::glance(algeria_model)


# Build the augmented dataframe
algeria_fitted <- broom::augment(algeria_model)

# Compare the predicted values with the actual values of life expectancy
algeria_fitted %>% 
  ggplot(aes(x = year)) +
  geom_point(aes(y = lifeExp)) + 
  geom_line(aes(y = .fitted), color = "red")

Chapter 2 - Multiple Models with broom

Exploring coefficients across models:

  • The gapminder models contains data about all of the 77 countries
    • gap_nested <- gapminder %>% group_by(country) %>% nest()
    • gap_models <- gap_nested %>% mutate(model = map(data, lm(life_expectancyyear, data = .x)))
  • Can extract regression coefficients to better understand trends in the gapminder data
    • gap_models %>% mutate(coef = map(model, ~tidy(.x))) %>% unnest(coef)

Evaluating fit of many models:

  • Can also look at the R-squared across many models
    • gap_models %>% mutate(fit = map(model, ~glance(.x))) %>% unnest(fit)

Visually inspect the fit of many models:

  • Can compare predicted and actual observations from the gapminder dataset
    • augmented_models <- gap_models %>% mutate(augmented = map(model,~augment(.x))) %>% unnest(augmented)
    • augmented_model %>% filter(country == “Italy”) %>% ggplot(aes(x = year, y = life_expectancy)) + geom_point() + geom_line(aes(y = .fitted), color = “red”)

Improve the fit of your models:

  • Can instead use multiple linear regressions and again explore the goodness of fits
    • gap_fullmodels <- gap_nested %>% mutate(model = map(data, ~lm(formula = life_expectancy ~ ., data = .x)))
    • tidy(gap_fullmodels$model[[1]])
    • augment(gap_fullmodels$model[[1]])
    • glance(gap_fullmodels$model[[1]])

Example code includes:

# Extract the coefficient statistics of each model into nested dataframes
model_coef_nested <- gap_models %>% 
    mutate(coef = map(.x=model, .f=~broom::tidy(.x)))
    
# Simplify the coef dataframes for each model    
model_coef <- model_coef_nested %>%
    unnest(coef)

# Plot a histogram of the coefficient estimates for year         
model_coef %>% 
  filter(term=="year") %>% 
  ggplot(aes(x = estimate)) +
  geom_histogram()


# Extract the fit statistics of each model into dataframes
model_perf_nested <- gap_models %>% 
    mutate(fit = map(.x=model, .f=~broom::glance(.x)))

# Simplify the fit dataframes for each model    
model_perf <- model_perf_nested %>% 
    unnest(fit)
    
# Look at the first six rows of model_perf
head(model_perf)


# Plot a histogram of rsquared for the 77 models    
model_perf %>% 
  ggplot(aes(x=r.squared)) + 
  geom_histogram() 
  
# Extract the 4 best fitting models
best_fit <- model_perf %>% 
  top_n(n = 4, wt = r.squared)

# Extract the 4 models with the worst fit
worst_fit <- model_perf %>% 
  top_n(n = 4, wt = -r.squared)


best_augmented <- best_fit %>% 
  # Build the augmented dataframe for each country model
  mutate(augmented = map(.x=model, .f=~broom::augment(.x))) %>% 
  # Expand the augmented dataframes
  unnest(augmented)

worst_augmented <- worst_fit %>% 
  # Build the augmented dataframe for each country model
  mutate(augmented = map(.x=model, .f=~broom::augment(.x))) %>% 
  # Expand the augmented dataframes
  unnest(augmented)


# Compare the predicted values with the actual values of life expectancy 
# for the top 4 best fitting models
best_augmented %>% 
  ggplot(aes(x=year)) +
  geom_point(aes(y=lifeExp)) + 
  geom_line(aes(y=.fitted), color = "red") +
  facet_wrap(~country, scales = "free_y")

# Compare the predicted values with the actual values of life expectancy 
# for the top 4 worst fitting models
worst_augmented %>% 
  ggplot(aes(x=year)) +
  geom_point(aes(y=lifeExp)) + 
  geom_line(aes(y=.fitted), color = "red") +
  facet_wrap(~country, scales = "free_y")


# Build a linear model for each country using all features
gap_fullmodel <- gap_nested %>% 
  mutate(model = map(data, ~lm(formula = lifeExp ~ year + pop + gdpPercap, data = .x)))

fullmodel_perf <- gap_fullmodel %>% 
  # Extract the fit statistics of each model into dataframes
  mutate(fit = map(model, ~broom::glance(.x))) %>% 
  # Simplify the fit dataframes for each model
  unnest(fit)
  
# View the performance for the four countries with the worst fitting 
# four simple models you looked at before
fullmodel_perf %>% 
  filter(country %in% worst_fit$country) %>% 
  select(country, adj.r.squared)

Chapter 3 - Build, Tune, and Evaluate Regression Models

Training, test, and validation splits:

  • Questions of how well the data would perform on new (unseen) data
  • The train-test split can be helpful for assessing out-of-sample performance - rsample has a function for this, with prop= being the proportion in the test data
    • library(rsample)
    • gap_split <- initial_split(gapminder, prop = 0.75)
    • training_data <- training(gap_split)
    • testing_data <- testing(gap_split)
  • The train data can be further split in to train and validate, with validate being used in model building (cross-validation)
    • cv_split <- vfold_cv(training_data, v = 3) # v=3 is for 3-fold cross-validation
    • cv_data <- cv_split %>% mutate(train = map(splits, ~training(.x)), validate = map(splits, ~testing(.x)))

Measuring cross-validation performance:

  • Can compare predictions made on the test or validate data to the actual values in the same datasets
  • The MAE captures the average magnitude of differences in the predictions and the actuals
    • cv_prep_lm <- cv_models_lm %>% mutate(validate_actual = map(validate, ~.x$life_expectancy))
  • There is also a map2(.x=, .y=, .f=) function that allows for two input columns
    • cv_prep_lm <- cv_eval_lm %>% mutate(validate_actual = map(validate, ~.x$life_expectancy), validate_predicted = map2(model, validate, ~predict(.x, .y)))
    • library(Metrics)
    • cv_eval_lm <- cv_prep_lm %>% mutate(validate_mae = map2_dbl(validate_actual, validate_predicted, ~mae(actual = .x, predicted = .y)))

Building and tuning a random-forest model:

  • MAE for the gapminder model above is roughly 1.5 years
  • Can instead try a random forest model - can handle non-linear relationships and interactions
    • rf_model <- ranger(formula = , data = , seed = ___)
    • prediction <- predict(rf_model, new_data)$predictions
    • rf_model <- ranger(formula, data, seed, mtry, num.trees) # tuning the hyper-parameters
  • Can tune the mtry parameter using the crossing() function for a tidyverse approach
    • cv_tune <- cv_data %>% crossing(mtry = 1:5) # expands the frame for each hyperparameter of interest
    • cv_model_tunerf <- cv_tune %>% mutate(model = map2(train, mtry, ~ranger(formula = life_expectancy~., data = .x, mtry = .y)))

Measuring the test performance:

  • Can compare multiple models, including hyper-parameters
  • The final model is then built using ALL the training data, with the OOB error estimate based on the held-out test data
    • best_model <- ranger(formula = life_expectancy~., data = training_data, mtry = 2, num.trees = 100, seed = 42)
    • test_actual <- testing_data$life_expectancy
    • test_predict <- predict(best_model, testing_data)$predictions
    • mae(test_actual, test_predict)

Example code includes:

set.seed(42)

# Prepare the initial split object
gap_split <- rsample::initial_split(gapminder, prop = 0.75)

# Extract the training dataframe
training_data <- rsample::training(gap_split)

# Extract the testing dataframe
testing_data <- rsample::testing(gap_split)

# Calculate the dimensions of both training_data and testing_data
dim(training_data)
dim(testing_data)


set.seed(42)

# Prepare the dataframe containing the cross validation partitions
cv_split <- rsample::vfold_cv(training_data, v = 5)

cv_data <- cv_split %>% 
  mutate(
    # Extract the train dataframe for each split
    train = map(splits, ~rsample::training(.x)), 
    # Extract the validate dataframe for each split
    validate = map(splits, ~rsample::testing(.x))
  )

# Use head() to preview cv_data
head(cv_data)


# Build a model using the train data for each fold of the cross validation
cv_models_lm <- cv_data %>% 
  mutate(model = map(train, ~lm(formula = lifeExp ~ ., data = .x)))


cv_prep_lm <- cv_models_lm %>% 
  mutate(
    # Extract the recorded life expectancy for the records in the validate dataframes
    validate_actual = map(.x=validate, .f=~.x$lifeExp),
    # Predict life expectancy for each validate set using its corresponding model
    validate_predicted = map2(.x=model, .y=validate, .f=~predict(.x, .y))
  )


library(Metrics)
# Calculate the mean absolute error for each validate fold       
cv_eval_lm <- cv_prep_lm %>% 
  mutate(validate_mae = map2_dbl(.x=validate_actual, .y=validate_predicted, 
                                 .f=~mae(actual = .x, predicted = .y)
                                 )
         )

# Print the validate_mae column
cv_eval_lm$validate_mae

# Calculate the mean of validate_mae column
mean(cv_eval_lm$validate_mae)


library(ranger)

# Build a random forest model for each fold
cv_models_rf <- cv_data %>% 
  mutate(model = map(train, ~ranger(formula = lifeExp ~ ., data = .x,
                                    num.trees = 100, seed = 42)))

# Generate predictions using the random forest model
cv_prep_rf <- cv_models_rf %>% 
  mutate(validate_predicted = map2(.x=model, .y=validate, .f=~predict(.x, .y)$predictions))


# Calculate validate MAE for each fold
cv_eval_rf <- cv_prep_rf %>% 
  mutate(validate_actual=map(.x=validate, .f=~.x$lifeExp), 
         validate_mae = map2_dbl(.x=validate_actual, .y=validate_predicted, 
                                 .f=~mae(actual = .x, predicted = .y)
                                 )
         )

# Print the validate_mae column
cv_eval_rf$validate_mae

# Calculate the mean of validate_mae column
mean(cv_eval_rf$validate_mae)


# Prepare for tuning your cross validation folds by varying mtry
cv_tune <- cv_data %>% 
  tidyr::crossing(mtry = 2:5) 

# Build a model for each fold & mtry combination
cv_model_tunerf <- cv_tune %>% 
  mutate(model = map2(.x=train, .y=mtry, ~ranger(formula = lifeExp ~ ., 
                                           data = .x, mtry = .y, 
                                           num.trees = 100, seed = 42)))


# Generate validate predictions for each model
cv_prep_tunerf <- cv_model_tunerf %>% 
  mutate(validate_predicted = map2(.x=model, .y=validate, .f=~predict(.x, .y)$predictions))

# Calculate validate MAE for each fold and mtry combination
cv_eval_tunerf <- cv_prep_tunerf %>% 
  mutate(validate_actual=map(.x=validate, .f=~.x$lifeExp),
         validate_mae = map2_dbl(.x=validate_actual, .y=validate_predicted, 
                                 .f=~mae(actual = .x, predicted = .y)
                                 )
         )

# Calculate the mean validate_mae for each mtry used  
cv_eval_tunerf %>% 
  group_by(mtry) %>% 
  summarise(mean_mae = mean(validate_mae))


# Build the model using all training data and the best performing parameter
best_model <- ranger(formula = lifeExp ~ ., data = training_data,
                     mtry = 4, num.trees = 100, seed = 42)

# Prepare the test_actual vector
test_actual <- testing_data$lifeExp

# Predict life_expectancy for the testing_data
test_predicted <- predict(best_model, testing_data)$predictions

# Calculate the test MAE
mae(test_actual, test_predicted)

Chapter 4 - Build, Tune, and Evaluate Classification Models

Logistic Regression Models:

  • Binary classification models can also be run using the nest and map approach
  • The dataset of interest is “attrition” based on a fictional employer
    • glm(formula = , data = , family = “binomial”)
    • head(cv_data)
    • cv_models_lr <- cv_data %>% mutate(model = map(train, ~glm(formula = Attrition~., data = .x, family = “binomial”)))

Evaluating Classification Models:

  • Need actual and predicted classes, plus a relevant metric
    • validate_prob <- predict(model, validate, type = “response”)
    • table(validate_actual, validate_predicted)
    • accuracy(validate_actual, validate_predicted)
    • precision(validate_actual, validate_predicted) # of observations with predicted==TRUE, how often is actual==TRUE?
    • recall(validate_actual, validate_predicted) # of observations with actual==TRUE, how often is predicted==TRUE?

Random Forest for Classification:

  • Can tune and build the random-forest model as per previous
    • cv_tune <- cv_data %>% crossing(mtry = c(2, 4, 8, 16))
    • cv_models_rf <- cv_tune %>% mutate(model = map2(train, mtry, ~ranger(formula = Attrition~., data = .x, mtry = .y, num.trees = 100, seed = 42)))
    • validate_classes <- predict(rf_model, rf_validate)$predictions
    • validate_predicted <- validate_classes == “Yes”

Wrap Up:

  • List Column Workflow
  • Explore Models with Broom
  • Build, Tune, and Evaluate Regression Models
  • Build, Tune, and Evaluate Classification Models

Example code includes:

attrition <- readRDS("./RInputFiles/attrition.rds")
str(attrition)
head(attrition)


set.seed(42)

# Prepare the initial split object
data_split <- rsample::initial_split(data=attrition, prop=0.75)

# Extract the training dataframe
training_data <- rsample::training(data_split)

# Extract the testing dataframe
testing_data <- rsample::testing(data_split)

set.seed(42)
cv_split <- rsample::vfold_cv(training_data, v=5)

cv_data <- cv_split %>% 
  mutate(
    # Extract the train dataframe for each split
    train = map(.x=splits, .f=~rsample::training(.x)),
    # Extract the validate dataframe for each split
    validate = map(.x=splits, .f=~rsample::testing(.x))
  )


# Build a model using the train data for each fold of the cross validation
cv_models_lr <- cv_data %>% 
    mutate(model = map(train, ~glm(formula = Attrition ~ ., data = .x, family = "binomial")))


# Extract the first model and validate 
model <- cv_models_lr$model[[1]]
validate <- cv_models_lr$validate[[1]]

# Prepare binary vector of actual Attrition values in validate
validate_actual <- validate$Attrition == "Yes"

# Predict the probabilities for the observations in validate
validate_prob <- predict(model, validate, type = "response")

# Prepare binary vector of predicted Attrition values for validate
validate_predicted <- validate_prob > 0.5


library(Metrics)

# Compare the actual & predicted performance visually using a table
table(validate_actual, validate_predicted)

# Calculate the accuracy
accuracy(validate_actual, validate_predicted)

# Calculate the precision
precision(validate_actual, validate_predicted)

# Calculate the recall
recall(validate_actual, validate_predicted)


cv_prep_lr <- cv_models_lr %>% 
  mutate(
    # Prepare binary vector of actual Attrition values in validate
    validate_actual = map(.x=validate, ~.x$Attrition == "Yes"),
    # Prepare binary vector of predicted Attrition values for validate
    validate_predicted = map2(.x=model, .y=validate, .f=~predict(.x, .y, type = "response") > 0.5)
  )


# Calculate the validate recall for each cross validation fold
cv_perf_recall <- cv_prep_lr %>% 
  mutate(validate_recall = map2_dbl(.x=validate_actual, .y=validate_predicted, .f=~recall(actual = .x, predicted = .y)))

# Print the validate_recall column
cv_perf_recall$validate_recall

# Calculate the average of the validate_recall column
mean(cv_perf_recall$validate_recall)


library(ranger)

# Prepare for tuning your cross validation folds by varying mtry
cv_tune <- cv_data %>%
  crossing(mtry = c(2, 4, 8, 16)) 

# Build a cross validation model for each fold & mtry combination
cv_models_rf <- cv_tune %>% 
  mutate(model = map2(train, mtry, ~ranger(formula = Attrition~., 
                                           data = .x, mtry = .y,
                                           num.trees = 100, seed = 42)))


cv_prep_rf <- cv_models_rf %>% 
  mutate(
    # Prepare binary vector of actual Attrition values in validate
    validate_actual = map(validate, ~.x$Attrition == "Yes"),
    # Prepare binary vector of predicted Attrition values for validate
    validate_predicted = map2(.x=model, .y=validate, ~predict(.x, .y, type = "response")$predictions=="Yes")
  )

# Calculate the validate recall for each cross validation fold
cv_perf_recall <- cv_prep_rf %>% 
  mutate(recall = map2_dbl(.x=validate_actual, .y=validate_predicted, ~recall(actual=.x, predicted=.y)))

# Calculate the mean recall for each mtry used  
cv_perf_recall %>% 
  group_by(mtry) %>% 
  summarise(mean_recall = mean(recall))


# Build the logistic regression model using all training data
best_model <- glm(formula = Attrition ~ ., 
                  data = training_data, family = "binomial")


# Prepare binary vector of actual Attrition values for testing_data
test_actual <- testing_data$Attrition == "Yes"

# Prepare binary vector of predicted Attrition values for testing_data
test_predicted <- predict(best_model, newdata=testing_data, type = "response") > 0.5


# Compare the actual & predicted performance visually using a table
table(test_actual, test_predicted)

# Calculate the test accuracy
accuracy(test_actual, test_predicted)

# Calculate the test precision
precision(test_actual, test_predicted)

# Calculate the test recall
recall(test_actual, test_predicted)

Predictive Analytics Using Networked Data in R

Chapter 1 - Introduction, Networks, and Labeled Networks

Introduction:

  • Labeled networks and network structure for predicting node attributes
    • Predicting Age, Gender, Fraud, Churn, etc., for unknown nodes
  • Course includes labeled social networks, homophily, network featurization, predicting using supervised learning
  • Example of course collaborations - network
    • library(igraph)
    • DataScienceNetwork <- data.frame( from = c(‘A’, ‘A’, ‘A’, ‘A’, ‘B’, ‘B’, ‘C’, ‘C’, ‘D’, ‘D’, ‘D’, ‘E’, ‘F’, ‘F’, ‘G’, ‘G’, ‘H’, ‘H’, ‘I’), to = c(‘B’,‘C’,‘D’,‘E’,‘C’,‘D’,‘D’, ‘G’,‘E’, ‘F’,‘G’,‘F’,‘G’,‘I’, ‘I’,‘H’,‘I’,‘J’,‘J’))
    • g <- graph_from_data_frame(DataScienceNetwork, directed = FALSE)
    • pos <- cbind(c(2, 1, 1.5, 2.5, 4, 4. 5, 3, 3.5, 5, 6), c(10.5, 9.5, 8, 8.5, 9, 7.5, 6, 4.5, 5.5, 4))
    • plot.igraph(g, edge.label = NA, edge.color = ‘black’, layout = pos, vertex.label = V(g)$name, vertex.color = ‘white’, vertex.label.color = ‘black’, vertex.size = 25)
    • V(g)$technology <- c(‘R’,‘R’,‘?’,‘R’,‘R’, ‘R’,‘P’,‘P’,‘P’,‘P’)
    • V(g)\(color <- V(g)\)technology
    • V(g)\(color <- gsub('R',"blue3", V(g)\)color)
    • V(g)\(color <- gsub('P',"green4", V(g)\)color)
    • V(g)\(color <- gsub('?',"gray", V(g)\)color)
  • Will be using the network edgeList which has relationships among customers

Labeled Networks, Social Influence:

  • Example of using node attributes “customers” which defines customers as having churned or not
  • Supposing that churn is a social phenomenon, then churn is likely predictable based on connections
  • Can use the relational neighbor classifier
    • Percentage of neighbors with a certain trait used to predict trait of unlabeled node
    • rNeighbors <- c(4,3,3,5,3,2,3,0,1,0)
    • pNeighbors <- c(0,0,1,1,0,2,2,3,3,2)
    • rRelationalNeighbor <- rNeighbors / (rNeighbors + pNeighbors)
    • rRelationalNeighbor

Challenges:

  • Desire to evaluate models using a test set (out-of-sample performance)
    • Harder to do with networks, where connections are important (cannot just select 60% of the nodes)
    • Often managed by training on one network and testing on another
  • Observations may not be iid (in fact, there tend to be strong correlations between connected nodes)
  • Collective inferencing is another challenge
    • Infer the unknown nodes based on knowledge of how these nodes tend to interact with each other

Example code includes:

library(igraph)


# load("./RInputFiles/StudentEdgelist.RData")

# Create edgeList
elFrom <- c(1, 1, 1, 1, 1, 1, 2, 2, 2, 2, 2, 2, 3, 3, 3, 3, 3, 4, 4, 4, 5, 5, 5, 6, 6, 7, 7, 8, 8, 10, 10, 11, 11, 11, 11, 11, 11, 12, 12, 12, 13, 13, 14, 14, 14, 15, 15, 15, 16, 16, 16, 16, 16, 16, 17, 17, 17, 17, 18, 18, 18, 18, 19, 19, 20, 20, 20, 21, 21, 22, 23, 23, 23, 23, 24, 24, 24, 25, 25, 25, 25, 25, 26, 26, 27, 28, 28, 28, 29, 29, 29, 29, 32, 32, 32, 32, 32, 34, 34, 34, 35, 35, 35, 35, 35, 35, 35, 35, 35, 35, 37, 37, 583, 38, 38, 39, 39, 40, 40, 40, 40, 343, 42, 42, 42, 42, 43, 43, 43, 43, 43, 43, 43, 43, 44, 44, 44, 44, 45, 45, 45, 45, 45, 45, 47, 47, 47, 47, 47, 48, 48, 49, 49, 50, 50, 51, 51, 52, 52, 53, 53, 53, 54, 54, 54, 54, 54, 54, 54, 54, 54, 55, 55, 56, 56, 56, 56, 56, 684, 57, 57, 58, 58, 58, 58, 191, 59, 59, 59, 60, 60, 60, 60, 61, 61, 61, 61, 61, 61, 61, 62, 63, 63, 63, 64, 64, 64, 64, 64, 64, 99, 65, 66, 66, 67, 68, 68, 68, 68, 68, 68, 69, 69, 69, 69, 69, 71, 71, 71, 71, 72, 72, 72, 73, 73, 73, 73, 74, 75, 76, 76, 76, 76, 76, 76, 238, 77, 77, 77, 78, 78, 78, 78, 78, 78, 78, 179, 80, 81, 707, 82, 83, 83, 83, 84, 84, 84, 84, 85, 85, 609, 85, 86, 86, 689, 86, 86, 87, 87, 87, 87, 87, 286, 459, 633, 88, 88, 89, 89, 89, 89, 90, 90, 90, 90, 91, 91, 92, 583, 92, 93, 93, 93, 94, 94, 358, 532, 95, 96, 97, 97, 707, 97, 98, 98, 98, 98, 98, 98, 98, 99, 99, 99, 99, 99, 807, 976, 101, 101, 101, 102, 102, 102, 102, 102, 784, 103, 104, 104, 105, 105, 106, 106, 106, 106, 106, 107, 583, 294, 109, 109, 110, 110, 111, 111, 111, 112, 112, 278, 113, 114, 114, 114, 114, 114, 115, 115, 115, 406, 116, 116, 116, 116, 267, 388, 117, 117, 117, 117, 117, 118, 358, 118, 119, 119, 119, 119, 119, 343, 120, 120, 121, 121, 121, 138, 207, 122, 122, 122, 122, 122, 889, 123, 123, 123, 123, 123, 124, 125, 125, 125, 125, 125, 125, 126, 126, 793, 889, 127, 128, 128, 128, 128, 128, 129, 707, 129, 337, 130, 130, 131, 131, 131, 131, 132, 133, 133, 133, 133, 532, 135, 406, 135, 186, 136, 364, 139, 139, 736, 467, 141, 288, 317, 142, 142, 142, 976, 143, 143, 143, 144, 144, 144, 889, 988, 145, 145, 146, 146, 147, 288, 148, 149, 149, 149, 661, 149, 149, 149, 172, 150, 150, 150, 245, 152, 153, 153, 154, 154, 155, 155, 155, 186, 467, 156, 157, 157, 332, 642, 190, 159, 159, 159, 159, 159, 160, 160, 161, 161, 290, 162, 162, 163, 163, 163, 531, 164, 164, 164, 165, 406, 165, 165, 165, 166, 166, 166, 166, 167, 167, 168, 168, 233, 413, 683, 931, 170, 839, 170, 171, 171, 171, 171, 171, 172, 172, 400, 506, 184, 174, 174, 174, 174, 174, 175, 176, 176, 177, 177, 177, 177, 177, 177, 177, 177, 177, 393, 178, 178, 179, 179, 179, 180, 981, 181, 181, 181, 182, 183, 183, 185, 185, 186, 270, 187, 410, 625, 189, 189, 189, 190, 190, 190, 191, 191, 191, 191, 302, 192, 193, 193, 523, 741, 195, 195, 195, 424, 196, 349, 197, 197, 246, 198, 198, 198, 198, 199, 531, 200, 201, 201, 201, 201, 201, 411, 204, 205, 205, 205, 206, 206, 206, 206, 207, 207, 207, 207, 354, 208, 209, 587, 717, 211, 211, 211, 630, 666, 211, 212, 212, 212, 545, 212, 212, 456, 889, 214, 216, 216, 216)
elFrom <- c(elFrom, 216, 216, 927, 883, 422, 946, 219, 406, 734, 874, 221, 221, 222, 222, 853, 222, 222, 222, 223, 223, 223, 224, 224, 224, 274, 406, 227, 227, 228, 228, 229, 230, 230, 230, 964, 231, 231, 231, 864, 597, 232, 233, 675, 235, 964, 237, 416, 482, 568, 236, 237, 238, 238, 238, 239, 671, 734, 975, 240, 684, 240, 650, 241, 424, 817, 243, 683, 243, 243, 307, 456, 245, 245, 246, 968, 259, 247, 247, 669, 247, 487, 248, 248, 249, 689, 250, 250, 250, 251, 251, 251, 251, 891, 375, 855, 252, 253, 253, 253, 690, 789, 255, 255, 284, 587, 730, 256, 545, 257, 257, 281, 336, 614, 258, 258, 259, 259, 975, 274, 260, 260, 260, 260, 698, 261, 817, 262, 262, 262, 262, 803, 816, 406, 264, 264, 853, 265, 488, 601, 266, 267, 269, 269, 269, 269, 269, 270, 290, 271, 271, 927, 594, 274, 274, 274, 274, 963, 276, 276, 276, 454, 278, 278, 279, 279, 279, 329, 384, 280, 281, 822, 281, 482, 282, 284, 284, 284, 284, 285, 285, 285, 286, 286, 286, 286, 287, 287, 288, 288, 288, 289, 290, 449, 291, 669, 291, 788, 659, 292, 293, 522, 296, 296, 803, 296, 297, 299, 300, 300, 300, 300, 643, 301, 302, 302, 302, 302, 303, 303, 303, 303, 531, 704, 304, 305, 789, 306, 306, 306, 306, 308, 336, 309, 309, 745, 312, 312, 313, 313, 313, 637, 649, 790, 802, 960, 343, 524, 316, 317, 317, 318, 335, 319, 319, 319, 689, 320, 964, 321, 321, 321, 321, 323, 323, 323, 324, 324, 868, 698, 327, 529, 329, 329, 329, 329, 960, 332, 746, 811, 822, 865, 335, 334, 334, 334, 424, 335, 335, 336, 336, 336, 633, 931, 401, 341, 407, 412, 842, 343, 343, 343, 532, 637, 344, 553, 597, 399, 758, 346, 347, 347, 348, 348, 348, 348, 349, 349, 349, 817, 351, 351, 807, 855, 353, 353, 976, 354, 354, 354, 356, 356, 371, 358, 358, 707, 859, 994, 690, 360, 360, 361, 361, 361, 361, 973, 375, 362, 784, 365, 365, 365, 732, 890, 972, 637, 368, 369, 369, 369, 370, 643, 370, 370, 371, 372, 404, 373, 997, 375, 375, 376, 568, 377, 377, 378, 402, 840, 380, 425, 465, 569, 382, 382, 803, 894, 384, 384, 608, 526, 388, 388, 390, 390, 390, 390, 390, 390, 672, 392, 393, 660, 395, 395, 743, 397, 398, 399, 996, 460, 401, 401, 401, 402, 403, 422, 403, 413, 406, 406, 406, 406, 408, 408, 930, 409, 409, 409, 409, 410, 410, 410, 411, 411, 412, 413, 414, 415, 415, 855, 416, 416, 445, 417, 417, 417, 871, 420, 946, 420, 420, 422, 877, 423, 424, 424, 425, 426, 822, 430, 429, 429, 429, 732, 429, 429, 430, 433, 669, 433, 467, 433, 434, 435, 436, 436, 812, 437, 437, 853, 963, 438, 439, 446, 440, 608, 440, 914, 441, 692, 441, 862, 442, 442, 443, 446, 744, 446, 880, 449, 482, 556, 912, 957, 453, 453, 453, 994, 454, 454, 551, 561, 998, 457, 457, 788, 473, 458, 689, 459, 689, 460, 460, 679, 812, 884, 886, 717, 741, 466, 467, 467, 760, 834, 529, 738, 470, 470, 503, 471, 471, 472, 472, 473, 473, 999, 474, 474, 474, 643, 835, 476, 690, 859, 478, 479, 877, 480, 480, 480, 503, 774, 482, 483, 584, 733, 487, 487, 488, 488, 642, 488, 577, 491, 802, 492, 493, 494, 494, 498, 496, 496, 642, 726, 497, 914, 498, 499, 499, 499, 500, 500, 942, 581, 915, 501, 543, 701, 770, 503, 503, 748, 506, 506, 506, 506, 737, 982, 913, 510, 566, 511, 692, 767, 932, 737, 660, 742, 552, 518, 700, 854, 640, 583, 521, 521, 522, 522, 524, 683, 718, 525, 526, 527, 759, 529, 530, 530, 998, 531, 531, 531, 532, 532, 532, 532, 532, 577)
elFrom <- c(elFrom, 533, 533, 877, 534, 534, 534, 734, 535, 535, 561, 536, 538, 538, 538, 539, 614, 652, 541, 541, 541, 997, 543, 543, 543, 946, 545, 791, 549, 550, 963, 705, 809, 554, 554, 555, 912, 556, 556, 556, 556, 557, 958, 632, 665, 719, 560, 560, 561, 570, 628, 707, 777, 923, 976, 564, 564, 738, 564, 564, 565, 565, 566, 566, 567, 567, 567, 569, 570, 958, 679, 958, 908, 638, 736, 577, 653, 808, 607, 645, 774, 865, 636, 583, 583, 999, 585, 585, 587, 840, 609, 589, 589, 995, 592, 874, 625, 698, 594, 595, 596, 822, 732, 823, 607, 771, 724, 804, 600, 839, 601, 731, 800, 854, 645, 607, 607, 607, 607, 608, 609, 610, 610, 891, 943, 613, 615, 800, 839, 638, 619, 619, 883, 620, 620, 768, 622, 877, 623, 623, 623, 633, 892, 889, 787, 984, 748, 761, 929, 690, 930, 630, 630, 632, 633, 685, 634, 634, 635, 635, 635, 637, 968, 883, 638, 638, 816, 642, 669, 643, 643, 644, 646, 895, 740, 649, 650, 650, 961, 651, 651, 856, 730, 849, 680, 908, 960, 661, 662, 931, 955, 666, 666, 669, 669, 669, 670, 671, 671, 768, 672, 812, 818, 675, 677, 677, 677, 679, 679, 679, 889, 683, 684, 732, 685, 876, 770, 687, 788, 690, 692, 692, 692, 692, 692, 790, 916, 698, 718, 722, 743, 937, 702, 704, 707, 759, 917, 713, 713, 732, 715, 892, 717, 718, 874, 921, 942, 744, 722, 891, 968, 724, 724, 726, 726, 881, 732, 733, 734, 793, 892, 740, 970, 742, 743, 744, 744, 784, 746, 886, 807, 770, 996, 994, 856, 878, 813, 769, 771, 902, 956, 982, 780, 810, 874, 825, 873, 840, 924, 789, 988, 790, 811, 791, 875, 795, 795, 800, 802, 964, 805, 980, 808, 808, 808, 874, 874, 811, 922, 819, 868, 929, 881, 822, 822, 952, 865, 963, 981, 988, 872, 832, 839, 960, 851, 855, 855, 860, 918, 861, 875, 875, 984, 888, 890, 897, 901, 998, 905, 961, 907, 918, 988, 976, 982, 922, 923, 924, 947, 970, 974, 997, 999, 942, 952, 984, 992)
elTo <- c(250, 308, 413, 525, 803, 894, 332, 433, 474, 847, 963, 968, 147, 290, 337, 393, 474, 179, 193, 233, 737, 793, 838, 684, 718, 237, 404, 698, 724, 285, 641, 86, 285, 376, 689, 758, 889, 145, 410, 544, 583, 835, 96, 788, 924, 43, 91, 446, 181, 289, 378, 406, 547, 784, 189, 399, 482, 822, 262, 308, 817, 832, 260, 997, 81, 229, 839, 56, 840, 183, 186, 397, 676, 760, 344, 534, 980, 303, 343, 395, 925, 988, 483, 522, 132, 335, 506, 643, 304, 704, 871, 872, 466, 524, 567, 683, 997, 264, 279, 896, 105, 356, 460, 568, 726, 789, 865, 902, 951, 988, 138, 293, 38, 614, 633, 224, 550, 64, 224, 463, 521, 41, 347, 566, 746, 885, 99, 424, 442, 459, 571, 613, 689, 807, 84, 106, 257, 883, 191, 222, 265, 631, 681, 853, 207, 296, 546, 726, 866, 161, 665, 640, 816, 160, 669, 284, 313, 371, 973, 270, 407, 748, 230, 410, 445, 587, 644, 651, 936, 961, 964, 320, 804, 284, 476, 506, 755, 919, 57, 730, 754, 85, 259, 609, 975, 59, 278, 360, 413, 454, 589, 609, 889, 170, 184, 215, 365, 426, 707, 828, 548, 294, 479, 671, 473, 497, 642, 914, 942, 999, 65, 358, 491, 669, 326, 310, 531, 717, 852, 882, 960, 172, 331, 416, 552, 643, 453, 607, 732, 994, 245, 428, 943, 97, 255, 279, 570, 238, 412, 235, 271, 532, 722, 927, 964, 77, 286, 638, 736, 216, 351, 526, 745, 911, 927, 971, 79, 970, 839, 82, 814, 288, 556, 595, 456, 560, 563, 976, 98, 249, 85, 802, 149, 661, 86, 788, 953, 312, 630, 696, 740, 793, 88, 88, 88, 682, 864, 400, 424, 460, 947, 208, 354, 683, 744, 467, 946, 195, 92, 932, 402, 411, 828, 321, 670, 95, 95, 931, 766, 129, 458, 97, 968, 116, 161, 336, 422, 493, 802, 877, 281, 442, 651, 826, 907, 100, 100, 352, 364, 414, 190, 618, 839, 914, 924, 103, 887, 635, 961, 182, 772, 380, 488, 510, 662, 670, 520, 107, 109, 584, 597, 267, 388, 338, 862, 933, 691, 998, 113, 763, 475, 506, 790, 835, 898, 420, 494, 819, 116, 440, 535, 692, 886, 117, 117, 437, 661, 853, 876, 877, 219, 118, 798, 156, 672, 731, 766, 825, 120, 972, 981, 551, 842, 963, 122, 122, 349, 527, 529, 650, 770, 122, 150, 354, 377, 811, 922, 617, 130, 190, 337, 523, 742, 880, 409, 539, 126, 127, 937, 152, 159, 448, 527, 591, 317, 129, 973, 130, 702, 831, 324, 472, 492, 659, 436, 168, 172, 515, 538, 134, 329, 135, 714, 136, 706, 137, 241, 912, 140, 141, 660, 142, 142, 470, 735, 773, 142, 282, 705, 930, 300, 625, 715, 144, 144, 319, 774, 610, 741, 375, 148, 909, 383, 585, 593, 149, 718, 874, 894, 150, 178, 545, 873, 152, 487, 768, 999, 868, 995, 269, 560, 860, 156, 156, 645, 425, 849, 158, 158, 159, 342, 407, 595, 620, 849, 514, 645, 553, 802, 162, 549, 981, 239, 540, 864, 164, 537, 795, 800, 391, 165, 630, 761, 891, 333, 427, 581, 982, 855, 907, 398, 515, 169, 169, 169, 169, 184, 170, 890, 176, 356, 613, 679, 884, 426, 796, 173, 173, 174, 211, 274, 403, 734, 812, 511, 302, 363, 204, 246, 251, 283, 465, 557, 664, 704, 891, 178, 884, 915, 242, 302, 637, 273, 180, 289, 587, 696, 569, 671, 831, 305, 789, 277, 187, 341, 188, 188, 222, 439, 590, 620, 867, 880, 278, 356, 968, 989, 192, 419, 464, 673, 194, 194, 372, 403, 863, 196, 810, 197, 601, 666, 198, 401, 716, 719, 771, 594, 200, 756, 381, 666, 688, 788, 867, 202, 979, 498, 525, 898, 253, 539, 818, 859, 236, 448, 790, 880, 208, 879, 906, 210, 210, 261, 384, 545, 211, 211, 817, 346, 443, 451, 212, 752, 947, 213, 213, 674, 300, 322, 543, 671)
elTo <- c(elTo, 881, 216, 217, 218, 218, 239, 220, 220, 220, 649, 957, 265, 269, 222, 918, 920, 989, 675, 692, 809, 394, 463, 854, 225, 225, 658, 960, 307, 975, 695, 791, 811, 905, 230, 449, 452, 556, 231, 232, 769, 886, 234, 700, 235, 236, 236, 236, 236, 929, 503, 769, 822, 905, 517, 239, 239, 239, 297, 240, 808, 241, 769, 242, 242, 374, 243, 744, 930, 244, 244, 251, 642, 922, 246, 247, 291, 444, 247, 690, 248, 663, 944, 632, 249, 515, 769, 986, 334, 335, 465, 801, 251, 252, 252, 870, 322, 402, 721, 254, 254, 627, 852, 256, 256, 256, 987, 257, 909, 996, 258, 258, 258, 956, 996, 392, 845, 259, 260, 567, 600, 769, 916, 261, 781, 261, 306, 319, 323, 776, 263, 263, 264, 420, 795, 265, 862, 266, 266, 958, 876, 602, 743, 862, 888, 911, 441, 271, 324, 608, 271, 272, 437, 564, 600, 824, 274, 699, 743, 974, 277, 593, 821, 724, 865, 897, 280, 280, 992, 774, 281, 991, 282, 705, 398, 476, 730, 919, 746, 758, 823, 342, 635, 800, 821, 370, 390, 420, 556, 861, 779, 324, 291, 648, 291, 688, 291, 292, 954, 953, 296, 533, 577, 296, 849, 357, 596, 668, 715, 732, 881, 301, 753, 369, 419, 518, 987, 500, 655, 672, 825, 304, 304, 919, 653, 305, 434, 519, 540, 612, 894, 309, 485, 691, 311, 316, 617, 557, 596, 621, 314, 314, 314, 314, 314, 315, 316, 856, 537, 714, 895, 319, 361, 391, 534, 320, 804, 320, 590, 670, 875, 985, 447, 733, 812, 363, 655, 325, 326, 836, 328, 492, 621, 673, 984, 330, 901, 333, 333, 333, 333, 334, 417, 588, 966, 335, 589, 954, 614, 682, 802, 337, 338, 340, 368, 342, 342, 342, 588, 716, 892, 344, 344, 980, 345, 345, 346, 346, 834, 558, 623, 489, 559, 632, 850, 359, 588, 770, 351, 849, 971, 352, 352, 603, 854, 353, 819, 843, 856, 789, 823, 357, 536, 561, 359, 359, 359, 360, 884, 942, 450, 558, 701, 918, 361, 362, 461, 364, 580, 598, 685, 365, 366, 366, 367, 713, 499, 571, 700, 390, 370, 753, 921, 994, 863, 373, 471, 373, 508, 942, 435, 377, 645, 917, 948, 379, 379, 680, 382, 382, 382, 579, 768, 383, 383, 738, 837, 385, 386, 501, 636, 435, 462, 499, 606, 794, 923, 392, 845, 870, 394, 866, 987, 396, 909, 856, 758, 399, 400, 417, 722, 823, 721, 419, 403, 550, 405, 547, 886, 934, 999, 486, 870, 408, 470, 581, 600, 604, 502, 961, 964, 430, 441, 897, 803, 897, 628, 833, 415, 798, 908, 417, 588, 966, 984, 419, 861, 420, 983, 985, 479, 422, 777, 913, 954, 887, 796, 428, 429, 578, 652, 667, 429, 739, 808, 759, 431, 431, 452, 433, 920, 554, 923, 580, 673, 436, 445, 743, 437, 437, 480, 647, 440, 505, 440, 709, 440, 603, 441, 772, 441, 777, 878, 752, 668, 446, 955, 448, 577, 450, 450, 450, 452, 607, 678, 787, 453, 806, 980, 455, 455, 455, 468, 584, 457, 458, 530, 458, 538, 459, 902, 979, 461, 461, 462, 462, 463, 466, 939, 797, 813, 468, 468, 469, 469, 905, 949, 471, 516, 949, 701, 800, 521, 530, 473, 644, 759, 987, 475, 475, 495, 477, 477, 799, 676, 479, 507, 605, 634, 481, 481, 929, 610, 484, 484, 638, 682, 544, 571, 488, 918, 490, 510, 492, 950, 773, 634, 876, 495, 829, 955, 497, 497, 833, 497, 652, 606, 696, 767, 655, 825, 500, 501, 501, 938, 502, 502, 502, 558, 949, 504, 571, 724, 766, 790, 508, 508, 509, 615, 511, 654, 513, 513, 513, 516, 517, 517, 518, 598, 518, 518, 519, 520, 617, 622, 733, 952, 567, 524, 524, 528, 541, 820, 528, 699, 575, 903, 530, 697, 871, 882, 565, 575, 590, 682, 968, 533, 622, 753)
elTo <- c(elTo, 533, 903, 923, 980, 535, 926, 970, 536, 791, 600, 709, 934, 544, 540, 541, 703, 866, 944, 541, 701, 799, 824, 543, 850, 547, 786, 606, 551, 554, 554, 827, 939, 711, 555, 729, 855, 872, 966, 621, 558, 559, 559, 559, 582, 636, 998, 562, 562, 562, 562, 562, 563, 604, 651, 564, 786, 844, 782, 836, 654, 810, 612, 769, 916, 910, 777, 570, 573, 573, 575, 576, 576, 656, 578, 578, 579, 579, 579, 579, 582, 606, 968, 584, 851, 857, 636, 588, 589, 711, 967, 590, 677, 593, 594, 594, 825, 981, 621, 596, 598, 598, 599, 599, 600, 600, 934, 601, 875, 602, 603, 603, 604, 798, 849, 940, 993, 902, 967, 611, 967, 611, 611, 843, 686, 618, 618, 619, 764, 876, 619, 916, 926, 622, 778, 622, 703, 720, 819, 624, 624, 625, 626, 626, 627, 627, 627, 629, 629, 740, 789, 892, 779, 634, 765, 813, 728, 821, 873, 644, 637, 638, 895, 934, 640, 694, 643, 753, 861, 987, 708, 647, 648, 957, 722, 905, 650, 786, 844, 654, 656, 656, 657, 658, 658, 852, 786, 662, 664, 751, 817, 694, 711, 985, 786, 734, 831, 672, 825, 673, 674, 725, 775, 798, 945, 749, 884, 886, 679, 931, 754, 685, 814, 686, 687, 783, 688, 942, 695, 790, 809, 833, 910, 695, 697, 725, 699, 699, 699, 699, 928, 919, 777, 708, 709, 749, 935, 715, 935, 716, 852, 937, 719, 720, 721, 722, 905, 723, 723, 829, 865, 865, 966, 728, 881, 796, 755, 737, 740, 926, 740, 830, 974, 753, 803, 745, 791, 749, 754, 757, 758, 760, 762, 764, 765, 846, 873, 775, 775, 776, 977, 781, 781, 782, 785, 786, 788, 876, 789, 887, 791, 905, 792, 857, 858, 810, 869, 804, 990, 806, 875, 928, 955, 810, 811, 884, 811, 843, 819, 820, 821, 959, 991, 827, 829, 830, 831, 831, 832, 928, 965, 840, 857, 870, 872, 910, 860, 985, 941, 985, 887, 969, 977, 954, 904, 903, 949, 905, 933, 910, 910, 912, 921, 937, 1000, 940, 925, 926, 928, 933, 934, 940, 940, 966, 966)

edgeList <- data.frame(from=elFrom, 
                       to=elTo, 
                       stringsAsFactors = FALSE
                       )

# Inspect edgeList
str(edgeList)
## 'data.frame':    1663 obs. of  2 variables:
##  $ from: num  1 1 1 1 1 1 2 2 2 2 ...
##  $ to  : num  250 308 413 525 803 894 332 433 474 847 ...
head(edgeList)
##   from  to
## 1    1 250
## 2    1 308
## 3    1 413
## 4    1 525
## 5    1 803
## 6    1 894
# Construct the igraph object
network <- graph_from_data_frame(edgeList, directed = FALSE)

# View your igraph object
network
## IGRAPH 966e7fb UN-- 956 1663 -- 
## + attr: name (v/c)
## + edges from 966e7fb (vertex names):
##  [1] 1 --250 1 --308 1 --413 1 --525 1 --803 1 --894 2 --332 2 --433
##  [9] 2 --474 2 --847 2 --963 2 --968 3 --147 3 --290 3 --337 3 --393
## [17] 3 --474 4 --179 4 --193 4 --233 5 --737 5 --793 5 --838 6 --684
## [25] 6 --718 7 --237 7 --404 8 --698 8 --724 10--285 10--641 11--86 
## [33] 11--285 11--376 11--689 11--758 11--889 12--145 12--410 12--544
## [41] 13--583 13--835 14--96  14--788 14--924 15--43  15--91  15--446
## [49] 16--181 16--289 16--378 16--406 16--547 16--784 17--189 17--399
## [57] 17--482 17--822 18--262 18--308 18--817 18--832 19--260 19--997
## + ... omitted several edges
# load("./RInputFiles/StudentCustomers.RData")

custID <- c(1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, 30, 31, 32, 33, 34, 35, 36, 37, 38, 39, 40, 41, 42, 43, 44, 45, 46, 47, 48, 49, 50, 51, 52, 53, 54, 55, 56, 57, 58, 59, 60, 61, 62, 63, 64, 65, 66, 67, 68, 69, 70, 71, 72, 73, 74, 75, 76, 77, 78, 79, 80, 81, 82, 83, 84, 85, 86, 87, 88, 89, 90, 91, 92, 93, 94, 95, 96, 97, 98, 99, 100, 101, 102, 103, 104, 105, 106, 107, 108, 109, 110, 111, 112, 113, 114, 115, 116, 117, 118, 119, 120, 121, 122, 123, 124, 125, 126, 127, 128, 129, 130, 131, 132, 133, 134, 135, 136, 137, 138, 139, 140, 141, 142, 143, 144, 145, 146, 147, 148, 149, 150, 151, 152, 153, 154, 155, 156, 157, 158, 159, 160, 161, 162, 163, 164, 165, 166, 167, 168, 169, 170, 171, 172, 173, 174, 175, 176, 177, 178, 179, 180, 181, 182, 183, 184, 185, 186, 187, 188, 189, 190, 191, 192, 193, 194, 195, 196, 197, 198, 199, 200, 201, 202, 203, 204, 205, 206, 207, 208, 209, 210, 211, 212, 213, 214, 215, 216, 217, 218, 219, 220, 221, 222, 223, 224, 225, 226, 227, 228, 229, 230, 231, 232, 233, 234, 235, 236, 237, 238, 239, 240, 241, 242, 243, 244, 245, 246, 247, 248, 249, 250, 251, 252, 253, 254, 255, 256, 257, 258, 259, 260, 261, 262, 263, 264, 265, 266, 267, 268, 269, 270, 271, 272, 273, 274, 275, 276, 277, 278, 279, 280, 281, 282, 283, 284, 285, 286, 287, 288, 289, 290, 291, 292, 293, 294, 295, 296, 297, 298, 299, 300, 301, 302, 303, 304, 305, 306, 307, 308, 309, 310, 311, 312, 313, 314, 315, 316, 317, 318, 319, 320, 321, 322, 323, 324, 325, 326, 327, 328, 329, 330, 331, 332, 333, 334, 335, 336, 337, 338, 339, 340, 341, 342, 343, 344, 345, 346, 347, 348, 349, 350, 351, 352, 353, 354, 355, 356, 357, 358, 359, 360, 361, 362, 363, 364, 365, 366, 367, 368, 369, 370, 371, 372, 373, 374, 375, 376, 377, 378, 379, 380, 381, 382, 383, 384, 385, 386, 387, 388, 389, 390, 391, 392, 393, 394, 395, 396, 397, 398, 399, 400, 401, 402, 403, 404, 405, 406, 407, 408, 409, 410, 411, 412, 413, 414, 415, 416, 417, 418, 419, 420, 421, 422, 423, 424, 425, 426, 427, 428, 429, 430, 431, 432, 433, 434, 435, 436, 437, 438, 439, 440, 441, 442, 443, 444, 445, 446, 447, 448, 449, 450, 451, 452, 453, 454, 455, 456, 457, 458, 459, 460, 461, 462, 463, 464, 465, 466, 467, 468, 469, 470, 471, 472, 473, 474, 475, 476, 477, 478, 479, 480, 481, 482, 483, 484, 485, 486, 487, 488, 489, 490, 491, 492, 493, 494, 495, 496, 497, 498, 499, 500, 501, 502, 503, 504, 505, 506, 507, 508, 509, 510, 511, 512, 513, 514, 515, 516, 517, 518, 519, 520, 521, 522, 523, 524, 525, 526, 527, 528, 529, 530, 531, 532, 533, 534, 535, 536, 537, 538, 539, 540, 541, 542, 543, 544, 545, 546, 547, 548, 549, 550, 551, 552, 553, 554, 555, 556, 557, 558, 559, 560, 561, 562, 563, 564, 565, 566, 567, 568, 569, 570, 571, 572, 573, 574, 575, 576, 577, 578, 579, 580, 581, 582, 583, 584, 585, 586, 587, 588, 589, 590, 591, 592, 593, 594, 595, 596, 597, 598, 599, 600, 601, 602, 603, 604, 605, 606, 607, 608, 609, 610, 611, 612, 613, 614, 615, 616, 617, 618, 619, 620, 621, 622, 623, 624, 625, 626, 627, 628, 629, 630, 631, 632, 633, 634, 635, 636, 637, 638, 639, 640, 641, 642, 643, 644, 645, 646, 647, 648, 649, 650, 651)
custID <- c(custID, 652, 653, 654, 655, 656, 657, 658, 659, 660, 661, 662, 663, 664, 665, 666, 667, 668, 669, 670, 671, 672, 673, 674, 675, 676, 677, 678, 679, 680, 681, 682, 683, 684, 685, 686, 687, 688, 689, 690, 691, 692, 693, 694, 695, 696, 697, 698, 699, 700, 701, 702, 703, 704, 705, 706, 707, 708, 709, 710, 711, 712, 713, 714, 715, 716, 717, 718, 719, 720, 721, 722, 723, 724, 725, 726, 727, 728, 729, 730, 731, 732, 733, 734, 735, 736, 737, 738, 739, 740, 741, 742, 743, 744, 745, 746, 747, 748, 749, 750, 751, 752, 753, 754, 755, 756, 757, 758, 759, 760, 761, 762, 763, 764, 765, 766, 767, 768, 769, 770, 771, 772, 773, 774, 775, 776, 777, 778, 779, 780, 781, 782, 783, 784, 785, 786, 787, 788, 789, 790, 791, 792, 793, 794, 795, 796, 797, 798, 799, 800, 801, 802, 803, 804, 805, 806, 807, 808, 809, 810, 811, 812, 813, 814, 815, 816, 817, 818, 819, 820, 821, 822, 823, 824, 825, 826, 827, 828, 829, 830, 831, 832, 833, 834, 835, 836, 837, 838, 839, 840, 841, 842, 843, 844, 845, 846, 847, 848, 849, 850, 851, 852, 853, 854, 855, 856, 857, 858, 859, 860, 861, 862, 863, 864, 865, 866, 867, 868, 869, 870, 871, 872, 873, 874, 875, 876, 877, 878, 879, 880, 881, 882, 883, 884, 885, 886, 887, 888, 889, 890, 891, 892, 893, 894, 895, 896, 897, 898, 899, 900, 901, 902, 903, 904, 905, 906, 907, 908, 909, 910, 911, 912, 913, 914, 915, 916, 917, 918, 919, 920, 921, 922, 923, 924, 925, 926, 927, 928, 929, 930, 931, 932, 933, 934, 935, 936, 937, 938, 939, 940, 941, 942, 943, 944, 945, 946, 947, 948, 949, 950, 951, 952, 953, 954, 955, 956)
custChurn <- c(0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 1, 1, 0, 0, 0, 0, 0, 0, 0, 0, 1, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 1, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 1, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 1, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 1, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 1, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 1, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 1, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 1, 0, 0, 0, 0, 0, 0, 0, 0, 1, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 1, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 1, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 1, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 1, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 1, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 1, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 1, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 1, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 1, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0)
custChurn <- c(custChurn, 1, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 1, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 1, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 1, 1, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 1, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 1, 0, 0, 0, 1, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 1, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0)

customers <- data.frame(id=custID, churn=custChurn)
# Inspect the customers dataframe
str(customers)
## 'data.frame':    956 obs. of  2 variables:
##  $ id   : num  1 2 3 4 5 6 7 8 9 10 ...
##  $ churn: num  0 0 0 0 0 0 0 0 0 0 ...
head(customers)
##   id churn
## 1  1     0
## 2  2     0
## 3  3     0
## 4  4     0
## 5  5     0
## 6  6     0
# Count the number of churners and non-churners
table(customers$churn)
## 
##   0   1 
## 926  30
matchID <- match(V(network), customers$id)
churnID <- customers$churn[matchID]
table(churnID)
## churnID
##   0   1 
## 926  30
churnID[is.na(churnID)] <- 0
table(churnID)
## churnID
##   0   1 
## 926  30
# Add a node attribute called churn
V(network)$churn <- churnID


# useVerts <- c('1', '10', '100', '1000', '101', '102', '103', '104', '105', '106', '107', '109', '11', '110', '111', '112', '113', '114', '115', '116', '117', '118', '119', '12', '120', '121', '122', '123', '124', '125', '126', '127', '128', '129', '13', '130', '131', '132', '133', '134', '135', '136', '137', '138', '139', '14', '140', '141', '142', '143', '144', '145', '146', '147', '148', '149', '15', '150', '152', '153', '154', '155', '156', '157', '158', '159', '16', '160', '161', '162', '163', '164', '165', '166', '167', '168', '169', '17', '170', '171', '172', '173', '174', '175', '176', '177', '178', '179', '18', '180', '181', '182', '183', '184', '185', '186', '187', '188', '189', '19', '190', '191', '192', '193', '194', '195', '196', '197', '198', '199', '2', '20', '200', '201', '202', '204', '205', '206', '207', '208', '209', '21', '210', '211', '212', '213', '214', '215', '216', '217', '218', '219', '22', '220', '221', '222', '223', '224', '225', '227', '228', '229', '23', '230', '231', '232', '233', '234', '235', '236', '237', '238', '239', '24', '240', '241', '242', '243', '244', '245', '246', '247', '248', '249', '25', '250', '251', '252', '253', '254', '255', '256', '257', '258', '259', '26', '260', '261', '262', '263', '264', '265', '266', '267', '269', '27', '270', '271', '272', '273', '274', '276', '277', '278', '279', '28', '280', '281', '282', '283', '284', '285', '286', '287', '288', '289', '29', '290', '291', '292', '293', '294', '296', '297', '299', '3', '300', '301', '302', '303', '304', '305', '306', '307', '308', '309', '310', '311', '312', '313', '314', '315', '316', '317', '318', '319', '32', '320', '321', '322', '323', '324', '325', '326', '327', '328', '329', '330', '331', '332', '333', '334', '335', '336', '337', '338', '34', '340', '341', '342', '343', '344', '345', '346', '347', '348', '349', '35', '351', '352', '353', '354', '356', '357', '358', '359', '360', '361', '362', '363', '364', '365', '366', '367', '368', '369', '37', '370', '371', '372', '373', '374', '375', '376', '377', '378', '379', '38', '380', '381', '382', '383', '384', '385', '386', '388', '39', '390', '391', '392', '393', '394', '395', '396', '397', '398', '399', '4', '40', '400', '401', '402', '403', '404', '405', '406', '407', '408', '409', '41', '410', '411', '412', '413', '414', '415', '416', '417', '419', '42', '420', '422', '423', '424', '425', '426', '427', '428', '429', '43', '430', '431', '433', '434', '435', '436', '437', '438', '439', '44', '440', '441', '442', '443', '444', '445', '446', '447', '448', '449', '45', '450', '451', '452', '453', '454', '455', '456', '457', '458', '459', '460', '461', '462', '463', '464', '465', '466', '467', '468', '469', '47', '470', '471', '472', '473', '474', '475', '476', '477', '478', '479', '48', '480', '481', '482', '483', '484', '485', '486', '487', '488', '489', '49', '490', '491', '492', '493', '494', '495', '496', '497', '498', '499')
# useVerts <- c(useVerts, '5', '50', '500', '501', '502', '503', '504', '505', '506', '507', '508', '509', '51', '510', '511', '513', '514', '515', '516', '517', '518', '519', '52', '520', '521', '522', '523', '524', '525', '526', '527', '528', '529', '53', '530', '531', '532', '533', '534', '535', '536', '537', '538', '539', '54', '540', '541', '543', '544', '545', '546', '547', '548', '549', '55', '550', '551', '552', '553', '554', '555', '556', '557', '558', '559', '56', '560', '561', '562', '563', '564', '565', '566', '567', '568', '569', '57', '570', '571', '573', '575', '576', '577', '578', '579', '58', '580', '581', '582', '583', '584', '585', '587', '588', '589', '59', '590', '591', '592', '593', '594', '595', '596', '597', '598', '599', '6', '60', '600', '601', '602', '603', '604', '605', '606', '607', '608', '609', '61', '610', '611', '612', '613', '614', '615', '617', '618', '619', '62', '620', '621', '622', '623', '624', '625', '626', '627', '628', '629', '63', '630', '631', '632', '633', '634', '635', '636', '637', '638', '64', '640', '641', '642', '643', '644', '645', '646', '647', '648', '649', '65', '650', '651', '652', '653', '654', '655', '656', '657', '658', '659', '66', '660', '661', '662', '663', '664', '665', '666', '667', '668', '669', '67', '670', '671', '672', '673', '674', '675', '676', '677', '678', '679', '68', '680', '681', '682', '683', '684', '685', '686', '687', '688', '689', '69', '690', '691', '692', '694', '695', '696', '697', '698', '699', '7', '700', '701', '702', '703', '704', '705', '706', '707', '708', '709', '71', '711', '713', '714', '715', '716', '717', '718', '719', '72', '720', '721', '722', '723', '724', '725', '726', '728', '729', '73', '730', '731', '732', '733', '734', '735', '736', '737', '738', '739', '74', '740', '741', '742', '743', '744', '745', '746', '748', '749', '75', '751', '752', '753', '754', '755', '756', '757', '758', '759', '76', '760', '761', '762', '763', '764', '765', '766', '767', '768', '769', '77', '770', '771', '772', '773', '774', '775', '776', '777', '778', '779', '78', '780', '781', '782', '783', '784', '785', '786', '787', '788', '789', '79', '790', '791', '792', '793', '794', '795', '796', '797', '798', '799', '8', '80', '800', '801', '802', '803', '804', '805', '806', '807', '808', '809', '81', '810', '811', '812', '813', '814', '816', '817', '818', '819', '82', '820', '821', '822', '823', '824', '825', '826', '827', '828', '829', '83', '830', '831', '832', '833', '834', '835', '836', '837', '838', '839', '84', '840', '842', '843', '844', '845', '846', '847', '849', '85', '850', '851', '852', '853', '854', '855', '856', '857', '858', '859', '86', '860', '861', '862', '863', '864', '865', '866', '867', '868', '869', '87', '870', '871', '872', '873', '874', '875', '876', '877', '878', '879', '88', '880', '881', '882', '883', '884', '885', '886', '887', '888', '889', '89', '890', '891', '892', '894', '895', '896', '897', '898', '90', '901', '902', '903', '904', '905', '906', '907', '908', '909', '91', '910', '911', '912', '913', '914', '915', '916', '917', '918', '919', '92', '920', '921', '922', '923', '924', '925', '926', '927', '928', '929', '93', '930', '931', '932', '933', '934', '935', '936', '937', '938', '939', '94', '940', '941', '942', '943', '944', '945', '946', '947', '948', '949', '95', '950', '951', '952', '953', '954', '955', '956', '957', '958', '959', '96', '960', '961', '963', '964', '965', '966', '967', '968', '969', '97', '970', '971', '972', '973', '974', '975', '976', '977', '979', '98', '980', '981', '982', '983', '984', '985', '986', '987', '988', '989', '99', '990', '991', '992', '993', '994', '995', '996', '997', '998', '999')

# useVertNums <- match(useVerts, V(network))
# useNetwork <- induced_subgraph(network, useVertNums)
useNetwork <- network
useNetwork
## IGRAPH 966e7fb UN-- 956 1663 -- 
## + attr: name (v/c), churn (v/n)
## + edges from 966e7fb (vertex names):
##  [1] 1 --250 1 --308 1 --413 1 --525 1 --803 1 --894 2 --332 2 --433
##  [9] 2 --474 2 --847 2 --963 2 --968 3 --147 3 --290 3 --337 3 --393
## [17] 3 --474 4 --179 4 --193 4 --233 5 --737 5 --793 5 --838 6 --684
## [25] 6 --718 7 --237 7 --404 8 --698 8 --724 10--285 10--641 11--86 
## [33] 11--285 11--376 11--689 11--758 11--889 12--145 12--410 12--544
## [41] 13--583 13--835 14--96  14--788 14--924 15--43  15--91  15--446
## [49] 16--181 16--289 16--378 16--406 16--547 16--784 17--189 17--399
## [57] 17--482 17--822 18--262 18--308 18--817 18--832 19--260 19--997
## + ... omitted several edges
# Visualize the network (pretty messy)
plot(useNetwork, vertex.label = NA, edge.label = NA, edge.color = 'black', vertex.size = 2)

# Add a node attribute called color
V(useNetwork)$color <- V(useNetwork)$churn

# Change the color of churners to red and non-churners to white
V(useNetwork)$color <- gsub("1", "red", V(useNetwork)$color) 
V(useNetwork)$color <- gsub("0", "white", V(useNetwork)$color)

# Plot the network (pretty messy)
plot(useNetwork, vertex.label = NA, edge.label = NA, edge.color = 'black', vertex.size = 2)

# Create a subgraph with only churners
churnerNetwork <- induced_subgraph(useNetwork, v = V(useNetwork)[which(V(useNetwork)$churn == 1)])
                    
# Plot the churner network 
plot(churnerNetwork, vertex.label = NA, vertex.size = 2)

ctNeighbors <- function(v) {
    tmp <- V(useNetwork)[neighbors(useNetwork, v, mode="all")]$churn
    c(sum(tmp==0), sum(tmp==1))
}
mtxNeighbors <- sapply(V(useNetwork), FUN=ctNeighbors)
NonChurnNeighbors <- mtxNeighbors[1, ]
ChurnNeighbors <- mtxNeighbors[2, ]


# Compute the churn probabilities
churnProb <- ChurnNeighbors / (ChurnNeighbors + NonChurnNeighbors)

# Find who is most likely to churn
mostLikelyChurners <- which(churnProb == max(churnProb))

# Extract the IDs of the most likely churners
customers$id[mostLikelyChurners]
## [1]  21 729 764 922
# Find churn probability of the 44th customer
churnProb[44]
## 49 
##  0
# Update the churn probabilties and the non-churn probabilities
AdjacencyMatrix <- as_adjacency_matrix(useNetwork)
nNeighbors <- colSums(mtxNeighbors)
churnProb_updated <- as.vector((AdjacencyMatrix %*% churnProb) / nNeighbors)

# Find updated churn probability of the 44th customer
churnProb_updated[44]
## [1] 0.3333333
# Compute the AUC
pROC::auc(churnID, as.vector(churnProb))
## Area under the curve: 0.5091
# Write a for loop to update the probabilities
for(i in 1:10){
    churnProb <- as.vector((AdjacencyMatrix %*% churnProb) / nNeighbors)
}

# Compute the AUC again
pROC::auc(churnID, as.vector(churnProb))
## Area under the curve: 0.6753

Chapter 2 - Homophily

Homophily:

  • Social networks tend to have reasons for connections (sharing of common properties such as interests, locations, etc.)
  • Homophily is a scientific term for “birds of a feather flock together” (similar nodes are more likely to connect than dissimilar nodes)
  • Can define different types of edges to classify the degree of homophily
    • edge_rr<-sum(E(g)$label==‘rr’) # connects r to r
    • edge_pp<-sum(E(g)$label==‘pp’) # connects p to p
    • edge_rp<-sum(E(g)$label==‘rp’) # connects r to p or p to r
    • p <- 2edges/nodes(nodes-1)

Dyadicity:

  • Dyadicity is a measure of connectedness among nodes with the same attributes
    • Comparison is to a random configuration of the network (1 would be equal to expected, >1 would be greater than expected)
    • Dyadic (>1) - Random (~1) - Anti-Dyadic (<1)

Heterophilicity:

  • Connectedness among nodes with opposite labels
    • Expected number of connections is nA * nB * p (where p is probability of connection across the network)
  • Heterophilic (>1), Random (~1), and Heterophobic (<1) networks are all possible

Summary:

  • Need to evaluate whether node attributes have important relationships - is there structure among the node connections
  • Dyadicity (connectiveness to same type of nodes, relative to expected / average network connectiveness)
  • Hetrophilicity (connectedness to different type of nodes, relative to expected / average network connectiveness)

Example code includes:

# Add the column edgeList$FromLabel
edgeList$FromLabel <- customers[match(edgeList$from, customers$id), 2]
edgeList$FromLabel[is.na(edgeList$FromLabel)] <- 0

# Add the column edgeList$ToLabel
edgeList$ToLabel <- customers[match(edgeList$to, customers$id), 2]
edgeList$ToLabel[is.na(edgeList$ToLabel)] <- 0

# Add the column edgeList$edgeType
edgeList$edgeType <- edgeList$FromLabel + edgeList$ToLabel
 
# Count the number of each type of edge
table(edgeList$edgeType)
## 
##    0    1    2 
## 1544  117    2
# Count churn edges
ChurnEdges <- sum(edgeList$edgeType == 2)
 
# Count non-churn edges
NonChurnEdges <- sum(edgeList$edgeType == 0)
 
# Count mixed edges
MixedEdges <- sum(edgeList$edgeType == 1)
 
# Count all edges
edges <- ChurnEdges + NonChurnEdges + MixedEdges

#Print hte number of edges
edges
## [1] 1663
# Count the number of churn nodes
ChurnNodes <- sum(customers$churn == 1)
 
# Count the number of non-churn nodes
NonChurnNodes <- sum(customers$churn == 0)
 
# Count the total number of nodes
nodes <- ChurnNodes + NonChurnNodes
 
# Compute the network connectance
connectance <- 2 * edges / nodes / (nodes - 1)

# Print the value
connectance
## [1] 0.003643015
# Compute the expected churn dyadicity
ExpectedDyadChurn <- ChurnNodes * (ChurnNodes - 1) * connectance / 2
 
# Compute the churn dyadicity
DyadChurn <- ChurnEdges / ExpectedDyadChurn
 
# Inspect the value
DyadChurn
## [1] 1.262059
# Compute the expected heterophilicity
ExpectedHet <- NonChurnNodes * ChurnNodes * connectance
 
# Compute the heterophilicity
Het <- MixedEdges / ExpectedHet
 
# Inspect the heterophilicity
Het
## [1] 1.156093

Chapter 3 - Network Featurization

Basic Network Features:

  • Provided that the labels of the nodes depend on each other, they can be useful for predictive modeling
  • Can begin by getting neighborhood features
    • degree(g) # first order degree
    • neighborhood.size(g, order=2) # second order degree, or size of neighborhoods counting all 2+ away
    • count_triangles(g) # triangles that each node is part of (triangle has full connection among three nodes)
  • Can also look at the centrality features
    • Betweenness - measure of how often the node is part of a quickest path between two other nodes
    • betweenness(g)
    • Closeness - measure of how easily a node can reach the other nodes
    • closeness(g)
  • Can also look at the transitivity (clustering coefficient)
    • transitivity(g,type = ‘local’) # computed for each node separately
    • Triangles vs. Triangles + Triads (triangles with a missing edge)

Link-Based Features:

  • Link-based features are network features that depend on adjacencies
    • The adjacency matrix has all nodes on both the x and y axis, with a 1 meaning they are linked by an edge
    • A <- get.adjacency(g)
    • Can then run the matrix multiplication (dot product) against (for example) a vector indicating preferences
    • preference <- c(1,1,1,1,1,1,0,0,0,0)
    • rNeighbors <- A %*% preference
    • as.vector(rNeighbors)
  • Could instad get something like the average age of the neighbors
    • age <- c(23,65,33,36,28,45,41,24,38,39)
    • degree <- degree(g)
    • averageAge <- A %*% age / degree

Page Rank:

  • The page rank is the basis of search algorithms such as google
  • The page rank algorithm assumes that clicks on one page lead to the next page, and checks the degree of connectivity
    • Page rank of pages that link to it
    • Number of links that the referring pages include
  • The page rank formula for all pages simultaneously is PR = alpha * A * PR + (1 - alpha) * epsilon
    • The alpha is the likelihood of a link being clicked, assumed to be uniform, assuming 85% as the default
    • The A is the adjacency matrix
    • The PR is the page rank, and is solved with either matrix inversions or iterations
    • page.rank(g)
    • page.rank(g, personalized = c(1,0,0,0,0,0,0,0,0,0)) # a personalized argument where the first node connections drive higher values

Example code includes:

# Extract network degree
V(network)$degree <- degree(network, normalized=TRUE)

# Extraxt 2.order network degree
degree2 <- neighborhood.size(network, 2)

# Normalize 2.order network degree
V(network)$degree2 <- degree2 / (length(V(network)) - 1)

# Extract number of triangles
V(network)$triangles <- count_triangles(network)


# Extract the betweenness
V(network)$betweenness <- betweenness(network, normalized=TRUE)

# Extract the closeness
V(network)$closeness <- closeness(network, normalized=TRUE)
## Warning in closeness(network, normalized = TRUE): At centrality.c:
## 2784 :closeness centrality is not well-defined for disconnected graphs
# Extract the eigenvector centrality
V(network)$eigenCentrality <- eigen_centrality(network, scale = TRUE)$vector


# Extract the local transitivity
V(network)$transitivity <- transitivity(network, type="local", isolates='zero')

# Compute the network's transitivity
transitivity(network)
## [1] 0.1002653
# Extract the adjacency matrix
AdjacencyMatrix <- as_adjacency_matrix(network)

# Compute the second order matrix
SecondOrderMatrix <- AdjacencyMatrix %*% AdjacencyMatrix

# Adjust the second order matrix
SecondOrderMatrix_adj <- ((SecondOrderMatrix) > 0) + 0
diag(SecondOrderMatrix_adj) <- 0

# Inspect the second order matrix
SecondOrderMatrix_adj[1:10, 1:10]
## 10 x 10 sparse Matrix of class "dgCMatrix"
##    [[ suppressing 10 column names '1', '2', '3' ... ]]
##                       
## 1  0 . . . . . . . . .
## 2  . 0 1 . . . . . . .
## 3  . 1 0 . . . . . . .
## 4  . . . 0 . . . . . .
## 5  . . . . 0 . . . . .
## 6  . . . . . 0 . . . .
## 7  . . . . . . 0 . . .
## 8  . . . . . . . 0 . .
## 10 . . . . . . . . 0 1
## 11 . . . . . . . . 1 0
# Compute the number of churn neighbors
V(network)$ChurnNeighbors <- as.vector(AdjacencyMatrix %*% V(network)$churn)

# Compute the number of non-churn neighbors
V(network)$NonChurnNeighbors <- as.vector(AdjacencyMatrix %*% (1 - V(network)$churn))

# Compute the relational neighbor probability
V(network)$RelationalNeighbor <- as.vector(V(network)$ChurnNeighbors / 
    (V(network)$ChurnNeighbors + V(network)$NonChurnNeighbors))


# Compute the number of churners in the second order neighborhood
V(network)$ChurnNeighbors2 <- as.vector(SecondOrderMatrix %*% V(network)$churn)

# Compute the number of non-churners in the second order neighborhood
V(network)$NonChurnNeighbors2 <- as.vector(SecondOrderMatrix %*% (1 - V(network)$churn))

# Compute the relational neighbor probability in the second order neighborhood
V(network)$RelationalNeighbor2 <- as.vector(V(network)$ChurnNeighbors2 / 
    (V(network)$ChurnNeighbors2 + V(network)$NonChurnNeighbors2))


degree <- degree(network)

# Extract the average degree of neighboring nodes
V(network)$averageDegree <- 
    as.vector(AdjacencyMatrix %*% V(network)$degree) / degree

# Extract the average number of triangles of neighboring nodes
V(network)$averageTriangles <- 
    as.vector(AdjacencyMatrix %*% V(network)$triangles) / degree

# Extract the average transitivity of neighboring nodes    
V(network)$averageTransitivity <-
    as.vector(AdjacencyMatrix %*% V(network)$transitivity) / degree

# Extract the average betweeness of neighboring nodes    
V(network)$averageBetweenness <- 
    as.vector(AdjacencyMatrix %*% V(network)$betweenness) / degree


# Compute one iteration of PageRank 
# iter1 <- page.rank(network, algo = 'power', options = list(niter = 1))$vector

# Compute two iterations of PageRank 
# iter2 <- page.rank(network, algo = 'power', options = list(niter = 2))$vector

# Inspect the change between one and two iterations
# sum(abs(iter1 - iter2))

# Inspect the change between nine and ten iterations
# sum(abs(iter9 - iter10))


# Create an empty vector
# value <- c()

# Write a loop to compute PageRank 
# for(i in 1:15){
#   value <- cbind(value, page.rank(network, algo = 'power',options = list(niter = i))$vector)
# }
  
# Compute the differences 
# difference <- colSums(abs(value[,1:14] - value[,2:15]))

# Plot the differences
# plot(1:14, difference)


# boxplots <- function(damping=0.85, personalized=FALSE){
#   if(personalized){
#     V(network)$pp<-page.rank(network,damping=damping,personalized = V(network)$Churn)$vector
#   }
#   else{
#   V(network)$pp<-page.rank(network,damping=damping)$vector
#   }
#   boxplot(V(network)$pp~V(network)$Churn)#
# }

# Look at the distribution of standard PageRank scores
# boxplots(damping = 0.85)

# Inspect the distribution of personalized PageRank scores
# boxplots(damping = 0.85, personalized = TRUE)

# Look at the standard PageRank with damping factor 0.2
# boxplots(damping = 0.2)

# Inspect the personalized PageRank scores with a damping factor 0.99
# boxplots(damping=0.99, personalized = TRUE)


# Compute the default PageRank score
# V(network)$pr_0.85 <- page.rank(network)$vector

# Compute the PageRank score with damping 0.2
# V(network)$pr_0.20 <- page.rank(network, damping=0.2)$vector

# Compute the personalized PageRank score
# V(network)$perspr_0.85 <- page.rank(network, damping=0.85, personalized = V(network)$Churn)$vector

# Compute the personalized PageRank score with damping 0.99
# V(network)$perspr_0.99 <- page.rank(network, damping=0.99, personalized = V(network)$Churn)$vector

Chapter 4 - Putting It All Together

Extract Dataset:

  • May want to extract some of the features from the nodes in the igraph
    • g # prints the object
    • as_data_frame(g,what=‘vertices’) # extracts to data frame - what= can be nodes (vertices) or edges
  • May want to preprocess, particularly for missing values (non-disclosed, non-relevant, processing error, etc.)
    • sum(is.na(dataset$degree))
  • May want to understand the correlations among the node features
    • M <- cor(dataset[,-1])
    • corrplot::corrplot(M, method = ‘circle’)

Building Predictive Models:

  • Building a predictive model using supervised learning
  • Can split the dataset from the graph in to a test and train dataset
  • Can use either logistic regression and random forests
    • glm(R~degree+pageRank, dataset=training_set,family=‘binomial’)
    • library(randomForest)
    • rfModel<-randomForest(R~., dataset=training_set)
    • varImpPlot(rfModel)

Evaluating Model Performance:

  • Can evaluate the model using the test dataset, along with the functions in the pROC library
    • logPredictions <- predict(logModel, newdata = test_set, type = “response”) # probability based on the logistic regression
    • rfPredictions<- predict(rfModel, newdata = test_set, type=‘prob’) # two column matrix, one for the probability of each of the factor states (two in this case)
  • Can evaluate the model based on AUC which is often between 0.5 (random) and 1.0 (perfect)
    • library(pROC)
    • auc(test_set$label, logPredictions)
  • Can also assess “top decile” lift - looks at actual churn among the top-10% churn probabilities
    • library(lift)
    • TopDecileLift(test_set$label, predictions, plot=TRUE)

Wrap Up:

  • Accurately predicting labels for network data
  • Labeled networks that convert edgelists to networks using igraph
  • Homophily - idea that “birds of a feather flock together”
    • Dyadicity - connectedness of nodes of same labels
    • Heterophilicity - connectednedd of nodes of different labels
  • Can featurize the network using igraph
  • Can create datasets based on networks, then use that for modeling
    • dataset <- as_data_frame(g, what=‘vertices’)
    • glm(R~., dataset=training_set, family=‘binomial’)
    • logPredictions <- predict(logModel, newdata=test_set, type=“response”)
    • auc(test_set$label, logPredictions)
    • TopDecileLift(test_set$label, predictions, plot=TRUE)

Example code includes:

# Extract the dataset
dataset_full <- as_data_frame(network, what = "vertices")
dataset_full$Future <- 0
dsF1 <- c(404, 550, 41, 613, 48, 230, 294, 852, 93, 520, 617, 523, 714, 282, 705, 153, 995, 511, 204, 273, 194, 756, 979, 879, 843, 713, 837, 636, 469, 478, 938, 654, 751, 775)
dataset_full[match(dsF1, dataset_full$name), "Future"] <- 1

# Inspect the dataset
head(dataset_full)
##   name churn      degree     degree2 triangles betweenness  closeness
## 1    1     0 0.006282723 0.021989529         2 0.008143888 0.08535931
## 2    2     0 0.006282723 0.030366492         0 0.019841794 0.08965452
## 3    3     0 0.005235602 0.019895288         0 0.008281176 0.08587357
## 4    4     0 0.003141361 0.012565445         0 0.003340597 0.08377928
## 5    5     0 0.003141361 0.008376963         1 0.002081070 0.07731541
## 6    6     0 0.002094241 0.010471204         0 0.001766448 0.08158209
##   eigenCentrality transitivity ChurnNeighbors NonChurnNeighbors
## 1      0.16674956    0.1333333              0                 6
## 2      0.25675402    0.0000000              0                 6
## 3      0.10174163    0.0000000              0                 5
## 4      0.06977430    0.0000000              0                 3
## 5      0.01838209    0.3333333              0                 3
## 6      0.06214509    0.0000000              0                 2
##   RelationalNeighbor ChurnNeighbors2 NonChurnNeighbors2
## 1                  0               3                 22
## 2                  0               0                 28
## 3                  0               2                 16
## 4                  0               0                 11
## 5                  0               0                  9
## 6                  0               0                  9
##   RelationalNeighbor2 averageDegree averageTriangles averageTransitivity
## 1           0.1200000   0.004363002        0.8333333          0.13888889
## 2           0.0000000   0.004886562        0.5000000          0.03888889
## 3           0.1111111   0.003769634        0.6000000          0.08666667
## 4           0.0000000   0.003839442        0.0000000          0.00000000
## 5           0.0000000   0.003141361        0.6666667          0.11111111
## 6           0.0000000   0.004712042        1.0000000          0.13333333
##   averageBetweenness Future
## 1        0.005713676      0
## 2        0.013126033      0
## 3        0.005525569      0
## 4        0.005168532      0
## 5        0.003089281      0
## 6        0.005718188      0
# Remove customers who already churned
dataset_filtered <- dataset_full[-which(dataset_full$churn == 1), ]

# Remove useless columns
dataset <- dataset_filtered[, -c(1, 2)]


# Inspect the feature
summary(dataset$RelationalNeighbor2)
##    Min. 1st Qu.  Median    Mean 3rd Qu.    Max. 
## 0.00000 0.00000 0.00000 0.02509 0.04000 0.33333
# Find the indeces of the missing values
toReplace <- which(is.na(dataset$RelationalNeighbor2))

# Replace the missing values with 0
dataset$RelationalNeighbor2[toReplace] <- 0

# Inspect the feature again
summary(dataset$RelationalNeighbor2)
##    Min. 1st Qu.  Median    Mean 3rd Qu.    Max. 
## 0.00000 0.00000 0.00000 0.02509 0.04000 0.33333
# Generate the correlation matrix
M <- cor(dataset[,])

# Plot the correlations
corrplot::corrplot(M, method = "circle")

# Print the column names
colnames(dataset)
##  [1] "degree"              "degree2"             "triangles"          
##  [4] "betweenness"         "closeness"           "eigenCentrality"    
##  [7] "transitivity"        "ChurnNeighbors"      "NonChurnNeighbors"  
## [10] "RelationalNeighbor"  "ChurnNeighbors2"     "NonChurnNeighbors2" 
## [13] "RelationalNeighbor2" "averageDegree"       "averageTriangles"   
## [16] "averageTransitivity" "averageBetweenness"  "Future"
# Create toRemove
# toRemove <- c(10, 13, 19, 22)

# Remove the columns
# dataset <- dataset[, -toRemove]


# Set the seed
set.seed(7)

# Creat the index vector
index_train <- sample(1:nrow(dataset), round((2/3) * nrow(dataset), 0), replace=FALSE)

# Make the training set
training_set <- dataset[index_train,]

# Make the test set
test_set <- dataset[-index_train,]


# Make firstModel
firstModel <- glm(Future ~ degree + degree2 + triangles + betweenness + closeness + transitivity, 
                  family = "binomial", data = training_set
                  )

# Build the model
secondModel <- glm(Future ~ ChurnNeighbors + RelationalNeighbor + ChurnNeighbors2 + RelationalNeighbor2 + averageDegree + averageTriangles + averageTransitivity + averageBetweenness, 
                   family = "binomial", data = training_set
                   )

# Build the model
thirdModel <- glm(Future ~ ., data=training_set, family="binomial")


# Set seed
set.seed(863)

# Build model
rfModel <- randomForest::randomForest(as.factor(Future)~. ,data=training_set)

# Plot variable importance
randomForest::varImpPlot(rfModel)

# Predict with the first model
firstPredictions <- predict(firstModel, newdata = test_set, type = "response")

# Predict with the first model
secondPredictions <- predict(secondModel, newdata = test_set, type = "response")

# Predict with the first model
thirdPredictions <- predict(thirdModel, newdata = test_set, type = "response")
## Warning in predict.lm(object, newdata, se.fit, scale = 1, type =
## ifelse(type == : prediction from a rank-deficient fit may be misleading
# Predict with the first model
rfPredictions<- predict(rfModel, newdata = test_set, type = "prob")

sapply(list(firstPredictions, secondPredictions, thirdPredictions, rfPredictions[, 2]), 
       FUN=function(x) { pROC::auc(test_set$Future, x) }
       )
## [1] 0.7321538 0.6514643 0.7031727 0.4804759

Bayesian Regression Modeling with rstanarm

Chapter 1 - Introduction to Bayesian Linear Models

Non-Bayesian Linear Regression:

  • Can use the “kidiq” dataset from the rstanarm package
  • Objective is to predict the child IQ from the mom IQ
    • lm_model <- lm(kid_score ~ mom_iq, data = kidiq)
    • summary(lm_model)
    • broom::tidy(lm_model)
  • Challenge of the p-value is that it is only a comparison to the null hypothesis
  • Often interested in understanding the underlying population, as well the statistic calculated
  • Can use the “songs” dataset from Spotify

Bayesian Linear Regression:

  • Bayesian methods sample from the posterior distribution, allowing for inferences about values the parameters might take
  • The “rstanarm” package allows a high-level interface to the Stan library
    • library(rstanarm)
    • stan_model <- stan_glm(kid_score ~ mom_iq, data = kidiq)
    • summary(stan_model)
  • There are several descriptive statistics in the output
    • sigma: Standard deviation of errors
    • mean_PPD: mean of posterior predictive samples
    • log-posterior: analogous to a likelihood
    • Rhat: a measure of within chain variance compared to across chain variance (stability of estimates, with a goal of less than 1.1 for all parameters)

Comparing frequentist and Bayesian models:

  • The Bayesian and frequentist methods produce very similar outputs
  • The fundamental difference is that frequentists assume fixed parameters and random data while Bayesians assume fixed data and random parameters
    • Frequentist - the p-value is the probability of a test statistics, given a specific null hypothesis
    • Bayesian - probabilities of parameters vary in their ability to generate the given data
  • Bayesian approaches use the credible interval, which is very similar to the confidence interval
    • Confidence interval: Probability that a range contains the true value
    • Credible interval: Probability that the true value is within a range
    • posterior_interval(stan_model) # gives the credible intervals (90% by default)
    • posterior_interval(stan_model, prob = 0.95) # gives the 95% credible intervals
  • Can look at both the confidence intervals and the credible intervals for the same dataset and different models
    • confint(lm_model, parm = “mom_iq”, level = 0.95)
    • posterior_interval(stan_model, pars = “mom_iq”, prob = 0.95)
  • Can also look at probabilities that a parameter is between several key points
    • posterior <- spread_draws(stan_model, mom_iq)
    • mean(between(posterior_mom_iq, 0.60, 0.65)) # Bayesian methods allow for actual inferences about the parameter

Example code includes:

# Print the first 6 rows
head(songs)

# Print the structure
str(songs)


# Create the model here
lm_model <- lm(popularity ~ song_age, data = songs)

# Produce the summary
summary(lm_model)

# Print a tidy summary of the coefficients
tidy(lm_model)


# Create the model here
stan_model <- stan_glm(popularity ~ song_age, data = songs)

# Produce the summary
summary(stan_model)

# Print a tidy summary of the coefficients
tidy(stan_model)


# Create the 90% credible intervals
posterior_interval(stan_model)

# Create the 95% credible intervals
posterior_interval(stan_model, prob = 0.95)

# Create the 80% credible intervals
posterior_interval(stan_model, prob = 0.8)

Chapter 2 - Modifying a Bayesian Model

What is in a Bayesian Model?

  • Many levers for modifying a Bayesian model
  • Posterior distributions are sampled in groups called chains (iterations) that begin in random areas
    • Chains move to where there is a good combination of the priors and the parameters
    • Lengths of the chains allow for more robust parameter estimates
  • Convergence is importance, since it ensures a consistent output - chains start at different places, and so the starting iterations (prior to convergence) are discarded
    • The chains start with a few thousand warm-up or burn-in for each of the chains
  • The number of iterations is a balancing act - not enough (convergence problems) or too many (run-time problems)

Prior Distributions:

  • Priors can inform the posterior distribution, given the same data in the experiment
    • More informative priors typically have narrower distributions
    • Can think of the prior as being like an additional data point - more meaningful the less data that we have
    • Generally a best practice to use a weakly informative prior, absent good cause for a strong belief
  • Example of including prior distributions in rstanarm
    • stan_model <- stan_glm(kid_score ~ mom_iq, data = kidiq)
    • prior_summary(stan_model){{1}}
  • Can calculate adjusted scales for the intercept as 10 * sd(y), since 10 is the default for the package
  • Can calculate adjusted scales for the coefficients as (2.5 / sd(x)) * sd(y), since 2.5 is the default for the package
    • prior_summary(stan_model)
  • Can also use unadjusted priors, such as
    • no_scale <- stan_glm(kid_score ~ mom_iq, data = kidiq, prior_intercept = normal(autoscale = FALSE), prior = normal(autoscale = FALSE), prior_aux = exponential(autoscale = FALSE) )
    • prior_summary(no_scale)

User-Specified Priors:

  • Can use a specified prior distribution using the same arguments as in the previous paragraph
    • Research may suggest the parameter should be near a specific value - take advantage of narrow prior
    • Parameters may be constrained, such as a need to be always positive
  • Can specify the priors to be cast to specific values
    • stan_model <- stan_glm(kid_score ~ mom_iq, data = kidiq, prior_intercept = normal(location = 0, scale = 10), prior = normal(location = 0, scale = 2.5), prior_aux = exponential(rate = 1) )
    • stan_model <- stan_glm(kid_score ~ mom_iq, data = kidiq, prior_intercept = normal(location = 0, scale = 10, autoscale = FALSE), prior = normal(location = 0, scale = 2.5, autoscale = FALSE), prior_aux = exponential(rate = 1, autoscale = FALSE) )
    • The autoscale=FALSE is needed so that stan_glm does not rescale the data before applying the priors
    • stan_model <- stan_glm(kid_score ~ mom_iq, data = kidiq, prior_intercept = normal(location = 3, scale = 2), prior = cauchy(location = 0, scale = 1), )
  • There are many types of prior distributions that can be used
    • ?priors
  • Can also set a flat prior (prior provides zero information)
    • stan_model <- stan_glm(kid_score ~ mom_iq, data = kidiq, prior_intercept = NULL, prior = NULL, prior_aux = NULL )
    • This is usually a bad idea; rarely in a state where there is zero information, and a weakly informative prior with an adjusted scale is typically better

Tuning Models for Stability:

  • May need to alter estimation parameters
  • Divergent transitions are when the steps are too big - need to take smaller steps (longer run time)
    • stan_model <- stan_glm(popularity ~ song_age, data = songs, control = list(adapt_delta = 0.95)) # 0.95 is default, increase will decrease step size
  • May have already reached the maximum tree depth in some of the chains (indicates poor efficiency; no good stopping place, and insufficient sampling of the posterior)
    • stan_model <- stan_glm(popularity ~ song_age, data = songs, control = list(max_treedepth = 10)) # 10 is the default, increases allow more sampling

Example code includes:

# 3 chains, 1000 iterations, 500 warmup
model_3chains <- stan_glm(popularity ~ song_age, data = songs,
    chains = 3, iter = 1000, warmup = 500)

# Print a summary of model_3chains
summary(model_3chains)

# 2 chains, 100 iterations, 50 warmup
model_2chains <- stan_glm(popularity ~ song_age, data = songs,
    chains = 2, iter = 100, warmup = 50)

# Print a summary of model_1chain
summary(model_2chains)


# Estimate the model
stan_model <- stan_glm(popularity ~ song_age, data = songs)

# Print a summary of the prior distributions
prior_summary(stan_model)


# Calculate the adjusted scale for the intercept
10 * sd(songs$popularity)

# Calculate the adjusted scale for `song_age`
(2.5 / sd(songs$song_age)) * sd(songs$popularity)

# Calculate the adjusted scale for `valence`
(2.5 / sd(songs$valence)) * sd(songs$popularity)


# Estimate the model with unadjusted scales
no_scale <- stan_glm(popularity ~ song_age, data = songs,
    prior_intercept = normal(autoscale = FALSE),
    prior = normal(autoscale = FALSE),
    prior_aux = exponential(autoscale = FALSE)
)

# Print the prior summary
prior_summary(no_scale)


# Estimate a model with flat priors
flat_prior <- stan_glm(popularity ~ song_age, data = songs,
    prior_intercept = NULL, prior = NULL, prior_aux = NULL)

# Print a prior summary
prior_summary(flat_prior)


# Estimate the model with an informative prior
inform_prior <- stan_glm(popularity ~ song_age, data = songs,
    prior = normal(location = 20, scale = 0.1, autoscale = FALSE))

# Print the prior summary
prior_summary(inform_prior)


# Estimate the model with a new `adapt_delta`
adapt_model <- stan_glm(popularity ~ song_age, data = songs,
  control = list(adapt_delta = 0.99))

# View summary
summary(adapt_model)

# Estimate the model with a new `max_treedepth`
tree_model <- stan_glm(popularity ~ song_age, data = songs,
  control = list(max_treedepth = 15))

# View summary
summary(tree_model)

Chapter 3 - Assessing Model Fit

Using R-Squared Statistics:

  • The R-squared statistic is a measure of how well the model predicts the dependent variable (proportion of variance explained) - “coefficient of determination”
    • R-squared = 1 - RSS/TSS where RSS is residual sum-squares and TSS is total sum-squares
    • lm_model <- lm(kid_score ~ mom_iq, data = kidiq)
    • lm_summary <- summary(lm_model)
    • lm_summary$r.squared
    • ss_res <- var(residuals(lm_model))
    • ss_total <- var(residuals(lm_model)) + var(fitted(lm_model))
    • 1 - (ss_res / ss_total)
  • The R-squared is not save by the stan_glm() call, but can be calculated
    • stan_model <- stan_glm(kid_score ~ mom_iq, data = kidiq)
    • ss_res <- var(residuals(stan_model))
    • ss_total <- var(fitted(stan_model)) + var(residuals(stan_model))
    • 1 - (ss_res / ss_total)

Posterior Predictive Model Checks:

  • Can use posterior distributions to check the model
    • stan_model <- stan_glm(kid_score ~ mom_iq, data = kidiq)
    • spread_draws(stan_model, (Intercept), mom_iq) %>% select(-.draw)
    • predictions <- posterior_linpred(stan_model) # predicted scores using each of the sets of parameter values and each data point
  • Can compare the distributions of predicted and observed scores
    • iter1 <- predictions[1,]
    • iter2 <- predictions[2,]
    • summary(kidiq$kid_score)
    • summary(iter1)
    • summary(iter2)

Model Fit with Posterior Predictive Model Checks:

  • Can use Bayesian functions as part of the post-processing
    • stan_model <- stan_glm(kid_score ~ mom_iq, data = kidiq)
    • r2_posterior <- bayes_R2(stan_model)
    • summary(r2_posterior)
    • quantile(r2_posterior, probs = c(0.025, 0.975))
    • hist(r2_posterior)
    • pp_check(stan_model, “dens_overlay”) # compare densities
    • pp_check(stan_model, “stat”) # compare statistic to histogram
  • The mean is only one aspect - can look at many aspects of the dependent variable
    • pp_check(stan_model, “stat_2d”) # mean and sd plotted on a 2-D plot

Bayesian Model Comparisons:

  • Can compare two or more models produced using rstanarm
  • The LOO (leave one out) package runs a modified (approximated) form of LOO cross-validation
    • library(loo)
    • stan_model <- stan_glm(kid_score ~ mom_iq, data = kidiq)
    • loo(stan_model)
  • The values from LOO mainly have value in comparison to similar models (much like ANOVA for comparing nested linear regression)
    • model_1pred <- stan_glm(kid_score ~ mom_iq, data = kidiq)
    • model_2pred <- stan_glm(kid_score ~ mom_iq * mom_hs, data = kidiq)
    • loo_1pred <- loo(model_1pred)
    • loo_2pred <- loo(model_2pred)
    • compare(loo_1pred, loo_2pred)
  • The compare() function provides the difference in loo, along with an SE
    • Positive means “prefer second model”
    • Negative means “prefer first model”
    • The SE helps assess whether it is meaningful - rule of thumb is to require change in loo greater than SE, otherwise prefer the simpler model

Example code includes:

# Print the R-squared from the linear model
lm_summary$r.squared

# Calulate sums of squares
ss_res <- var(residuals(lm_model))
ss_fit <- var(fitted(lm_model))

# Calculate the R-squared
1 - (ss_res / (ss_res + ss_fit))


# Save the variance of residulas
ss_res <- var(residuals(stan_model))

# Save the variance of fitted values
ss_fit <- var(fitted(stan_model))

# Calculate the R-squared
1 - (ss_res / (ss_res + ss_fit))


# Calculate posterior predictive scores
predictions <- posterior_linpred(stan_model)

# Print a summary of the observed data
summary(songs$popularity)

# Print a summary of the 1st replication
summary(predictions[1,])

# Print a summary of the 10th replication
summary(predictions[10,])


# Calculate the posterior distribution of the R-squared
r2_posterior <- bayes_R2(stan_model)

# Make a histogram of the distribution
hist(r2_posterior)


# Create density comparison
pp_check(stan_model, "dens_overlay")

# Create scatter plot of means and standard deviations
pp_check(stan_model, "stat_2d")


# Estimate the model with 1 predictor
model_1pred <- stan_glm(popularity ~ song_age, data = songs)

# Print the LOO estimate for the 1 predictor model
loo(model_1pred)

# Estimate the model with both predictors
model_2pred <- stan_glm(popularity ~ song_age * artist_name, data = songs)

# Print the LOO estimates for the 2 predictor model
loo(model_2pred)

Chapter 4 - Presenting and Using Bayesian Regression

Visualizing Bayesian Models:

  • Can save the model coefficients using tidy() and then plot the regression against the underlying point
    • stan_model <- stan_glm(kid_score ~ mom_iq, data = kidiq)
    • tidy(stan_model)
    • tidy_coef <- tidy(stan_model)
    • model_intercept <- tidy_coef$estimate[1]
    • model_slope <- tidy_coef$estimate[2]
    • ggplot(kidiq, aes(x = mom_iq, y = kid_score)) + geom_point() + geom_abline(intercept = model_intercept, slope = model_slope,)
  • Can also plot uncertainty using the posterior distribution
    • draws <- spread_draws(stan_model, (Intercept), mom_iq)
    • ggplot(kidiq, aes(x = mom_iq, y = kid_score)) + geom_point()
    • ggplot(kidiq, aes(x = mom_iq, y = kid_score)) + geom_point() geom_abline(data = draws, aes(intercept = (Intercept), slope = mom_iq), size = 0.2, alpha = 0.1, color = “skyblue”)
    • ggplot(kidiq, aes(x = mom_iq, y = kid_score)) + geom_point() geom_abline(data = draws, aes(intercept = (Intercept), slope = mom_iq), size = 0.2, alpha = 0.1, color = “skyblue”) + geom_abline(intercept = model_intercept, slope = model_slope)

Making Predictions:

  • Can make predictions for the observed data
    • stan_model <- stan_glm(kid_score ~ mom_iq + mom_hs, data = kidiq)
    • posteriors <- posterior_predict(stan_model)
    • predict_data <- data.frame( mom_iq = 110, mom_hs = c(0, 1) )
    • new_predictions <- posterior_predict(stan_model, newdata = predict_data)

Visualizing Predictions:

  • Can plot predictions based on the new data
    • stan_model <- stan_glm(kid_score ~ mom_iq + mom_hs, data = kidiq)
    • predict_data <- data.frame( mom_iq = 110, mom_hs = c(0, 1) )
    • posterior <- posterior_predict(stan_model, newdata = predict_data)
    • posterior <- as.data.frame(posterior)
    • colnames(posterior) <- c(“No HS”, “Completed HS”)
    • plot_posterior <- gather(posterior, key = “HS”, value = “predict”)
    • ggplot(plot_posterior, aes(x = predict)) + facet_wrap(~ HS, ncol = 1) + geom_density()

Conclusion:

  • One solution to inferences - implementing Bayesian models
    • Differences between frequentist and Bayesian
    • Importance of making correct inferences
  • Modifying a Bayesian model
  • Evaluating fit of a Bayesian model
  • Using the model to make predictions and communicate results
  • Additional topics for exploration include

Example code includes:

# Save the model parameters
tidy_coef <- tidy(stan_model)

# Extract intercept and slope
model_intercept <- tidy_coef$estimate[1]
model_slope <- tidy_coef$estimate[2]

# Create the plot
ggplot(songs, aes(x = song_age, y = popularity)) +
  geom_point() +
  geom_abline(intercept = model_intercept, slope = model_slope)


# Save the values from each draw of the posterior distribution
draws <- spread_draws(stan_model, `(Intercept)`, `song_age`)

# Print the `draws` data frame to the console
draws

# Create the plot
ggplot(songs, aes(x = song_age, y = popularity)) +
  geom_point()

# Create the plot
ggplot(songs, aes(x = song_age, y = popularity)) +
    geom_point() +
    geom_abline(data = draws, aes(intercept = `(Intercept)`, slope = song_age), 
                size = 0.1, alpha = 0.2, color = "skyblue"
                )

# Create the plot
ggplot(songs, aes(x = song_age, y = popularity)) +
    geom_point() +
    geom_abline(data = draws, aes(intercept = `(Intercept)`, slope = song_age), 
                size = 0.1, alpha = 0.2, color = "skyblue"
                ) +
    geom_abline(intercept = model_intercept, slope = model_slope)

# Estimate the regression model
stan_model <- stan_glm(popularity ~ song_age + artist_name, data = songs)

# Print the model summary
summary(stan_model)

# Get posteriors of predicted scores for each observation
posteriors <- posterior_predict(stan_model)

# Print 10 predicted scores for 5 songs
posteriors[1:10, 1:5]


# Create data frame of new data
predict_data <- data.frame(song_age = 663, artist_name = "Beyoncé")

# Create posterior predictions for Lemonade album
new_predictions <- posterior_predict(stan_model, newdata = predict_data)

# Print first 10 predictions for the new data
new_predictions[1:10, ]

# Print a summary of the posterior distribution of predicted popularity
summary(new_predictions[, 1])


# View new data predictions
new_predictions[1:10, ]

# Convert to data frame and rename variables
new_predictions <- as.data.frame(new_predictions)
colnames(new_predictions) <- c("Adele", "Taylor Swift", "Beyoncé")

# Create tidy data structure
plot_posterior <- gather(new_predictions, key = "artist_name", value = "predict")

# Print formated data
head(plot_posterior)


# Create plot of 
ggplot(plot_posterior, aes(x = predict)) +
    facet_wrap(~ artist_name, ncol = 1) +
    geom_density()

ChIP-seq Workflows in R

Chapter 1 - Introduction to ChIP-seq

What is ChIP-seq?

  • The core of ChIP-seq is understanding how the cells in the body know what to do
  • The function of a cell is largely determined by the expressed genes (DNA - RNA - Proteins)
    • Inhibitors will stop the process
    • Regualtors help keep the cell producing the right proteins - disorders lead to diseases like cancer
  • Can use ChIP-seq to find over-represented genes in various patient cohorts (such as cancer patients)
  • Dataset for the course will be prostate cancer - 5 primary tumors, 3 treatment resistent
    • library(GenomicAlignments)
    • reads <- readGAlignments(‘file_name’)
    • seqnames(reads) # obtaining read coordinates
    • start(reads) # obtaining read coordinates
    • end(reads) # obtaining read coordinates
    • coverage(reads) # computing coverage
  • Can also access the peack cells in the ChIP-seq experiment
    • library(rtracklayer)
    • peaks <- import.bed(‘file_name’)
    • chrom(peaks)
    • ranges(peaks)
    • score(peaks)

ChIP-seq Workflow:

  • First step of the workflow is read mapping - mapping reads to genomes
  • Then, create a coverage profile (number of overlapping reads)
  • Then, import the mapped reads and verify the quality (these are usually the first steps in R - the above steps are usually in more specialized software)
  • Then, identify peaks by comparing samples - AR sample sites that are over-used
  • Then, interpret the findings for a better understanding of the associated biological processes
    • Heat maps - differences in cells and similarities in cells
    • Creating UpSet plots, such as upset(fromList(peak_sets))

ChIP-seq Results Summary:

  • The heatmap plot is useful for assessing sample quality - check for expected patterns
  • Heights of individual peaks across samples can be more informative - height of peak by group can be particularly insightful

Example code includes:

# Print a summary of the 'reads' object
print(reads)

# Get the start position of the first read
start_first <- start(reads)[1]

# Get the end position of the last read
end_last <- end(reads)[length(reads)]

# Compute the number of reads covering each position in the selected region
cvg <- coverage(reads)


# Print a summary of the 'peaks' object
print(peaks)

# Use the score function to find the index of the highest scoring peak
max_idx <- which.max(score(peaks))

# Extract the genomic coordinates of the highest scoring peak using the `chrom` and `ranges` functions
max_peak_chrom <- chrom(peaks)[max_idx]
max_peak_range <- ranges(peaks)[max_idx]


# Create a vector of colors to label groups (there are 2 samples per group)
group <- c(primary = rep("blue", 2), TURP = rep("red", 2))

# Plot the sample correlation matrix `sample_cor` as a heat map
heatmap(sample_cor, ColSideColors = group, RowSideColors = group, 
        cexCol = 0.75, cexRow = 0.75, symm = TRUE)

# Create a heat map of peak read counts
heatmap(read_counts, ColSideColors = group, labRow = "", cexCol = 0.75)


# Take a look at the full gene sets
print(ar_sets)

# Visualise the overlap between the two groups using the `upset` function
upset(fromList(ar_sets))

# Print the genes with differential binding
print(db_sets)

# Visualise the overlap between the two groups using the `upset` function
upset(fromList(db_sets))

Chapter 2 - Back to Basics - Preparing ChIP-seq Data

Importing Data:

  • Read mapping and peak calling are typically carried out with specialized (non-R) tools and then stored in a BAM (Binary Sequence Alignment Map) format
  • Can use Rsamtools package to interact with BAM files
    • Rsamtools provides functions for indexing, reading, filtering and writing of BAM files
  • Use readGAlignments to import mapped reads
    • library(GenomicAlignments)
    • reads <- readGAlignments(bam_file)
  • Use BamViews to define regions of interest
    • library(GenomicRanges)
    • library(Rsamtools)
    • ranges <- GRanges(…)
    • views <- BamViews(bam_file, bamRanges=ranges)
  • Use import.bed to load peak calls from a BED file
    • library(rtracklayer)
    • peaks <- import.bed(peak_bed, genome=“hg19”)
    • bams <- BamViews(bam_file, bamRanges=peaks)
    • reads <- readGAlignments(bams)

Closer Look at Peaks:

  • Can use Gvix to combine data from multiple sources in to a single plot
    • Where are the reads located, and the associated coverage
    • Annotations of key features of read coverage
  • Need to load the key library and set context for data to be plotted
    • library(Gviz)
    • ideogram <- IdeogramTrack(“chr12”, “hg19”)
    • axis <- GenomeAxisTrack()
    • plotTracks(list(ideogram, axis), from=101360000, to=101380000)
  • Can then add data to the track
    • cover_track <- DataTrack(cover_ranges,window=100000,type=‘h’,name=“Coverage”)
    • plotTracks(list(ideogram, cover_track, axis), from=101360000, to=101380000)
    • peak_track <- AnnotationTrack(peaks, name=“Peaks”)
    • plotTracks(list(ideogram, cover_track, peak_track, axis), from=101360000, to=101380000)
    • library(TxDb.Hsapiens.UCSC.hg19.knownGene)
    • tx <- GeneRegionTrack(TxDb.Hsapiens.UCSC.hg19.knownGene, chromosome=“chr12”, start=101360000, end=101380000, name=“Genes”)
    • plotTracks(list(ideogram, cover_track, peak_track, tx, axis), from=101360000, to=101380000)

Cleaning ChIP-seq Data:

  • Incorrectly mapped reads can produce false peaks - “genomic repeats”
    • Particularly problematic if the reference and the sample differ in the number of false reads
    • Low complexity regions (such as end of chromosomes) tend to have poorer quality
  • Amplification bias can be a concern - just prior to sequencing
  • Quality Control reports can help diagnose the potential issues
    • library(ChIPQC)
    • qc_report <- ChIPQC(experiment=“sample_info.csv”, annotation=“hg19”)
    • ChIPQCreport(qc_report)
    • Input is a CSV file mapping samples to input files and descriptions
  • Cleaning the data has many steps
    • Remove duplicate reads
    • Remove reads with multiple hits or low mapping quality
    • Remove peaks in “blacklisted” regions – available from the ENCODE project

Assessing Enrichment:

  • Reading finds the ends where a protein is created, meaning there will also be more than one read representing the ends of the fragment (?)
  • Can be helpful to do read coverage forward and backwards and to then aggregate findings
    • reads <- readGAlignments(bam)
    • reads_gr <- granges(reads[[1]])
    • frag_length <- fragmentlength(qc_report)[“GSM1598218”]
    • reads_ext <- resize(reads_gr, width=frag_length)
    • cover_ext <- coverage(reads_ext)
  • Question is how does coverage look in peaks relative to the rest of the genome
    • bins <- tileGenome(seqinfo(reads), tilewidth=200, cut.last.tile.in.chrom=TRUE) # create 200 bins along the genome
    • peak_bins_overlap <- findOverlaps(bins, peaks) # can find the overlaps
    • peak_bins <- bins[from(peak_bins_overlap), ] # subset to just the overlaps
    • peak_bins$score <- countOverlaps(peak_bins, reads) # count number of overlapping reads
  • Can create a function for the binning reads process
    • count_bins <- function(reads, target, bins){
    • Find all bins overlapping peaks

    • overlap <- from(findOverlaps(bins, target))
    • target_bins <- bins[overlap, ]
    • Count the number of reads overlapping each peak bin

    • target_bins$score <- countOverlaps(target_bins, reads)
    • target_bins
    • }
  • Can find coverage for the blacklisted regions in much the same way
    • peak_bins <- count_bins(reads_ext, peaks, bins)
    • bl_bins <- count_bins(reads_ext, blacklist.hg19, bins)
  • Can then get the background coverage by considering all of the remaining bins
    • bkg_bins <- subset(bins, !bins %in% peak_bins & !bins %in% bl_bins)
    • bkg_bins$score <- countOverlaps(bkg_bins, reads_ext)

Example code includes:

# Load reads form chr20_bam file
reads <- readGAlignments(chr20_bam)

# Create a `BamViews` object for the range 29805000 - 29820000 on chromosome 20
bam_views <- BamViews(chr20_bam, bamRanges=GRanges("chr20", IRanges(start=29805000, end=29820000)))

# Load only the reads in that view
reads_sub <- readGAlignments(bam_views)

# Print the `reads_sub` object
str(reads_sub)


# Load peak calls from chr20_peaks
peaks <- import.bed(chr20_peaks, genome="hg19")

# Create a BamViews object
bam_views <- BamViews(chr20_bam, bamRanges=peaks)

# Load the reads
reads <- readGAlignments(bam_views)


# Create tracks
peak_track <- AnnotationTrack(peak_calls, name="Peaks")
cover_track <- DataTrack(cover_ranges, window=10500, type="polygon", name="Coverage", fill.mountain=c("lighgrey", "lightgrey"), col.mountain="grey")

# Highlight peak locations across tracks
peak_highlight <- HighlightTrack(trackList = list(cover_track, peak_track), range = peak_calls)

# Produce plot
plotTracks(list(ideogram, peak_highlight, GenomeAxisTrack()), chromosome="chr20", from=start_pos, to=end_pos)


# Load reads with mapping qualities by requesting the "mapq" entries
reads <- readGAlignments(bam_file, param=ScanBamParam(what="mapq"))

# Identify good quality alignments
high_mapq <- mcols(reads)$mapq >= 20

# Examine mapping quality distribution for high and low quality alignments
boxplot(mcols(reads)$mapq ~ high_mapq, xlab="good quality alignments", ylab="mapping quality")

# Remove low quality alignments
reads_good <- subset(reads, high_mapq)

Chapter 3 - Comparing ChIP-seq Samples

Introduction to Differential Binding:

  • Objective is to find differences in prostate cancercells that respond or are resistant to treatment
  • Can use PCA to find differences in the groups - directions of the components with the most variation
    • Points can be projected on to the plane
    • qc_result <- ChIPQC(“sample_info.csv”, “hg19”)
    • counts <- dba.count(qc_results, summits=250)
    • plotPrincomp(counts)
  • Can use hierarchical clustering to cluster similar samples for easier future visualization
    • distance <- dist(t(coverage))
    • dendro <- hclust(distance)
    • plot(dendro)
    • dba.plotHeatmap(peaks, maxSites = peak_count, correlations = FALSE)

Testing for Differential Binding:

  • Can use the DiffBind package for either DESeq2 or edgeR
  • Can count the records in a peak dataset
    • peak_counts <- dba.counts(qc_output, summits=250)
  • Can add a contrast for how the sample should be split
    • peak_counts <- dba.contrast(peak_counts, categories = DBA_CONDITION)
  • Want to assess the coverage differences in comparison to a control sequence
    • bind_diff <- dba.analyze(peak_counts)
    • dba.plotPCA(bind_diff, DBA_Condition, contrast=1)
    • dba.plotHeatmap(bind_diff, DBA_Condition, contrast=1)

Closer Look at Differential Binding:

  • Plotting is a good way to look at the results - can use the DiffBind library
  • Can create MA plots - x-axis for concentration, y-axis for resistant vs. log-fold-change of responsive
    • dba.plotMA(dba_object) # MA plots
    • May need to normalize data in the MA plot to eliminate systemic downward bias
  • Can create volcano plots - FDR as a function of log-fold-change
    • dba.plotVolcano(dba_object)
  • Can create box plots
    • dba.plotBox(dba_object)

Example code includes:

# Compute the pairwise distances between samples using `dist`
cover_dist <- dist(t(cover))

# Use `hclust()` to create a dendrogram from the distance matrix
cover_dendro <- hclust(cover_dist)

# Plot the dendrogram
plot(cover_dendro)


# Print the `peaks` object
print(peaks)

# Obtain the coordinates of the merged peaks
merged_peaks <- peaks$merged

# Extract the number of peaks present in the data
peak_count <- nrow(merged_peaks)

# Create a heatmap using the `dba.plotHeatmap()` function
dba.plotHeatmap(peaks, maxSites = peak_count, correlations = FALSE)


# Examine the ar_binding object
print(ar_binding)

# Identify the category corresponding to the tumor type contrast
contrast <- DBA_CONDITION

# Establish the contrast to compare the two tumor types
ar_binding <- dba.contrast(ar_binding, categories=contrast, minMembers=2)

# Examine the ar_binding object again to confirm that the contrast has been added
print(ar_binding)


# Examine the `ar_binding` object to confirm that it contains the required contrast
print(ar_binding)

# Run the differential binding analysis
ar_diff <- dba.analyze(ar_binding)

# Examine the result
print(ar_diff)


# Create a PCA plot using all peaks
dba.plotPCA(ar_diff, DBA_CONDITION)

# Create a PCA plot using only differentially bound peaks
dba.plotPCA(ar_diff, DBA_CONDITION, contrast = 1)

# Create a heatmap using all peaks
dba.plotHeatmap(ar_diff, DBA_CONDITION, correlations = FALSE, maxSites = 440)

# Create a heatmap using only differentially bound peaks
dba.plotHeatmap(ar_diff, DBA_CONDITION, contrast=1, correlations = FALSE)


# Create an MA plot
dba.plotMA(ar_diff)


# Create a volcano plot
dba.plotVolcano(ar_diff)


# Create a box plot of the peak intensities
compare_groups <- dba.plotBox(ar_diff, notch=FALSE)

# Inspect the returned p-values
print(compare_groups)

Chapter 4 - From Peaks to Genes to Function

Interpreting ChIP-seq Peaks:

  • Want to find the genes that impact a particular binding site - no way to know for sure, but often look for “closest” genes
    • Obtain information about gene locations
    • Assign peaks to genes
    • Identify genes associated with stronger peaks in one of the conditions
  • Transcript annotations are helpful
    • library(TxDb.Hsapiens.UCSC.hg19.knownGene)
    • genes(TxDb.Hsapiens.UCSC.hg19.knownGene)
    • library(org.Hs.eg.db) # may be easier for reading/intepreting
    • select(org.Hs.eg.db, keys=gene_id, columns=“SYMBOL”, keytype=“ENTREZID”)
  • Gene symbols are tricky - can have multiple genes given the same symbol
  • Can annotate peaks using the transcript data
    • library(ChIPpeakAnno)
    • annoPeaks(peaks, human_genes, bindingType=“startSite”, bindingRegion=c(-5000,5000))
    • library(DiffBind)
    • dba.plotVenn(peaks, mask=1:2)
  • Can use UpSet plots for better interpretation in larger datasets
    • library(UpSetR)
    • called_peaks <- as.data.frame(peaks$called)
    • upset(called_peaks, sets=colnames(peaks$called), order.by=‘freq’)

Interpreting Gene Lists:

  • Can use a Gene Set image for very long lists of genes - associations with genes of interest
    • library(chipenrich)
    • chipenrich(peaks, genome=‘hg19’, genesets = ‘hallmark’, locusdef = ‘nearest_tss’)

Advanced ChIP-seq Analyses:

  • Loading and analyzing ChIP-seq data in R
  • First step is to import data and then visualize read coverage, peaks, etc.
  • Need to run quality control procedures
  • Can investigate differential binding with DiffBind
  • Can continue to explore additional datasets

Example code includes:

# Extract peaks from ChIPQCexperiment object
peak_calls <- peaks(ar_calls)

# Only keep samples that passed QC
peak_passed <- peak_calls[qc_pass]

# Find overlaps between peak sets
peaks_combined <- findOverlapsOfPeaks(peak_passed[[1]], peak_passed[[2]], 
                                      peak_passed[[3]], peak_passed[[4]], 
                                      maxgap=50
                                      )

# Examine merged peak set
print(peaks_combined)


# Annotate peaks with closest gene
peak_anno <- annoPeaks(peaks_merged, human_genes, bindingType="startSite", bindingRegion=c(-5000,5000))

# How many peaks were found close to genes?
length(peak_anno)

# Where are peaks located relative to genes?
table(peak_anno$insideFeature)


# Create Venn diagram
dba.plotVenn(ar_diff, mask=1:4)

# Convert the matrix of called peaks into a data frame
called_peaks <- as.data.frame(ar_diff$called)

# Create UpSet plot
upset(called_peaks, keep.order = TRUE, sets=colnames(ar_diff$called), order.by="freq")


# Select all peaks with higher intensity in treatment resistant samples
turp_peaks <- peaks_binding[, "GSM1598218"] + peaks_binding[, "GSM1598219"] < peaks_binding[, "GSM1598223"] + peaks_binding[, "GSM1598225"]

# Run enrichment analysis
enrich_turp <- chipenrich(peaks_comb[turp_peaks, ], genome="hg19", 
                   genesets = "hallmark", out_name = NULL, 
                   locusdef = "nearest_tss", qc_plots=FALSE)

# Print the results of the analysis
print(enrich_turp$results)


# Examine the top gene sets
head(enrich_primary$results)

# Extract the gene IDs for the top ranking set
genes <- enrich_primary$results$Geneset.Peak.Genes[1]

# Split gene IDs into a vector
genes_split <- strsplit(genes, ', ')[[1]]

# Convert gene IDs to gene symbols
gene_symbol <- select(org.Hs.eg.db, keys=genes_split, columns="SYMBOL", keytype="ENTREZID")

# Print the result
print(gene_symbol)


# This is the base URL for all KEGG pathways
base_url <- "https://www.kegg.jp/pathway/"

# Add pathway ID to URL
path_url <- paste0(base_url, top_path, collapse="+")

# Collapse gene IDs into selection string
gene_select <- paste(genes, collapse="+")

# Add gene IDs to URL
path_url <- paste(path_url, gene_select, sep="+")

Designing and Analyzing Clinical Trials in R

Chapter 1 - Principles

Fundamentals:

  • Clinical trials are scientific experiments used to evaluate the safety and efficacy of one or more treatments in humans
    • Pharma, medical devices, medical procedures, etc.
  • Four general phases of clinical trials
    • Phase I - small group of healthy volunteers to look for effects and side effects
    • Phase II - small groups of patients with the disease - optimal doses for safety and efficiacy
    • Phase III - chosen dose evaluated for efficacy and safety against a control
    • Phase IV - post-marketing surveillance
  • Randomized control trials are considered the gold-standard for treatment - reduces the impact of confoudning variables (such as in cohort studies)
    • Aim is to have similar patient charcteristics in each of the groups
    • Blinding is when the patient does not know what they are receiving
    • Double-blinding is when the researcher and the patient BOTH do not know what they are receiving

Types of Data and Endpoints:

  • Clinical trials are highly regulated and must meet various international standards
  • Clinical measures are pre-defined in the protocol (endpoints) and can be a mix of primary or secondary measures related to both efficacy and safety
  • Endpoints can be continuous or categorical - example of continuous
    • ggplot(data=exercise, aes(x=sbp_change)) + geom_histogram(fill=“white”, color=“black”) + xlab(“SBP Change, mmHg”)
    • exercise %>% summarise(mean_sbp = mean(sbp_baseline), sd_spb = sd(sbp_baseline))
  • Endpoints can also be categorical, such as did the patient recover in 30 days
    • finaldata %>% group_by(treatment) %>% filter(!is.na(response)) %>% summarise (n = n()) %>% mutate(prop = n / sum(n))
    • table(finaldata\(response, finaldata\)treatment)
  • While binary and continuous endpoints are both common, there are other types also
    • Discrete values, such as drinks per week or years to progression

Basic Statistical Analysis:

  • There is typically a target population (all patients with a disease), a sample population drawn from the target population, and inferences drawn about the target population from the sample population
  • Hypothesis testing is typically run against a null hypothesis - alternative hypothesis can be one-sided or two-sided
    • The p-value is the probability of observing something at least as extreme as our data if the null hypothesis is true - typical hurdles are set at 0.05
  • For comparing distributions, can use the Wilcox test or the Chi-squared test
    • wilcox.test(outcome.variable~ group.variable, data=dataset)
    • table1<-table(care.trial\(group, care.trial\)recover)
    • prop.test(table1, correct=FALSE)

Example code includes:

Acupuncture <- readRDS("./RInputFiles/Ex1_1_1.Rds")

#Explore the Acupuncture dataset with the str() function 
str(Acupuncture)
## 'data.frame':    396 obs. of  18 variables:
##  $ id                           : num  100 101 104 105 108 112 113 114 126 130 ...
##  $ age                          : num  47 52 32 53 56 45 45 49 47 46 ...
##  $ sex                          : Factor w/ 2 levels "Female","Male": 1 1 1 1 1 1 1 1 1 1 ...
##  $ migraine                     : Factor w/ 2 levels "0","1": 2 2 2 2 2 2 2 2 2 2 ...
##  $ chronicity                   : num  35 8 14 10 40 27 30 49 42 3 ...
##  $ treatment.group              : Factor w/ 2 levels "Acupuncture",..: 1 2 2 2 2 1 1 1 2 1 ...
##  $ score.baseline               : num  10.8 9.5 16 32.5 16.5 ...
##  $ score.baseline.4             : Factor w/ 4 levels "[6.75,15.2]",..: 1 1 2 3 2 1 4 3 2 3 ...
##  $ age.group                    : Factor w/ 4 levels "18-34","35-44",..: 3 3 1 3 4 3 3 3 3 3 ...
##  $ score.month3                 : num  NA NA NA 44 17.5 ...
##  $ score.month12                : num  NA NA 15.3 NA 23.2 ...
##  $ withdrawal.reason            : Factor w/ 7 levels "adverse effects",..: 5 7 NA 7 NA NA NA NA NA NA ...
##  $ completedacupuncturetreatment: num  NA NA NA NA NA 1 NA NA NA NA ...
##  $ completer                    : num  0 0 1 0 1 1 1 1 1 1 ...
##  $ total.therap.visits          : num  NA 2 0 2 0 0 7 0 0 10 ...
##  $ total.gp.visits              : num  NA 4 0 0 0 5 1 0 1 0 ...
##  $ total.spec.visits            : num  NA 0 0 0 0 0 0 0 0 0 ...
##  $ total.days.sick              : num  NA 6 3 NA 23 2 6 9 19 0 ...
#Display the treatment group frequencies
table(Acupuncture$treatment.group)
## 
## Acupuncture     Control 
##         202         194
#Generate summaries of the variables by treatment group and save results as baselines
baselines <- compareGroups::compareGroups(treatment.group ~ score.baseline + age + sex, data = Acupuncture)

#Use the createTable function to display the results saved in baselines
baseline.table <- compareGroups::createTable(baselines, show.ratio = FALSE, show.p.overall=FALSE)

#Display the created summary table
baseline.table
## 
## --------Summary descriptives table by 'treatment.group'---------
## 
## ______________________________________ 
##                Acupuncture   Control   
##                   N=202       N=194    
## ¯¯¯¯¯¯¯¯¯¯¯¯¯¯¯¯¯¯¯¯¯¯¯¯¯¯¯¯¯¯¯¯¯¯¯¯¯¯ 
## score.baseline 25.8 (15.5) 27.6 (16.8) 
## age            45.6 (10.6) 45.3 (11.5) 
## sex:                                   
##     Female     169 (83.7%) 164 (84.5%) 
##     Male       33 (16.3%)  30 (15.5%)  
## ¯¯¯¯¯¯¯¯¯¯¯¯¯¯¯¯¯¯¯¯¯¯¯¯¯¯¯¯¯¯¯¯¯¯¯¯¯¯
#Generate a variable for the change from baseline at 12 months
Acupuncture$diff.month12 <- Acupuncture$score.month12 - Acupuncture$score.baseline

#Use the new variable to generate the percentage change from baseline at 12 months
Acupuncture$pct.month12 <- Acupuncture$diff.month12 / Acupuncture$score.baseline * 100

#Generate a histogram for percentage change from baseline within each treatment group
ggplot(data=Acupuncture, aes(x=pct.month12)) + 
  geom_histogram(fill="white", color="black") + facet_wrap( ~ treatment.group) +
  xlab("Percentage Change from Baseline at Month 12")
## `stat_bin()` using `bins = 30`. Pick better value with `binwidth`.
## Warning: Removed 100 rows containing non-finite values (stat_bin).

#Generate the binary response variable. 
Acupuncture$resp35.month12 <- ifelse(Acupuncture$pct.month12 < (-35), 1, 0)

#Encode this new variable as a factor.
Acupuncture$resp35.month12 <- factor(Acupuncture$resp35.month12, 
                                     levels = c(1,0), 
                                     labels=c("greater than 35%", "less than or eq to 35%")
                                     )

#Tabulate the numbers and percentages of patients in each category. 
Acupuncture %>% 
  group_by(resp35.month12) %>% 
  filter(!is.na(resp35.month12)) %>%
  summarise(n = n()) %>% 
  mutate(pct = n / sum(n)*100)
## # A tibble: 2 x 3
##   resp35.month12             n   pct
##   <fct>                  <int> <dbl>
## 1 greater than 35%         132  44.6
## 2 less than or eq to 35%   164  55.4
#Dichotomize the variable for complementary therapist visits into 0 or at least 1 visit.
Acupuncture$any.therap.visits <- ifelse(Acupuncture$total.therap.visits == 0, 0, 1)

#Encode the new variable as a factor
Acupuncture$any.therap.visits <- factor(Acupuncture$any.therap.visits, 
                                        levels = c(0,1), 
                                        labels=c("Did not visit CT", "Visited CT")
                                        )

#Dichotomize the variable for complementary therapist visits into 0 or at least 1 visit.
Acupuncture$any.gp.visits <- ifelse(Acupuncture$total.gp.visits == 0, 0, 1)

#Encode the new variable as a factor
Acupuncture$any.gp.visits <- factor(Acupuncture$any.gp.visits, 
                                        levels = c(0,1), 
                                        labels=c("Did not visit GP", "Visited GP")
                                        )

#Dichotomize the variable for complementary therapist visits into 0 or at least 1 visit.
Acupuncture$any.spec.visits <- ifelse(Acupuncture$total.spec.visits == 0, 0, 1)

#Encode the new variable as a factor
Acupuncture$any.spec.visits <- factor(Acupuncture$any.spec.visits, 
                                        levels = c(0,1), 
                                        labels=c("Did not visit specialist", "Visited specialist")
                                        )

#Generate a combined binary endpoint for having any professional visits. 
Acupuncture$combined <- ifelse(Acupuncture$any.therap.visits=="Did not visit CT" &
                                   Acupuncture$any.gp.visits=="Did not visit GP" & 
                                   Acupuncture$any.spec.visits=="Did not visit specialist", 0, 1
                               )

#Encode the new variable as a factor
Acupuncture$combined <- factor(Acupuncture$combined, 
                               levels = c(0,1), 
                               labels=c("No visits", "At least one visit")
                               )

#Tabulate the new composite endpoint.
table(Acupuncture$combined, useNA="ifany")
## 
##          No visits At least one visit               <NA> 
##                118                211                 67
#Perform the t-test, assuming the variances are equal in the treatment groups
t.test(pct.month12 ~ treatment.group, var.equal=TRUE, data = Acupuncture)
## 
##  Two Sample t-test
## 
## data:  pct.month12 by treatment.group
## t = -3.3531, df = 294, p-value = 0.0009039
## alternative hypothesis: true difference in means is not equal to 0
## 95 percent confidence interval:
##  -25.176008  -6.552921
## sample estimates:
## mean in group Acupuncture     mean in group Control 
##                 -32.36822                 -16.50376
#Use the compareGroups function to save a summary of the results in pct.month12.test
pct.month12.test <- compareGroups::compareGroups(treatment.group ~ pct.month12, data = Acupuncture)

#Use the createTable function to summarize and store the results saved in pct.month12.test.
pct.month12.table <- compareGroups::createTable(pct.month12.test, show.ratio = FALSE, show.p.overall=TRUE)

#Display the results of pct.month12.table
pct.month12.table
## 
## --------Summary descriptives table by 'treatment.group'---------
## 
## _________________________________________________ 
##              Acupuncture     Control    p.overall 
##                 N=158         N=138               
## ¯¯¯¯¯¯¯¯¯¯¯¯¯¯¯¯¯¯¯¯¯¯¯¯¯¯¯¯¯¯¯¯¯¯¯¯¯¯¯¯¯¯¯¯¯¯¯¯¯ 
## pct.month12 -32.37 (42.3) -16.50 (38.6)   0.001   
## ¯¯¯¯¯¯¯¯¯¯¯¯¯¯¯¯¯¯¯¯¯¯¯¯¯¯¯¯¯¯¯¯¯¯¯¯¯¯¯¯¯¯¯¯¯¯¯¯¯
#Use a boxplot to visualize the total days off sick by treatment group.  
ggplot(data=Acupuncture, aes(x=treatment.group, y=total.days.sick)) + 
  geom_boxplot(fill="white", color="black") +
  ylab("Total days off sick") +  xlab("Treatment group")
## Warning: Removed 68 rows containing non-finite values (stat_boxplot).

#Use the Wilcoxon Rank Sum test to compare the two distributions.
wilcox.test(total.days.sick ~ treatment.group, data=Acupuncture)
## 
##  Wilcoxon rank sum test with continuity correction
## 
## data:  total.days.sick by treatment.group
## W = 11991, p-value = 0.09957
## alternative hypothesis: true location shift is not equal to 0
#Perform the test of proportions on resp35.month12 by treatment.group.
prop.test(table(Acupuncture$treatment.group, Acupuncture$resp35.month12), correct=FALSE)
## 
##  2-sample test for equality of proportions without continuity
##  correction
## 
## data:  table(Acupuncture$treatment.group, Acupuncture$resp35.month12)
## X-squared = 15.032, df = 1, p-value = 0.0001057
## alternative hypothesis: two.sided
## 95 percent confidence interval:
##  0.1143954 0.3346965
## sample estimates:
##    prop 1    prop 2 
## 0.5506329 0.3260870
#Use the tidy function to store and display a summary of the test results.
resp35.month12.test <- broom::tidy(prop.test(table(Acupuncture$treatment.group, 
                                                   Acupuncture$resp35.month12
                                                   ), correct=FALSE
                                             )
                                   )
resp35.month12.test
## # A tibble: 1 x 9
##   estimate1 estimate2 statistic p.value parameter conf.low conf.high method
##       <dbl>     <dbl>     <dbl>   <dbl>     <dbl>    <dbl>     <dbl> <chr> 
## 1     0.551     0.326      15.0 1.06e-4         1    0.114     0.335 2-sam~
## # ... with 1 more variable: alternative <chr>
#Calculate the treatment difference
resp35.month12.test$estimate1 - resp35.month12.test$estimate2
## [1] 0.224546

Chapter 2 - Trial Designs

Randomization Methods:

  • Good randomization ensures the groups are appropriately stratified
  • Simple Randomization has every patient with a 50/50 chance of assignment to either group, regardless of how many are already in each group
    • treatment <- c(“A”,“B”)
    • simple.list <- sample(treatment, 20, replace=TRUE)
    • cat(simple.list,sep=“”)
  • May want to instead use blocks, where each block has equal numbers
    • library(blockrand)
    • block.list <- blockrand(n=20, num.levels = 2,block.sizes = c(2,2))
    • Can further randomize the block sizes to avoid the issue of predictability at the end of the block
    • block.list2 <- blockrand(n=20, num.levels = 2,block.sizes = c(1,2))
  • May want to instead used stratified randomization
    • Age group, geographical region, disease severity, etc.
    • over50.severe.list <- blockrand(n=100, num.levels = 2, block.sizes = c(1,2,3,4), stratum=‘Over 50, Severe’, id.prefix=‘O50_S’, block.prefix=‘O50_S’)

Crossover, Factorial, Cluster Randomized Trials:

  • Sometimes a desire to have each patient be their own control after a “washout” period (long enough to reverse effects) - called a crossover trial
    • May increase precision, eliminate inter-pateitn variability, and allow for smaller sample sizes
    • However, orders of treatments may impact outcomes, washout periods may be too short, and patients may fall out before finishing
  • Factorial designs are such that patients may receive A, B, A and B, or placebo only
  • Sometimes desirable to calculate the odds ratios, especially if the treatments are independent
    • Odds of Recovery = nRecover / nNotRecover
    • epitools::oddsratio.wald(recovery.trial\(A, recovery.trial\)recover)
  • May also want to run cluster-level trials, such as by school or by hospital
    • Can run in to problems with sample sizes (need to be large, may not have enough, etc.)

Equivalence and Non-Inferiority Trials:

  • Objective of an equivalence trial is to show similar efficacy - for example, where a generic is being released
    • Need to pre-specify a maximum acceptable difference (delta) among the groups
    • Equivalence is when the confidence intervals are all inside the deltas
    • Non-inferiority is when at least one of the confidence intervals is outside delta, even with the point estimate being inside
    • prop.test(table(infection.trial\(Treatment,infection.trial\)Infection), alternative = “less”, conf.level = 0.95, correct=FALSE)
    • prop.test(table(infection.trial\(Treatment,infection.trial\)Infection), alternative = “greater”, conf.level = 0.95, correct=FALSE)
    • prop.test(table(infection.trial\(Treatment,infection.trial\)Infection), alternative = “two.sided”, conf.level = 0.90, correct=FALSE)
  • Sometimes the only objective is to show non-inferiority with a one-sided test (Ha: new treatment wose then existing), often at the 2.5% level
    • prop.test(table(infection.trial\(Treatment,infection.trial\)Infection), alternative = “less”, conf.level = 0.975, correct=FALSE)
  • Need to state in advance the delta, the number of sides, and the significance levels
    • Lack of superiority does NOT imply equivalence

Bioequivalence trials:

  • Bioequivalence is determined by blood draws after someone has taken a drug - pharmacokinetics (PK)
    • Absorbtion, Excretion
    • Assumption is often made that similar PK profiles will lead to similar safety and efficacy, saving time on Phase III trials
  • PK profiles are often assessed based on key statistics
    • Cmax - highest concentration
    • Tmax - time to highest concentration
    • T1/2 - half-life
    • AUC - area under the curve
    • Crossover designs are frequently used, with washouts being many times greater than the half-life
  • The AUC is often calculated using the trapezoidal method - objective is to be between (0.8, 1.25) of the reference drug for the 90% CI
    • library(PKNCA)
    • pk.calc.auc(PKData\(plasma.conc.n, PKData\)rel.time, interval=c(0.25, 12), method=“linear”)

Example code includes:

#Generate a vector to store treatment labels "A" and "B"
set.seed(123)
arm<-c("A", "B")

#Randomly select treatment arm 14 times with the sample function and store in a vector
simple <- sample(arm, 14, replace=TRUE)

#Display the contents of the vector
simple
##  [1] "B" "B" "B" "B" "B" "A" "B" "A" "B" "A" "B" "A" "A" "A"
#Tabulate the numbers assigned to each treatment.
table(simple)
## simple
## A B 
## 6 8
#Use the blockrand function for 14 patients, two arms and block size 2.
set.seed(123)
block2 <- blockrand::blockrand(n=14, num.levels = 2,  block.prefix='B', block.sizes = c(1,1))

#Display the list.
block2
##    id block.id block.size treatment
## 1   1       B1          2         B
## 2   2       B1          2         A
## 3   3       B2          2         B
## 4   4       B2          2         A
## 5   5       B3          2         A
## 6   6       B3          2         B
## 7   7       B4          2         B
## 8   8       B4          2         A
## 9   9       B5          2         A
## 10 10       B5          2         B
## 11 11       B6          2         A
## 12 12       B6          2         B
## 13 13       B7          2         B
## 14 14       B7          2         A
#Tabulate the numbers per treatment arm.
table(block2$treatment)
## 
## A B 
## 7 7
#Use block randomization to produce lists of length 100 and random block sizes between 2 and 8.
set.seed(123)
under55 <- blockrand::blockrand(n=100, num.levels = 2, block.sizes = 1:4, 
                                id.prefix='U55', block.prefix='U55', stratum='<55y'
                                )
above55 <- blockrand::blockrand(n=100, num.levels = 2, block.sizes = 1:4, 
                                id.prefix='A55', block.prefix='A55',stratum='>=55y'
                                )

#Explore the two lists 
head(under55)
##       id stratum block.id block.size treatment
## 1 U55001    <55y    U5501          6         B
## 2 U55002    <55y    U5501          6         A
## 3 U55003    <55y    U5501          6         B
## 4 U55004    <55y    U5501          6         A
## 5 U55005    <55y    U5501          6         A
## 6 U55006    <55y    U5501          6         B
head(above55)
##       id stratum block.id block.size treatment
## 1 A55001   >=55y    A5501          6         A
## 2 A55002   >=55y    A5501          6         B
## 3 A55003   >=55y    A5501          6         A
## 4 A55004   >=55y    A5501          6         A
## 5 A55005   >=55y    A5501          6         B
## 6 A55006   >=55y    A5501          6         B
#Tabulate the numbers assigned to each treatment within each strata
table(under55$treatment)
## 
##  A  B 
## 53 53
table(above55$treatment)
## 
##  A  B 
## 51 51
fact.data <- readRDS("./RInputFiles/fact.data.Rds")
str(fact.data)
## 'data.frame':    502 obs. of  3 variables:
##  $ glutamine: Factor w/ 2 levels "No","Yes": 2 1 1 2 1 1 2 2 1 1 ...
##  $ selenium : Factor w/ 2 levels "No","Yes": 1 1 2 1 2 1 1 1 2 2 ...
##  $ infection: Factor w/ 2 levels "No","Yes": 2 1 2 2 1 2 2 1 1 1 ...
#Explore the fact.data using the head function.
head(fact.data)
##   glutamine selenium infection
## 1       Yes       No       Yes
## 2        No       No        No
## 3        No      Yes       Yes
## 4       Yes       No       Yes
## 5        No      Yes        No
## 6        No       No       Yes
#Display the numbers with and without infections by supplement combination.
fact.data %>% 
    count(glutamine, selenium, infection)
## # A tibble: 8 x 4
##   glutamine selenium infection     n
##   <fct>     <fct>    <fct>     <int>
## 1 No        No       No           57
## 2 No        No       Yes          68
## 3 No        Yes      No           64
## 4 No        Yes      Yes          63
## 5 Yes       No       No           55
## 6 Yes       No       Yes          71
## 7 Yes       Yes      No           61
## 8 Yes       Yes      Yes          63
#Display the numbers and proportions with infections for those who received glutamine.
fact.data %>% 
    group_by(glutamine) %>% 
    filter(infection=="Yes") %>%
    summarise (n = n()) %>% 
    mutate(prop = n / sum(n))
## # A tibble: 2 x 3
##   glutamine     n  prop
##   <fct>     <int> <dbl>
## 1 No          131 0.494
## 2 Yes         134 0.506
#Display the numbers and proportions with infections for those who received selenium.
fact.data %>% 
    group_by(selenium) %>% 
    filter(infection=="Yes") %>%
    summarise (n = n()) %>% 
    mutate(prop = n / sum(n))
## # A tibble: 2 x 3
##   selenium     n  prop
##   <fct>    <int> <dbl>
## 1 No         139 0.525
## 2 Yes        126 0.475
#Display the numbers with and without infections by supplement combination.
fact.data %>% 
    count(glutamine, selenium, infection)
## # A tibble: 8 x 4
##   glutamine selenium infection     n
##   <fct>     <fct>    <fct>     <int>
## 1 No        No       No           57
## 2 No        No       Yes          68
## 3 No        Yes      No           64
## 4 No        Yes      Yes          63
## 5 Yes       No       No           55
## 6 Yes       No       Yes          71
## 7 Yes       Yes      No           61
## 8 Yes       Yes      Yes          63
#Display the numbers and proportions with infections for those who received glutamine.
fact.data %>% 
    group_by(infection) %>% 
    filter(glutamine=="Yes") %>%
    summarise (n = n()) %>% 
    mutate(prop = n / sum(n))
## # A tibble: 2 x 3
##   infection     n  prop
##   <fct>     <int> <dbl>
## 1 No          116 0.464
## 2 Yes         134 0.536
#Display the numbers and proportions with infections for those who received selenium.
fact.data %>% 
    group_by(infection) %>% 
    filter(selenium=="Yes") %>%
    summarise (n = n()) %>% 
    mutate(prop = n / sum(n))
## # A tibble: 2 x 3
##   infection     n  prop
##   <fct>     <int> <dbl>
## 1 No          125 0.498
## 2 Yes         126 0.502
#Calculate the effect of glutamine on infection
epitools::oddsratio.wald(fact.data$glutamine, fact.data$infection)
## $data
##          Outcome
## Predictor  No Yes Total
##     No    121 131   252
##     Yes   116 134   250
##     Total 237 265   502
## 
## $measure
##          odds ratio with 95% C.I.
## Predictor estimate     lower    upper
##       No  1.000000        NA       NA
##       Yes 1.066991 0.7515148 1.514901
## 
## $p.value
##          two-sided
## Predictor midp.exact fisher.exact chi.square
##       No          NA           NA         NA
##       Yes  0.7180246    0.7216211  0.7169009
## 
## $correction
## [1] FALSE
## 
## attr(,"method")
## [1] "Unconditional MLE & normal approximation (Wald) CI"
#Calculate the effect of selenium on infection
epitools::oddsratio.wald(fact.data$selenium, fact.data$infection)
## $data
##          Outcome
## Predictor  No Yes Total
##     No    112 139   251
##     Yes   125 126   251
##     Total 237 265   502
## 
## $measure
##          odds ratio with 95% C.I.
## Predictor  estimate     lower    upper
##       No  1.0000000        NA       NA
##       Yes 0.8122014 0.5718144 1.153646
## 
## $p.value
##          two-sided
## Predictor midp.exact fisher.exact chi.square
##       No          NA           NA         NA
##       Yes  0.2469929    0.2833307  0.2451355
## 
## $correction
## [1] FALSE
## 
## attr(,"method")
## [1] "Unconditional MLE & normal approximation (Wald) CI"
relapse.trial <- data.frame(Treatment=rep(c("New", "Standard"), times=c(264, 263)), 
                            Relapse=rep(rep(c("At least one relapse", "No relapse"), times=2), 
                                        times=c(184, 80, 169, 94)
                                        ), 
                            stringsAsFactors = TRUE
                            )
str(relapse.trial)
## 'data.frame':    527 obs. of  2 variables:
##  $ Treatment: Factor w/ 2 levels "New","Standard": 1 1 1 1 1 1 1 1 1 1 ...
##  $ Relapse  : Factor w/ 2 levels "At least one relapse",..: 1 1 1 1 1 1 1 1 1 1 ...
table(relapse.trial)
##           Relapse
## Treatment  At least one relapse No relapse
##   New                       184         80
##   Standard                  169         94
#Use the head function to explore the relapse.trial dataset
head(relapse.trial)
##   Treatment              Relapse
## 1       New At least one relapse
## 2       New At least one relapse
## 3       New At least one relapse
## 4       New At least one relapse
## 5       New At least one relapse
## 6       New At least one relapse
#Calculate the number of percentages of relapse by treatment group
relapse.trial %>% 
    group_by(Treatment, Relapse) %>% 
    summarise(n = n()) %>% 
    mutate(pct = (n / sum(n))*100)
## # A tibble: 4 x 4
## # Groups:   Treatment [2]
##   Treatment Relapse                  n   pct
##   <fct>     <fct>                <int> <dbl>
## 1 New       At least one relapse   184  69.7
## 2 New       No relapse              80  30.3
## 3 Standard  At least one relapse   169  64.3
## 4 Standard  No relapse              94  35.7
#Calculate the two-sided 90% confidence interval for the difference
prop.test(table(relapse.trial$Treatment, relapse.trial$Relapse), 
          alternative = "two.sided", conf.level=0.9, correct=FALSE
          )
## 
##  2-sample test for equality of proportions without continuity
##  correction
## 
## data:  table(relapse.trial$Treatment, relapse.trial$Relapse)
## X-squared = 1.7619, df = 1, p-value = 0.1844
## alternative hypothesis: two.sided
## 90 percent confidence interval:
##  -0.01289979  0.12166808
## sample estimates:
##    prop 1    prop 2 
## 0.6969697 0.6425856
PKData <- readRDS("./RInputFiles/PKData.Rds")
str(PKData)
## Classes 'tbl_df', 'tbl' and 'data.frame':    12 obs. of  6 variables:
##  $ subject.id : num  1001 1001 1001 1001 1001 ...
##  $ sample.id  : num  1 2 3 4 5 6 7 8 9 10 ...
##  $ time       : chr  "predose" "15min" "30min" "1h" ...
##  $ rel.time   : num  -0.25 0.25 0.5 1 1.5 2 3 4 6 8 ...
##  $ plasma.conc: chr  "<LLQ" "2.19" "7.28" "12.98" ...
##  $ unit       : chr  "ng/mL" "ng/mL" "ng/mL" "ng/mL" ...
#Display the dataset contents
head(PKData)
## # A tibble: 6 x 6
##   subject.id sample.id time    rel.time plasma.conc unit 
##        <dbl>     <dbl> <chr>      <dbl> <chr>       <chr>
## 1       1001         1 predose    -0.25 <LLQ        ng/mL
## 2       1001         2 15min       0.25 2.19        ng/mL
## 3       1001         3 30min       0.5  7.28        ng/mL
## 4       1001         4 1h          1    12.98       ng/mL
## 5       1001         5 1.5h        1.5  10.76       ng/mL
## 6       1001         6 2h          2    9.01        ng/mL
#Store a numeric version of the concentration variable in plasma.conc.n
PKData$plasma.conc.n <- as.numeric(PKData$plasma.conc)
## Warning: NAs introduced by coercion
#Use ggplot to plot the concentration levels against relative time
ggplot(data=PKData, aes(x=rel.time, y=plasma.conc.n)) + 
    geom_line() +
    geom_point() + ggtitle("Individual Concentration Profile") +
    xlab("Time Relative to First Dose, h") + 
    ylab("Plasma Concentration, ng/mL")
## Warning: Removed 2 rows containing missing values (geom_path).
## Warning: Removed 2 rows containing missing values (geom_point).

#Use the summary function to find the max concentration level
summary(PKData$plasma.conc.n)
##    Min. 1st Qu.  Median    Mean 3rd Qu.    Max.    NA's 
##   0.610   2.388   5.315   5.750   8.578  12.980       2
#Use pk.calc.tmax to find when Cmax occurred, specifying the concentration and time.
PKNCA::pk.calc.tmax(PKData$plasma.conc.n, PKData$rel.time)
## [1] 1
#Use pk.calc.cmax to estimate AUC between 0.25 and 12hrs.
PKNCA::pk.calc.auc(PKData$plasma.conc.n, PKData$rel.time, interval=c(0.25, 12), method="linear")
## [1] 43.33125

Chapter 3 - Sample Size and Power

Introduction to Sample Size and Power:

  • Only a sample from the target population is appropriate, and it needs to be appropriately sized (too big and too small are both problems)
  • Need to understand the requirements of the trial, endpoints, statistical techniques to be used, smallest clinical meaningful difference, variability, and the significance level as well as the power
  • Type I error is rejecting a true null hypothesis - significance level, often set to 0.05
  • Type II error is failing to reject a false null hypothesis - power is 1 minus Type II error and is usually targeted as 0.8 or 0.9
    • power.t.test(delta=3, sd=10, power=0.8, type = “two.sample”, alternative = “two.sided”)
    • power.t.test(delta=3, sd=10, power=0.9, type = “two.sample”, alternative = “two.sided”)
  • May want to instead run a test of proportions
    • power.prop.test(p1=0.3, p2=0.15, power=0.8)

Sample Size Adjustments:

  • The alternative hypothesis is often, but not always, based on a two-sided test
  • If the alternative hypothesis is one-sided, then this should be incproproated in the study design
    • power.t.test(delta=3, sd=10, power=0.8, type = “two.sample”, alternative = “one.sided”)
  • May want to have unequal group sizes (non 1:1 ratio) if it produces better recruitment or compliance
    • n.ttest(power = 0.8, alpha = 0.05, mean.diff = 3, sd1 = 10, sd2 = 10, k = 0.5, design = “unpaired”, fraction = “unbalanced”) # k of 0.5 means a ratio of 2
  • Can also make adjustments for unequal variances
    • n.ttest(power = 0.8, alpha = 0.05, mean.diff = 3, sd1 = 9.06, sd2 = 9.06, k = 1, design = “unpaired”, fraction = “balanced”)
  • There are inevitably drop-outs from clinical trials - ratio is called Q
    • Sample size needs to be inflated by 1 / (1 - Q)
    • orig.n <- power.t.test(delta=3, sd=10, power=0.8, type = “two.sample”, alternative = “one.sided”)$n
    • ceiling(orig.n/(1-0.1)) # assuming Q = 0.1

Interim Analyses and Stopping Rules:

  • Patient recruitment often occurs over a time period of years; can regularly monitor the study prior to completion
    • May want to stop early if the evidence is very strong for superiority, inferiority, side effects, futility, etc.
  • Interim analyses typically require increasing the same size - Type I error increases with more chances to reject
  • The Pocock rule is also known as the “fixed nominal” rule
    • library(gsDesign)
    • Pocock <- gsDesign(k=3, test.type=2, sfu=“Pocock”) # sfu is the spending function and k=3 means 2 interim and 1 final
    • 2*(1-pnorm(Pocock\(upper\)bound))
    • Pocock.ss <- gsDesign(k=3, test.type=2, sfu=“Pocock”, n.fix=200, beta=0.1)
    • ceiling(Pocock.ss$n.I)
  • Can instead use the O’Brien-Fleming rule which has increasing p-value hurdles as the sample size increases (most of the budget is saved for the full and final sample)
    • OF <- gsDesign(k=3, test.type=2, sfu=“OF”)
    • 2*(1-pnorm(OF\(upper\)bound))
    • OF.ss <- gsDesign(k=3, test.type=2, sfu=“OF”, n.fix=200, beta=0.1)
    • ceiling(OF.ss$n.I)

Sample Size for Alternative Trial Designs:

  • Goal of an equivalence trial is to prove similarity to within a maximum specified delta
    • library(TOSTER)
    • powerTOSTtwo.prop(alpha = 0.05, statistical_power = 0.9, prop1 = 0.7, prop2 = 0.7, low_eqbound_prop = -0.05, high_eqbound_prop = 0.05)
    • powerTOSTtwo.raw(alpha=0.05, statistical_power=0.8, sdpooled=15, low_eqbound=-3,high_eqbound=3)
  • May want to instead run a cluster-level randomized trial
    • CRTSize::n4means(delta=1, sigma=2.5, m=25, ICC=0.1, alpha=0.05, power=0.90)
  • May want to instead run a factorial design randomized trial - powered such that it assumes independence (would not detect an interaction effect)
    • power.prop.test(p1=0.40, p2=0.25, power=0.9)
    • power.prop.test(p1=0.40, p2=0.23, power=0.9)

Example code includes:

#Generate the sample size for delta of 1, with SD of 3 and 80% power.
ss1 <- power.t.test(delta=1, sd=3, power=0.8)
ss1
## 
##      Two-sample t test power calculation 
## 
##               n = 142.2466
##           delta = 1
##              sd = 3
##       sig.level = 0.05
##           power = 0.8
##     alternative = two.sided
## 
## NOTE: n is number in *each* group
#Round up and display the numbers needed per group
ceiling(ss1$n)
## [1] 143
#Use the sample size from above to show that it provides 80% power
power.t.test(n=ceiling(ss1$n), delta=1, sd=3)
## 
##      Two-sample t test power calculation 
## 
##               n = 143
##           delta = 1
##              sd = 3
##       sig.level = 0.05
##           power = 0.802082
##     alternative = two.sided
## 
## NOTE: n is number in *each* group
#Generate a vector containing values between 0.5 and 2.0, incrementing by 0.25
delta <- seq(0.5, 2, 0.25)
npergp <- NULL

#Specify the standard deviation and power
for(i in 1:length(delta)){
  npergp[i] <- ceiling(power.t.test(delta = delta[i], sd = 3, power = 0.8)$n)
}

#Create a data frame from the deltas and sample sizes
sample.sizes <- data.frame(delta, npergp)

#Plot the patients per group against the treatment differences
ggplot(data=sample.sizes, aes(x=delta, y=npergp)) + 
    geom_line() + 
    geom_point() + 
    ggtitle("Sample Size Scenarios") + 
    xlab("Treatment Difference") + 
    ylab("Patients per Group")

#Use the power.prop.test to generate sample sizes for the proportions
power.prop.test(p1 = 0.4, p2 = 0.6, power = 0.8)
## 
##      Two-sample comparison of proportions power calculation 
## 
##               n = 96.92364
##              p1 = 0.4
##              p2 = 0.6
##       sig.level = 0.05
##           power = 0.8
##     alternative = two.sided
## 
## NOTE: n is number in *each* group
#Find the minimum detectable percentage for the above using 150 patients per group.
power.prop.test(p1 = 0.4, power = 0.8, n = 150)$p2*100
## [1] 56.0992
#Use 90% power, delta 1.5, standard deviations of 2.5, fraction of 0.5
unequalgps <- samplesize::n.ttest(power = 0.9, alpha = 0.05, mean.diff = 1.5, 
                                  sd1 = 2.5, sd2 = 2.5, k = 0.5, 
                                  design = "unpaired", fraction = "unbalanced"
                    )
unequalgps
## $`Total sample size`
## [1] 135
## 
## $`Sample size group 1`
## [1] 90
## 
## $`Sample size group 2`
## [1] 45
## 
## $Fraction
## [1] 0.5
#Generate sample sizes comparing the proportions using a two-sided test
two.sided <- power.prop.test(p1=0.1, p2=0.3, power=0.8, alternative = "two.sided")
two.sided
## 
##      Two-sample comparison of proportions power calculation 
## 
##               n = 61.5988
##              p1 = 0.1
##              p2 = 0.3
##       sig.level = 0.05
##           power = 0.8
##     alternative = two.sided
## 
## NOTE: n is number in *each* group
ceiling(two.sided$n)
## [1] 62
#Repeat using a one-sided test
one.sided <- power.prop.test(p1=0.1, p2=0.3, power=0.8, alternative = "one.sided")
one.sided
## 
##      Two-sample comparison of proportions power calculation 
## 
##               n = 48.40295
##              p1 = 0.1
##              p2 = 0.3
##       sig.level = 0.05
##           power = 0.8
##     alternative = one.sided
## 
## NOTE: n is number in *each* group
ceiling(one.sided$n)
## [1] 49
#Display the reduction per group
ceiling(two.sided$n)- ceiling(one.sided$n)
## [1] 13
#Use the gsDesign function to generate the p-values for four analyses under the Pocock rule
Pocock <- gsDesign::gsDesign(k=4, test.type=2, sfu="Pocock")
Pocock
## Symmetric two-sided group sequential design with
## 90 % power and 2.5 % Type I Error.
## Spending computations assume trial stops
## if a bound is crossed.
## 
##            Sample
##             Size 
##   Analysis Ratio*  Z   Nominal p  Spend
##          1  0.296 2.36    0.0091 0.0091
##          2  0.592 2.36    0.0091 0.0067
##          3  0.887 2.36    0.0091 0.0051
##          4  1.183 2.36    0.0091 0.0041
##      Total                       0.0250 
## 
## ++ alpha spending:
##  Pocock boundary.
## * Sample size ratio compared to fixed design with no interim
## 
## Boundary crossing probabilities and expected sample size
## assume any cross stops the trial
## 
## Upper boundary (power or Type I Error)
##           Analysis
##    Theta      1      2      3      4 Total   E{N}
##   0.0000 0.0091 0.0067 0.0051 0.0041 0.025 1.1561
##   3.2415 0.2748 0.3059 0.2056 0.1136 0.900 0.6975
## 
## Lower boundary (futility or Type II Error)
##           Analysis
##    Theta      1      2      3      4 Total
##   0.0000 0.0091 0.0067 0.0051 0.0041 0.025
##   3.2415 0.0000 0.0000 0.0000 0.0000 0.000
2*(1-pnorm(Pocock$upper$bound))
## [1] 0.01821109 0.01821109 0.01821109 0.01821109
#Repeat for the the O'Brein & Fleming rule
OF <- gsDesign::gsDesign(k=4, test.type=2, sfu="OF")
OF
## Symmetric two-sided group sequential design with
## 90 % power and 2.5 % Type I Error.
## Spending computations assume trial stops
## if a bound is crossed.
## 
##            Sample
##             Size 
##   Analysis Ratio*  Z   Nominal p  Spend
##          1  0.256 4.05    0.0000 0.0000
##          2  0.511 2.86    0.0021 0.0021
##          3  0.767 2.34    0.0097 0.0083
##          4  1.022 2.02    0.0215 0.0145
##      Total                       0.0250 
## 
## ++ alpha spending:
##  O'Brien-Fleming boundary.
## * Sample size ratio compared to fixed design with no interim
## 
## Boundary crossing probabilities and expected sample size
## assume any cross stops the trial
## 
## Upper boundary (power or Type I Error)
##           Analysis
##    Theta     1      2      3      4 Total   E{N}
##   0.0000 0.000 0.0021 0.0083 0.0145 0.025 1.0157
##   3.2415 0.008 0.2850 0.4031 0.2040 0.900 0.7674
## 
## Lower boundary (futility or Type II Error)
##           Analysis
##    Theta 1      2      3      4 Total
##   0.0000 0 0.0021 0.0083 0.0145 0.025
##   3.2415 0 0.0000 0.0000 0.0000 0.000
2*(1-pnorm(OF$upper$bound))
## [1] 5.152685e-05 4.199337e-03 1.941553e-02 4.293975e-02
#Use the gsDesign function to generate the sample sizes at each stage under the Pocock rule
Pocock.ss <- gsDesign::gsDesign(k=4, test.type=2, sfu="Pocock", n.fix=500, beta=0.1)
ceiling(Pocock.ss$n.I)
## [1] 148 296 444 592
#Repeat for the the O'Brein-Fleming rule
OF.ss <- gsDesign::gsDesign(k=4, test.type=2, sfu="OF", n.fix=500, beta=0.1)
ceiling(OF.ss$n.I)
## [1] 128 256 384 512
#Find the sample size  per group for expected rates of 60%, 4% delta, 90% power and 5% significance level.
TOSTER::powerTOSTtwo.prop(alpha = 0.05, statistical_power = 0.9, prop1 = 0.6, prop2 = 0.6, 
                          low_eqbound_prop = -0.04, high_eqbound_prop = 0.04
                          )
## The required sample size to achieve 90 % power with equivalence bounds of -0.04 and 0.04 is 3247
## 
## [1] 3246.652
#Find the power if the above trial is limited to 2500 per group
TOSTER::powerTOSTtwo.prop(alpha = 0.05, N=2500, prop1 = 0.6, prop2 = 0.6, 
                          low_eqbound_prop = -0.04, high_eqbound_prop = 0.04
                          )
## The statistical power is 78.57 % for equivalence bounds of -0.04 and 0.04 .
## 
## [1] 0.7857316
#Find the sample size for a standard deviation of 10, delta of 2, 80% power and 5% significance level.
TOSTER::powerTOSTtwo.raw(alpha=0.05, statistical_power=0.8, sdpooled=10, low_eqbound=-2, high_eqbound=2)
## The required sample size to achieve 80 % power with equivalence bounds of -2 and 2 is 428.1924 per group, or 858 in total.
## 
## [1] 428.1924
#Find the sample sizes based on standard deviations between 7 and 13.
stdev <- seq(7, 13, 1)
npergp <- NULL
for(i in 1:length(stdev)){
    npergp[i] <- ceiling(TOSTER::powerTOSTtwo.raw(alpha=0.05, statistical_power=0.8, sdpooled=stdev[i],
                                                  low_eqbound=-2, high_eqbound=2
                                                  )
                         )
}
## The required sample size to achieve 80 % power with equivalence bounds of -2 and 2 is 209.8143 per group, or 420 in total.
## 
## The required sample size to achieve 80 % power with equivalence bounds of -2 and 2 is 274.0431 per group, or 550 in total.
## 
## The required sample size to achieve 80 % power with equivalence bounds of -2 and 2 is 346.8358 per group, or 694 in total.
## 
## The required sample size to achieve 80 % power with equivalence bounds of -2 and 2 is 428.1924 per group, or 858 in total.
## 
## The required sample size to achieve 80 % power with equivalence bounds of -2 and 2 is 518.1128 per group, or 1038 in total.
## 
## The required sample size to achieve 80 % power with equivalence bounds of -2 and 2 is 616.597 per group, or 1234 in total.
## 
## The required sample size to achieve 80 % power with equivalence bounds of -2 and 2 is 723.6451 per group, or 1448 in total.
## 
sample.sizes <- data.frame(stdev, npergp)

#Plot npergp against stdev
ggplot(data=sample.sizes, aes(x=stdev, y=npergp)) + 
    geom_line() +
    geom_point() + 
    ggtitle("Equivalence Sample Size Scenarios") +
    xlab("Standard Deviation") + 
    ylab("Patients per Group")


Chapter 4 - Statistical Analysis

Regression Analysis:

  • May be additional explanatory variables associated with outcomes of interest; these could differ by treatment arms (“explanatory variables”)
  • May be interested to see whether particular variables are associated with trial endpoints of particular interest
  • Can use simple linear regression to investigate the treatment effects
    • asthma.trial\(group <- relevel(asthma.trial\)group, ref=“Placebo”)
    • asthma.reg1 <- lm(fev.change ~group, asthma.trial)
    • summary(asthma.reg1)
    • t.test(fev.change~group, var.equal=TRUE, data=asthma.trial)
    • asthma.reg2<-lm(fev.change ~group + age, asthma.trial)
    • summary(asthma.reg2)
  • May want to use logistic regression to model binary outcomes
    • asthma.logreg1=glm(attack~group + age, family=binomial(link=“logit”), asthma.trial)
    • summary(asthma.logreg1)
    • exp(coefficients(asthma.logreg1)[2])
    • exp(confint(asthma.logreg1)[2,])

Analysis Sets, Subgroups, and Interactions:

  • Patient adherence may be imperfect for many reasons; as such, analysis is often re-done for sub-groups
  • Intention to treat (ITT) means looking at patient outcomes according to planned treatments rather than just those who complied and completed treatment
    • Full Analysis Set (FAS) follows IT principles
    • Per-Protocol Set (PPS) does not follow ITT principles and instead includes everyone
  • Can look at both FAS and PPS to compare outcomes
    • asthma.fas<-lm(fev.change ~group , asthma.trial)
    • asthma.pp<-lm(fev.change ~group , asthma.trial, subset = pp==1)
  • Can also look at subgroup analyses
    • asthma.u65<-lm( fev.change ~group , asthma.trial, subset = age<65)
    • asthma.o65<-lm( fev.change ~group , asthma.trial, subset = age>=65)
  • There is a risk of p-hacking with subgroup analyses, so they should be pre-specified rather than ad hoc
  • May also want to consider interaction effects for the trial
    • asthma.ageg <- lm( fev.change ~group + agegroup , asthma.trial)
    • summary(asthma.ageint)

Multiplicity of Data:

  • Multiple subgroups of data - patients, looks, sub-groups, etc.
  • Goal is to keep the probability of Type I error low - roughly 0.05
    • Multiplicity may make Type I errors cumulatively much more likely
  • Can adjust the p-values to maintain the desired Type I error rate
    • p / n (Bonferroni) for n tests with a Type I error rate of p
  • There is typically a lack of power within the subgroups due to how the study is designed
    • Subgroups should thus be limited, and based on hypotheses driven by previous research
  • There are often multiple endpoints for a study, so there needs to be clarity about which are confirmatory and which are exploratory
  • Composite endpoints can increase statistical power - for example, adding the causes of cardiac death
  • May also have repeated measurements due to collecting data at multiple timepoints

Wrap up:

  • Well-conducted human clinical trials are common in the medical indistry and need to follow rigorous protocols and analyses
    • Randomization, including several different methods
    • Clinical trial designs such as cross-over, equivalence, and non-inferiority
    • Sample size determination
    • Statistical analysis for the overll group and sub-groups
    • T-tests, Wilcoxon rank tests, test for equal proportions, logistic regression

Example code includes:

#Explore the variable names with the str function
str(Acupuncture)
## 'data.frame':    396 obs. of  25 variables:
##  $ id                           : num  100 101 104 105 108 112 113 114 126 130 ...
##  $ age                          : num  47 52 32 53 56 45 45 49 47 46 ...
##  $ sex                          : Factor w/ 2 levels "Female","Male": 1 1 1 1 1 1 1 1 1 1 ...
##  $ migraine                     : Factor w/ 2 levels "0","1": 2 2 2 2 2 2 2 2 2 2 ...
##  $ chronicity                   : num  35 8 14 10 40 27 30 49 42 3 ...
##  $ treatment.group              : Factor w/ 2 levels "Acupuncture",..: 1 2 2 2 2 1 1 1 2 1 ...
##  $ score.baseline               : num  10.8 9.5 16 32.5 16.5 ...
##  $ score.baseline.4             : Factor w/ 4 levels "[6.75,15.2]",..: 1 1 2 3 2 1 4 3 2 3 ...
##  $ age.group                    : Factor w/ 4 levels "18-34","35-44",..: 3 3 1 3 4 3 3 3 3 3 ...
##  $ score.month3                 : num  NA NA NA 44 17.5 ...
##  $ score.month12                : num  NA NA 15.3 NA 23.2 ...
##  $ withdrawal.reason            : Factor w/ 7 levels "adverse effects",..: 5 7 NA 7 NA NA NA NA NA NA ...
##  $ completedacupuncturetreatment: num  NA NA NA NA NA 1 NA NA NA NA ...
##  $ completer                    : num  0 0 1 0 1 1 1 1 1 1 ...
##  $ total.therap.visits          : num  NA 2 0 2 0 0 7 0 0 10 ...
##  $ total.gp.visits              : num  NA 4 0 0 0 5 1 0 1 0 ...
##  $ total.spec.visits            : num  NA 0 0 0 0 0 0 0 0 0 ...
##  $ total.days.sick              : num  NA 6 3 NA 23 2 6 9 19 0 ...
##  $ diff.month12                 : num  NA NA -0.667 NA 6.75 ...
##  $ pct.month12                  : num  NA NA -4.17 NA 40.91 ...
##  $ resp35.month12               : Factor w/ 2 levels "greater than 35%",..: NA NA 2 NA 2 2 2 2 2 1 ...
##  $ any.therap.visits            : Factor w/ 2 levels "Did not visit CT",..: NA 2 1 2 1 1 2 1 1 2 ...
##  $ any.gp.visits                : Factor w/ 2 levels "Did not visit GP",..: NA 2 1 1 1 2 2 1 2 1 ...
##  $ any.spec.visits              : Factor w/ 2 levels "Did not visit specialist",..: NA 1 1 1 1 1 1 1 1 1 ...
##  $ combined                     : Factor w/ 2 levels "No visits","At least one visit": NA 2 1 2 1 2 2 1 2 2 ...
#Use the relevel function to set Control as reference group
Acupuncture$treatment.group <- relevel(Acupuncture$treatment.group, ref="Control")


#Use lm to run and store the model in linreg1
linreg1 <- lm(pct.month12 ~ treatment.group + sex + score.baseline.4, data=Acupuncture, 
              na.action = na.exclude
              )

#Display the results of linreg1
summary(linreg1)
## 
## Call:
## lm(formula = pct.month12 ~ treatment.group + sex + score.baseline.4, 
##     data = Acupuncture, na.action = na.exclude)
## 
## Residuals:
##    Min     1Q Median     3Q    Max 
## -85.71 -28.82  -4.89  24.48 130.39 
## 
## Coefficients:
##                             Estimate Std. Error t value Pr(>|t|)    
## (Intercept)                   -5.805      5.460  -1.063 0.288565    
## treatment.groupAcupuncture   -16.473      4.718  -3.492 0.000555 ***
## sexMale                        2.767      6.410   0.432 0.666317    
## score.baseline.4(15.2,21.2]   -9.878      6.447  -1.532 0.126584    
## score.baseline.4(21.2,34.6]  -18.822      6.717  -2.802 0.005415 ** 
## score.baseline.4(34.6,94.8]  -15.786      6.657  -2.371 0.018375 *  
## ---
## Signif. codes:  0 '***' 0.001 '**' 0.01 '*' 0.05 '.' 0.1 ' ' 1
## 
## Residual standard error: 40.23 on 290 degrees of freedom
##   (100 observations deleted due to missingness)
## Multiple R-squared:  0.06742,    Adjusted R-squared:  0.05134 
## F-statistic: 4.193 on 5 and 290 DF,  p-value: 0.001076
#Use lm to run and store the model in linreg2
linreg2 <- lm(pct.month12 ~ treatment.group + score.baseline.4, data=Acupuncture, na.action = na.exclude)

#Display the results of linreg2
summary(linreg2)
## 
## Call:
## lm(formula = pct.month12 ~ treatment.group + score.baseline.4, 
##     data = Acupuncture, na.action = na.exclude)
## 
## Residuals:
##     Min      1Q  Median      3Q     Max 
## -83.371 -29.273  -4.979  24.691 129.902 
## 
## Coefficients:
##                             Estimate Std. Error t value Pr(>|t|)    
## (Intercept)                   -5.435      5.385  -1.009 0.313616    
## treatment.groupAcupuncture   -16.359      4.704  -3.478 0.000582 ***
## score.baseline.4(15.2,21.2]   -9.824      6.437  -1.526 0.128053    
## score.baseline.4(21.2,34.6]  -18.850      6.707  -2.811 0.005281 ** 
## score.baseline.4(34.6,94.8]  -15.783      6.647  -2.374 0.018234 *  
## ---
## Signif. codes:  0 '***' 0.001 '**' 0.01 '*' 0.05 '.' 0.1 ' ' 1
## 
## Residual standard error: 40.18 on 291 degrees of freedom
##   (100 observations deleted due to missingness)
## Multiple R-squared:  0.06682,    Adjusted R-squared:  0.05399 
## F-statistic: 5.209 on 4 and 291 DF,  p-value: 0.0004574
#Add the predicted values to the Acupuncture dataset for linreg2 using the predict function 
Acupuncture$pred.linreg2 <- predict(linreg2)


#Plot the predicted values against baseline score quartile grouping by treatment.
ggplot(data = subset(Acupuncture, !is.na(pred.linreg2)), 
       aes(x = score.baseline.4, y = pred.linreg2, group = treatment.group)
       ) + 
    geom_line(aes(color = treatment.group)) +
    geom_point(aes(color = treatment.group)) + 
    ggtitle("Predicted Values from Linear Regression Model") + 
    xlab("Baseline Score Quartile") + 
    ylab("Percentage Change from Baseline at M12")

#Use the relevel function to set "Control" as the reference for treatment
Acupuncture$treatment.group <- relevel(Acupuncture$treatment.group, ref="Control")

#Use the relevel function to set "less than or eq to 35%" as the reference for resp35.month12
Acupuncture$resp35.month12 <- relevel(Acupuncture$resp35.month12, ref="less than or eq to 35%")

#Use glm to run and store the model in logreg1
logreg1 <- glm(resp35.month12 ~ treatment.group + sex  + score.baseline.4, 
               family=binomial(link="logit"), data=Acupuncture
               )

#Display the results of logreg1
summary(logreg1)
## 
## Call:
## glm(formula = resp35.month12 ~ treatment.group + sex + score.baseline.4, 
##     family = binomial(link = "logit"), data = Acupuncture)
## 
## Deviance Residuals: 
##     Min       1Q   Median       3Q      Max  
## -1.4033  -0.9907  -0.7770   1.1163   1.7695  
## 
## Coefficients:
##                             Estimate Std. Error z value Pr(>|z|)    
## (Intercept)                  -1.0430     0.2935  -3.553  0.00038 ***
## treatment.groupAcupuncture    0.9734     0.2465   3.949 7.84e-05 ***
## sexMale                      -0.2882     0.3340  -0.863  0.38818    
## score.baseline.4(15.2,21.2]   0.5463     0.3359   1.626  0.10386    
## score.baseline.4(21.2,34.6]   0.5865     0.3487   1.682  0.09258 .  
## score.baseline.4(34.6,94.8]   0.2151     0.3481   0.618  0.53664    
## ---
## Signif. codes:  0 '***' 0.001 '**' 0.01 '*' 0.05 '.' 0.1 ' ' 1
## 
## (Dispersion parameter for binomial family taken to be 1)
## 
##     Null deviance: 406.88  on 295  degrees of freedom
## Residual deviance: 386.90  on 290  degrees of freedom
##   (100 observations deleted due to missingness)
## AIC: 398.9
## 
## Number of Fisher Scoring iterations: 4
#Display the odds ratio and 95% CI for Acupuncture vs Control
exp(coefficients(logreg1)[2])
## treatment.groupAcupuncture 
##                   2.646798
exp(confint(logreg1)[2,])
## Waiting for profiling to be done...
##    2.5 %   97.5 % 
## 1.640863 4.318076
#Tabulate withdrawal.reason
table(Acupuncture$withdrawal.reason,  useNA="ifany")
## 
##       adverse effects                  died  intercurrent illness 
##                     1                     1                    16 
##     lost to follow-up      treatment hassle treatment ineffective 
##                    15                     5                     4 
##      withdrew consent                  <NA> 
##                    58                   296
#Tabulate completedacupuncturetreatment by treatment.group
table(Acupuncture$completedacupuncturetreatment, Acupuncture$treatment.group,  useNA="ifany") 
##       
##        Control Acupuncture
##   0          0          35
##   1          1         131
##   <NA>     193          36
#Create a per protocol flag that is TRUE if patients met the criteria
Acupuncture <- Acupuncture %>%
    mutate(pp = is.na(withdrawal.reason) & 
               ((completedacupuncturetreatment==1 & treatment.group=="Acupuncture") | 
                    (is.na(completedacupuncturetreatment) & treatment.group=="Control")
                )
           )
Acupuncture$pp[is.na(Acupuncture$pp)] <- FALSE
Acupuncture$pp <- as.factor(Acupuncture$pp)

#Tabulate the per protocol flag
table(Acupuncture$pp)
## 
## FALSE  TRUE 
##   144   252
#Use the relevel function to set Control as reference group
Acupuncture$treatment.group <- relevel(Acupuncture$treatment.group, ref="Control")

#Use lm to run and store the model without interaction in linregnoint
linregnoint <- lm(pct.month12 ~ treatment.group + score.baseline.4, Acupuncture, na.action = na.exclude)

#Use lm to run and store the model with interaction in linregint
linregint <- lm(pct.month12 ~ treatment.group*score.baseline.4, Acupuncture, na.action = na.exclude)

#Display the results of linregnoint and linregint
summary(linregnoint)
## 
## Call:
## lm(formula = pct.month12 ~ treatment.group + score.baseline.4, 
##     data = Acupuncture, na.action = na.exclude)
## 
## Residuals:
##     Min      1Q  Median      3Q     Max 
## -83.371 -29.273  -4.979  24.691 129.902 
## 
## Coefficients:
##                             Estimate Std. Error t value Pr(>|t|)    
## (Intercept)                   -5.435      5.385  -1.009 0.313616    
## treatment.groupAcupuncture   -16.359      4.704  -3.478 0.000582 ***
## score.baseline.4(15.2,21.2]   -9.824      6.437  -1.526 0.128053    
## score.baseline.4(21.2,34.6]  -18.850      6.707  -2.811 0.005281 ** 
## score.baseline.4(34.6,94.8]  -15.783      6.647  -2.374 0.018234 *  
## ---
## Signif. codes:  0 '***' 0.001 '**' 0.01 '*' 0.05 '.' 0.1 ' ' 1
## 
## Residual standard error: 40.18 on 291 degrees of freedom
##   (100 observations deleted due to missingness)
## Multiple R-squared:  0.06682,    Adjusted R-squared:  0.05399 
## F-statistic: 5.209 on 4 and 291 DF,  p-value: 0.0004574
summary(linregint)
## 
## Call:
## lm(formula = pct.month12 ~ treatment.group * score.baseline.4, 
##     data = Acupuncture, na.action = na.exclude)
## 
## Residuals:
##     Min      1Q  Median      3Q     Max 
## -84.497 -28.562  -5.565  26.525 126.990 
## 
## Coefficients:
##                                                        Estimate Std. Error
## (Intercept)                                              -9.662      7.239
## treatment.groupAcupuncture                               -9.220      9.407
## score.baseline.4(15.2,21.2]                              -4.471      9.543
## score.baseline.4(21.2,34.6]                             -10.655     10.412
## score.baseline.4(34.6,94.8]                             -12.425      9.875
## treatment.groupAcupuncture:score.baseline.4(15.2,21.2]   -9.478     12.993
## treatment.groupAcupuncture:score.baseline.4(21.2,34.6]  -14.057     13.644
## treatment.groupAcupuncture:score.baseline.4(34.6,94.8]   -5.375     13.417
##                                                        t value Pr(>|t|)
## (Intercept)                                             -1.335    0.183
## treatment.groupAcupuncture                              -0.980    0.328
## score.baseline.4(15.2,21.2]                             -0.469    0.640
## score.baseline.4(21.2,34.6]                             -1.023    0.307
## score.baseline.4(34.6,94.8]                             -1.258    0.209
## treatment.groupAcupuncture:score.baseline.4(15.2,21.2]  -0.729    0.466
## treatment.groupAcupuncture:score.baseline.4(21.2,34.6]  -1.030    0.304
## treatment.groupAcupuncture:score.baseline.4(34.6,94.8]  -0.401    0.689
## 
## Residual standard error: 40.3 on 288 degrees of freedom
##   (100 observations deleted due to missingness)
## Multiple R-squared:  0.07059,    Adjusted R-squared:  0.048 
## F-statistic: 3.125 on 7 and 288 DF,  p-value: 0.003398
#Compare the models with the anova command
anova(linregnoint, linregint)
## Analysis of Variance Table
## 
## Model 1: pct.month12 ~ treatment.group + score.baseline.4
## Model 2: pct.month12 ~ treatment.group * score.baseline.4
##   Res.Df    RSS Df Sum of Sq      F Pr(>F)
## 1    291 469699                           
## 2    288 467802  3    1897.3 0.3893 0.7608
#Tabulate the age group variable to view the categories
table(Acupuncture$age.group)
## 
## 18-34 35-44 45-54 55-65 
##    75    83   159    79
#Display the adjusted significance level
0.05/4
## [1] 0.0125
#Run the Wilcoxon Rank Sum test in each of the age subgroups
age <- c("18-34", "35-44", "45-54", "55-65")
for(group in age){
  subgroup <- broom::tidy(wilcox.test(total.days.sick ~ treatment.group, 
                                      data = subset(Acupuncture, age.group==group), 
                                      exact=FALSE
                                      )
                          )
  print(group)
  print(subgroup)
}
## [1] "18-34"
## # A tibble: 1 x 4
##   statistic p.value method                                     alternative
##       <dbl>   <dbl> <chr>                                      <chr>      
## 1       518  0.0380 Wilcoxon rank sum test with continuity co~ two.sided  
## [1] "35-44"
## # A tibble: 1 x 4
##   statistic p.value method                                     alternative
##       <dbl>   <dbl> <chr>                                      <chr>      
## 1       534   0.540 Wilcoxon rank sum test with continuity co~ two.sided  
## [1] "45-54"
## # A tibble: 1 x 4
##   statistic p.value method                                     alternative
##       <dbl>   <dbl> <chr>                                      <chr>      
## 1      2557   0.130 Wilcoxon rank sum test with continuity co~ two.sided  
## [1] "55-65"
## # A tibble: 1 x 4
##   statistic p.value method                                     alternative
##       <dbl>   <dbl> <chr>                                      <chr>      
## 1       630   0.678 Wilcoxon rank sum test with continuity co~ two.sided
#Tabulate the combined endpoint by treatment group
table(Acupuncture$combined, Acupuncture$treatment.group, useNA="ifany")
##                     
##                      Control Acupuncture
##   No visits               53          65
##   At least one visit     102         109
##   <NA>                    39          28
#Use the relevel function to set Control as reference group
Acupuncture$treatment.group <- relevel(Acupuncture$treatment.group, ref="Control")

#Use compareGroups to generate and save the treatment effect for the composite endpoint amd each component
combined.test <- compareGroups::compareGroups(treatment.group ~ combined + any.therap.visits + any.gp.visits + any.spec.visits, data = Acupuncture)

# Store the results in a table
combined.test.table <- compareGroups::createTable(combined.test, show.ratio = TRUE, show.p.overall=FALSE)

#Display the results
combined.test.table
## 
## --------Summary descriptives table by 'treatment.group'---------
## 
## _____________________________________________________________________________ 
##                                Control   Acupuncture        OR        p.ratio 
##                                 N=155       N=174                             
## ¯¯¯¯¯¯¯¯¯¯¯¯¯¯¯¯¯¯¯¯¯¯¯¯¯¯¯¯¯¯¯¯¯¯¯¯¯¯¯¯¯¯¯¯¯¯¯¯¯¯¯¯¯¯¯¯¯¯¯¯¯¯¯¯¯¯¯¯¯¯¯¯¯¯¯¯¯ 
## combined:                                                                     
##     No visits                53 (34.2%)  65 (37.4%)        Ref.        Ref.   
##     At least one visit       102 (65.8%) 109 (62.6%) 0.87 [0.55;1.37]  0.553  
## any.therap.visits:                                                            
##     Did not visit CT         126 (81.3%) 142 (81.6%)       Ref.        Ref.   
##     Visited CT               29 (18.7%)  32 (18.4%)  0.98 [0.56;1.72]  0.940  
## any.gp.visits:                                                                
##     Did not visit GP         63 (40.6%)  85 (48.9%)        Ref.        Ref.   
##     Visited GP               92 (59.4%)  89 (51.1%)  0.72 [0.46;1.11]  0.138  
## any.spec.visits:                                                              
##     Did not visit specialist 145 (93.5%) 160 (92.0%)       Ref.        Ref.   
##     Visited specialist       10 (6.45%)  14 (8.05%)  1.26 [0.54;3.04]  0.590  
## ¯¯¯¯¯¯¯¯¯¯¯¯¯¯¯¯¯¯¯¯¯¯¯¯¯¯¯¯¯¯¯¯¯¯¯¯¯¯¯¯¯¯¯¯¯¯¯¯¯¯¯¯¯¯¯¯¯¯¯¯¯¯¯¯¯¯¯¯¯¯¯¯¯¯¯¯¯

Financial Analytics in R

Chapter 1 - Intro to Valuations (Cash is King)

Valuations Overview:

  • Can value economic value based on cash flows using R and the tidyverse
  • Focus for the course is valuation of projects within a company
  • Discounted cash flows use an interest rate to discount future expenditures and revenues to the present value
  • Cash flow statements typically have time as the column, with variables such as spend or revenue as rows
    • May want to tidy data for analysis where the column is the variable and the row is the observation

Business Models and Writing R Functions:

  • The business model includes the timing of earning revenue and incurring expenses
    • Operating revenue is driven by the units sold and the price per unit (for consumer products)
    • Operating revenue is driven by enrolment, churn, monthly fees, etc. (for subscription products)
    • Direct Expenses are driven by the units sold and the cost per unit (marginal direct costs)
    • Operating expenses (overhead) are costs required to run the business but not directly tied to a specific sale - e.g., SG&A, depreciation, etc.
  • The timing of revenues and expenses are on an accrual basis - for example, raw materials may be purchased well before production, but accrual would be when producing
  • Gross Profit = Operative Revenue minus Direct Expenses
  • Can use a function for calculating the business model
    • calc_business_model <- function(assumptions, price_per_unit, cost_per_unit){
    • model <- assumptions
    • model\(revenue <- model\)sales * price_per_unit
    • model\(direct_expense <- model\)sales * cost_per_unit
    • model\(gross_profit <- model\)revenue - model$direct_expenses
    • model
    • }
    • calc_business_model( assumptions, price_per_unit = 10, cost_per_unit = 2 )

Pro-Forma Income Statements:

  • The income statement (P&L) translates revenues and expenses to net income
    • overhead_expense <- sga + depreciation + amortization
    • operating_profit <- gross_profit - overhead_expense
  • Depreciation is the idea that large capital expenditures should be spread over their useful lifetimes
    • Amortization is a similar concept for non-physical investments (such as R&D)
    • Depreciation per Year = (Book Value - Salvage Value) / Years of Useful Life
    • depreciation_per_period <- (book_value - salvage_value)/useful_life
    • depreciation <- rep(depreciation_per_period, useful_life)
  • Can calculate valuations as either levered (financing, including tax considerations and interest) or unlevered (ignores financing considerations)
  • Generally need to include the tax considerations
    • tax <- operating_income * tax_rate
    • net_income <- operating_income - tax

Income to Cash:

  • Net income needs to be adjusted to create free cash flow
  • Cash is king - need to be able to convert the income in to no-string-attached cash
  • Income is recognized based on accrual while cash is recognized when it is received or spent
    • The income statement may majorly differ from the cash flow particularly due to depreciation
  • To convert from income to free cash flow, convert as follows
    • Add back depreciation and amortization (only care about actual spending)
    • Subtract out CAPEX (care about recognizing all of the capital asset when it is purchased)
    • Adjust for net working capital (NWC)
    • cashflow <- net_income + depreciation_exp - capex + nwc_changes

Example code includes:

# define inputs
price <- 20
print_cost <- 0.5
ship_cost <- 2

assumptions <- data.frame(year=1:5, sales=c(175, 200, 180, 100, 50))

# add revenue, expense, and profit variables
cashflow <- assumptions
cashflow$revenue <- cashflow$sales * price
cashflow$direct_expense <- cashflow$sales * (print_cost + ship_cost) 
cashflow$gross_profit <- cashflow$revenue - cashflow$direct_expense

# print cashflow
print(cashflow)
##   year sales revenue direct_expense gross_profit
## 1    1   175    3500          437.5       3062.5
## 2    2   200    4000          500.0       3500.0
## 3    3   180    3600          450.0       3150.0
## 4    4   100    2000          250.0       1750.0
## 5    5    50    1000          125.0        875.0
prem_ts <- data.frame(MONTH=1:60, COST_PER_SONG=0.01, SONG_LENGTH=3, REV_PER_SUB=10) %>%
    mutate(PCT_ACTIVE=0.95**(MONTH-1), HOURS_PER_MONTH=528-0.08*(MONTH-40)**2)

# premium business models
premium_model <- prem_ts
premium_model$SONGS_PLAYED <- prem_ts$PCT_ACTIVE * prem_ts$HOURS_PER_MONTH * 1 / prem_ts$SONG_LENGTH
premium_model$REV_SUBSCRIPTION <- prem_ts$PCT_ACTIVE * prem_ts$REV_PER_SUB
premium_model$COST_SONG_PLAYED <- premium_model$SONGS_PLAYED * prem_ts$COST_PER_SONG

# inspect results
head(premium_model)
##   MONTH COST_PER_SONG SONG_LENGTH REV_PER_SUB PCT_ACTIVE HOURS_PER_MONTH
## 1     1          0.01           3          10  1.0000000          406.32
## 2     2          0.01           3          10  0.9500000          412.48
## 3     3          0.01           3          10  0.9025000          418.48
## 4     4          0.01           3          10  0.8573750          424.32
## 5     5          0.01           3          10  0.8145062          430.00
## 6     6          0.01           3          10  0.7737809          435.52
##   SONGS_PLAYED REV_SUBSCRIPTION COST_SONG_PLAYED
## 1     135.4400        10.000000         1.354400
## 2     130.6187         9.500000         1.306187
## 3     125.8927         9.025000         1.258927
## 4     121.2671         8.573750         1.212671
## 5     116.7459         8.145062         1.167459
## 6     112.3324         7.737809         1.123324
free_ts <- data.frame(MONTH=1:60, PROP_MUSIC=0.95, REV_PER_AD=0.02, REV_PER_CLICK=10, 
                      COST_PER_SONG=0.01, SONG_LENGTH=3, AD_LENGTH=0.25, CLICK_THROUGH_RATE=0.001
                      ) %>%
    mutate(PCT_ACTIVE=0.97**(MONTH-1), HOURS_PER_MONTH=480-0.08*(MONTH-40)**2)

# freemium business models
freemium_model <- free_ts
freemium_model$SONGS_PLAYED <- free_ts$PCT_ACTIVE * free_ts$HOURS_PER_MONTH * free_ts$PROP_MUSIC / free_ts$SONG_LENGTH
freemium_model$ADS_PLAYED <- free_ts$PCT_ACTIVE * free_ts$HOURS_PER_MONTH * (1-free_ts$PROP_MUSIC) / free_ts$AD_LENGTH
freemium_model$REV_AD_PLAYED <- freemium_model$ADS_PLAYED * free_ts$REV_PER_AD
freemium_model$REV_AD_CLICKED <- freemium_model$ADS_PLAYED * free_ts$CLICK_THROUGH_RATE * free_ts$REV_PER_CLICK
freemium_model$COST_SONG_PLAYED <- freemium_model$SONGS_PLAYED * free_ts$COST_PER_SONG

# examine output
head(freemium_model)
##   MONTH PROP_MUSIC REV_PER_AD REV_PER_CLICK COST_PER_SONG SONG_LENGTH
## 1     1       0.95       0.02            10          0.01           3
## 2     2       0.95       0.02            10          0.01           3
## 3     3       0.95       0.02            10          0.01           3
## 4     4       0.95       0.02            10          0.01           3
## 5     5       0.95       0.02            10          0.01           3
## 6     6       0.95       0.02            10          0.01           3
##   AD_LENGTH CLICK_THROUGH_RATE PCT_ACTIVE HOURS_PER_MONTH SONGS_PLAYED
## 1      0.25              0.001  1.0000000          358.32     113.4680
## 2      0.25              0.001  0.9700000          364.48     111.9561
## 3      0.25              0.001  0.9409000          370.48     110.3851
## 4      0.25              0.001  0.9126730          376.32     108.7614
## 5      0.25              0.001  0.8852928          382.00     107.0909
## 6      0.25              0.001  0.8587340          387.52     105.3793
##   ADS_PLAYED REV_AD_PLAYED REV_AD_CLICKED COST_SONG_PLAYED
## 1   71.66400      1.433280      0.7166400         1.134680
## 2   70.70912      1.414182      0.7070912         1.119561
## 3   69.71693      1.394339      0.6971693         1.103851
## 4   68.69142      1.373828      0.6869142         1.087614
## 5   67.63637      1.352727      0.6763637         1.070909
## 6   66.55532      1.331106      0.6655532         1.053793
# Define function: calc_business_model
calc_business_model <- function(assumptions, price, print_cost, ship_cost){
    cashflow <- assumptions
    cashflow$revenue <- cashflow$sales * price
    cashflow$direct_expense <- cashflow$sales * (print_cost + ship_cost) 
    cashflow$gross_profit <- cashflow$revenue - cashflow$direct_expense
    cashflow
}

# Call calc_business_model function for different sales prices
assumptions
##   year sales
## 1    1   175
## 2    2   200
## 3    3   180
## 4    4   100
## 5    5    50
calc_business_model(assumptions, 20, 0.5, 2)$gross_profit
## [1] 3062.5 3500.0 3150.0 1750.0  875.0
calc_business_model(assumptions, 25, 0.5, 2)$gross_profit
## [1] 3937.5 4500.0 4050.0 2250.0 1125.0
# Inputs
production <- data.frame(Month=1:60, Units=rep(c(60, 50, 40, 30), times=15))

cost <- 100000
life <- 60
salvage <- 10000

# Compute depreciation
production$Depr_Straight <- (cost - salvage)/life
production$Depr_UnitsProd <- (cost - salvage)*(production$Units) / sum(production$Units)

# Plot two depreciation schedules
ggplot(production, aes(x = Month)) + 
    geom_line(aes(y = Depr_Straight)) + 
    geom_line(aes(y = Depr_UnitsProd))

# Business model
cashflow
##   year sales revenue direct_expense gross_profit
## 1    1   175    3500          437.5       3062.5
## 2    2   200    4000          500.0       3500.0
## 3    3   180    3600          450.0       3150.0
## 4    4   100    2000          250.0       1750.0
## 5    5    50    1000          125.0        875.0
cashflow$revenue <- cashflow$revenue + 2 * cashflow$sales
cashflow$gross_profit <- cashflow$revenue - cashflow$direct_expense

# Income statement
cashflow$depr_sl <- (1000 - 0) / 5
cashflow$operating_profit <- cashflow$gross_profit - cashflow$depr_sl
cashflow$tax <- cashflow$operating_profit * 0.3
cashflow$net_income <- cashflow$operating_profit - cashflow$tax

# Inspect dataset
cashflow
##   year sales revenue direct_expense gross_profit depr_sl operating_profit
## 1    1   175    3850          437.5       3412.5     200           3212.5
## 2    2   200    4400          500.0       3900.0     200           3700.0
## 3    3   180    3960          450.0       3510.0     200           3310.0
## 4    4   100    2200          250.0       1950.0     200           1750.0
## 5    5    50    1100          125.0        975.0     200            775.0
##       tax net_income
## 1  963.75    2248.75
## 2 1110.00    2590.00
## 3  993.00    2317.00
## 4  525.00    1225.00
## 5  232.50     542.50
# Calculate income statement
assumptions <- data.frame(unit_sales=100000*c(1, 2, 4, 8), machines_purchased=c(1, 1, 2, 4), 
                          depreciation=10000000*c(4, 8, 16, 32)
                          )
assumptions
##   unit_sales machines_purchased depreciation
## 1      1e+05                  1      4.0e+07
## 2      2e+05                  1      8.0e+07
## 3      4e+05                  2      1.6e+08
## 4      8e+05                  4      3.2e+08
price_per_unit <- 1000
cogs_per_unit <- 450
labor_per_unit <- 50

income_statement <- assumptions
income_statement$revenue <- income_statement$unit_sales * price_per_unit
income_statement$expenses <- income_statement$unit_sales * (cogs_per_unit + labor_per_unit)
income_statement$earnings <- income_statement$revenue - income_statement$expenses - income_statement$depreciation

# Summarize cumulative earnings
sum(income_statement$earnings)
## [1] 1.5e+08
sum(income_statement$earnings) / sum(income_statement$revenue)
## [1] 0.1
# calculate free cashflow
cashflow <- income_statement
cashflow$operating_cf <- cashflow$earnings + cashflow$depreciation
cashflow$capex <- cashflow$machines_purchased * 160000000
cashflow$free_cf <- cashflow$operating_cf - cashflow$capex

# summarize free cashflow
sum(cashflow$free_cf)
## [1] -5.3e+08

Chapter 2 - Key Financial Concepts (Time is Money)

Time Value of Money:

  • Money today is generally more valuable than money tomorrow
    • Can use a compounding interest rate, so V(n) = V(0) * (1 + r)**n
    • Therefore, PV = FV(n) / (1+r)**n - the discounting rate is r, applied over n time periods
    • mutate(data, pv = fv / (1 + r)^n)

Different Discount Rates:

  • Need to clarify the types of discount rates - need to ensure the same time periods as the cash flows
  • Can convert discount rates between time periods using appropriate compounding
    • r2 = [(1 + r1)^(# r1 units per 1 r2 unit) ] - 1
    • r_quart <- (1 + r_mth)^3 - 1
    • r_quart <- (1 + r_ann)^(1/4) - 1
  • Need to also consider the differences in real and nominal rates
    • Can think about inflation or deflation as relates to purchaing power for an item
  • Generally easiest for cash flows to reflect real cash-flows and discounted by real interest rates
    • r_real=r_nominal / (1+inflation_rate)
    • r_nominal=r_real*(1+inflation_rate)

Discounting Multiple Cash Flows:

  • Cash flow differs dramatically based on time in the future when it is received
  • Need to discount the cash flows back to present values prior to summing across them
    • pv <- calc_pv(fv = 100, r = 0.01, n = 3) # single caseh flow
    • cashflows <- c(0, -50, 25, 100, 175, 250, 250)
    • discounted_cashflows <- calc_pv(cashflows, r = 0.01, n = 0:6) # vectorized calculation, once for each of 0:6
  • Vectorized functions work well with the Tidyverse
    • many_cashflows %>% group_by(option) %>% summarize( PV = sum(calc_pv(cashflow, 0.08, n = time))

Example code includes:

# Assign input variables
fv <- 100
r <- 0.08

# Calculate PV if receive FV in 1 year
pv_1 <- 100 / (1 + r)**1
pv_1
## [1] 92.59259
# Calculate PV if receive FV in 5 years
pv_5 <- 100 / (1 + r)**5
pv_5
## [1] 68.05832
# Calculate difference
pv_1 - pv_5
## [1] 24.53427
# Define PV function: calc_pv
calc_pv <- function(fv, r, n){
    pv <- fv / (1+r)**n
    pv
}

# Use PV function for 1 input
calc_pv(100, 0.08, 5)
## [1] 68.05832
# Use PV function for range of inputs
n_range <- 1:10
pv_range <- calc_pv(100, 0.08, n_range)
pv_range
##  [1] 92.59259 85.73388 79.38322 73.50299 68.05832 63.01696 58.34904
##  [8] 54.02689 50.02490 46.31935
# Calculate present values in dataframe
present_values <- data.frame(n = 1:10) %>% mutate(pv = 100 / (1 + 0.08)**n)

# Plot relationship between time periods versus present value
ggplot(present_values, aes(x = n, y = pv)) +
    geom_line() +
    geom_label(aes(label = paste0("$",round(pv,0)))) +
    ylim(0,100) +
    labs(
        title = "Discounted Value of $100 by Year Received", 
        x = "Number of Years in the Future",
        y = "Present Value ($)"
        )

# Calculate present values over range of time periods and discount rates
present_values <- 
    expand.grid(n = 1:10, r = seq(0.05,0.12,0.01)) %>%
    mutate(pv = calc_pv(100, r, n))
     
# Plot present value versus time delay with a separate colored line for each rate
ggplot(present_values, aes(x = n, y = pv, col = factor(r))) +
    geom_line() +
    ylim(0,100) +
    labs(
        title = "Discounted Value of $100 by Year Received", 
        x = "Number of Years in the Future",
        y = "Present Value ($)",
        col = "Discount Rate"
        )

# Convert monthly to other time periods
r1_mth <- 0.005
r1_quart <- (1 + r1_mth)^3 - 1
r1_semi <- (1 + r1_mth)^6 - 1
r1_ann <- (1 + r1_mth)^12 - 1

# Convert years to other time periods
r2_ann <- 0.08
r2_mth <- (1 + r2_ann)^(1/12) - 1
r2_quart <- (1 + r2_ann)^(1/4) - 1


# Convert real to nominal
r1_real <- 0.08
inflation1 <- 0.03
(r1_nom <- (1 + r1_real) * (1 + inflation1) - 1)
## [1] 0.1124
# Convert nominal to real
r2_nom <- 0.2
inflation2 <- 0.05
(r2_real <- (1 + r2_nom) / (1 + inflation2) - 1)
## [1] 0.1428571
# Define cashflows
cashflow_a <- c(5000, rep(0,6))
cashflow_b <- c(0, rep(1000, 6))

# Calculate pv for each time period
disc_cashflow_a <- calc_pv(cashflow_a, 0.06, 0:6)
disc_cashflow_b <- calc_pv(cashflow_b, 0.06, 0:6)

# Calculate and report total present value for each option
(pv_a <- sum(disc_cashflow_a))
## [1] 5000
(pv_b <- sum(disc_cashflow_b))
## [1] 4917.324
# Define cashflows
cashflow_old <- rep(-500, 11)
cashflow_new <- c(-2200, rep(-300, 10))
options <- data.frame(time = rep(0:10, 2),
                      option = c(rep("Old",11), rep("New",11)),
                      cashflow = c(cashflow_old, cashflow_new)
                      )
                
# Calculate total expenditure with and without discounting
options %>%
    group_by(option) %>%
    summarize(sum_cashflow = sum(cashflow),
              sum_disc_cashflow = sum(calc_pv(cashflow, 0.12, 0:10))
              )
## # A tibble: 2 x 3
##   option sum_cashflow sum_disc_cashflow
##   <fct>         <dbl>             <dbl>
## 1 New           -5200            -3895.
## 2 Old           -5500            -3325.

Chapter 3 - Prioritizing Profitability (Financial Metrics)

Profitability Metrics and Payback Period:

  • Profitability metrics help to quantify how projects bring value to firms
  • Decision rules help to interpret metrics for decisions and comparisons
    • Absolute vs. relative
    • Constrained vs. unconstrained
  • All summary metrics have shortcomings; none are perfect in all situations
    • Decision rules are communication tools, not hard and fast “laws”
    • There are many corporate objectives over and above discounted cash flows; important input but not the sole answer
  • Payback periods help to assess the amount of time needed before full payback - sooner is better
    • Does not consider TVM and does not consider profits after the payback period
    • cashflows <- c(-10000, 2500, 3000, 5000, 6000, 1000)
    • cumsum(cashflows) + init_investment

NPV, IRR, Profitability Index:

  • NPV - Net Present Value is net of the investment costs
    • In an unconstrained world, any NPV-positive project would be pursued
    • n <- 0:(length(cashflows) - 1)
    • npv <- sum( calc_pv(cashflows, r, n) )
  • IRR - Internal Rate of Return is the required rate of return for an investment to break-even over a stated time period
    • Also called the “hurdle rate” since it is the rate required for a project to hurdle in to profitability
    • assume we have calc_npv function with signature:

    • calc_npv(cashflows, r)

    • uniroot(calc_npv, interval = c(0, 1), cashflows = cashflows)$root
  • Profitability index - ratio between sum of discounted cash flows over the cost of the initial investment
    • A value of 1 is a break-even that only recoups the investment
    • npv_fcf <- calc_npv(future_cashflow, r)
    • profitability_index <- npv_fcf / abs(initial_investment)

Terminal Value:

  • Terminal Value (TV) is residual value outside the specified time period of the cash flow analysis
    • Can add TV as a summary metric for the cash flows (discounted) after the final time period
    • final_cashflow <- cashflow[n]
    • terminal_value_period_n <- final_cashflow / (discount_rate - growth_rate)
    • terminal_value_as_present <- terminal_value_period_n / (1 + discount_rate)^n
  • Can also use the exit multiplier method, in which a benchmark is applied to the cash flows (sales, revenues, etc.)

Comparing and Computing Metrics:

  • NPV and IRR are important metrics with related information - however, they may give different constrained project decisions
    • By definition, IRR is the discount rate that lets a project break-even on an NPV basis
  • NPV focuses on profit (favors large investments), while IRR focuses on return (favors small investments with high returns)
    • Best solution can be to examine both metrics
    • options %>% group_by(option) %>% summarize(npv=calc_npv(cf,0.08))

Wrap up:

  • Strengths, weaknesses, and blind spots of various metrics
    • Summary metrics alone can be deceptive
  • Additional metrics include ROE (equity) and ROA (assets)
  • Industries and even companies may have their own key metrics of interest

Example code includes:

cashflows <- c(-50000, 1000, 5000, 5000, 5000, 10000, 10000, 10000, 10000, 10000, 10000)

# Inspect variables
cashflows
##  [1] -50000   1000   5000   5000   5000  10000  10000  10000  10000  10000
## [11]  10000
# Calculate cumulative cashflows
cum_cashflows <- cumsum(cashflows)

# Identify payback period
payback_period <- min(which(cum_cashflows >= 0)) - 1

# View result
payback_period
## [1] 8
# Define payback function: calc_payback
calc_payback <- function(cashflows) {
  cum_cashflows <- cumsum(cashflows)
  payback_period <- min(which(cum_cashflows >= 0)) - 1
  payback_period
}

# Test out our function
cashflows <- c(-100, 50, 50, 50)
calc_payback(cashflows) == 2
## [1] TRUE
cashflows <- c(-50000, 1000, 5000, 5000, 5000, 10000, 10000, 10000, 10000, 10000, 10000)

# normal payback period
payback_period <- calc_payback(cashflows)

# discounted payback period
discounted_cashflows <- calc_pv(cashflows, r = 0.06, n = 0:(length(cashflows)-1) )
payback_period_disc <- calc_payback(discounted_cashflows)

# compare results
payback_period
## [1] 8
payback_period_disc
## [1] 10
# Define NPV function: calc_npv
calc_npv <- function(cashflows, r) {
  n <- 0:(length(cashflows) - 1)
  npv <- sum( calc_pv(cashflows, r, n) )
  npv
}


# The base R function stats::uniroot can help find values between a lower bound (lower) and an upper bound (upper) where the value of a function is zero
# This can help us calculate the internal rate of return (IRR) for which NPV = 0.

# Define IRR function: calc_irr
calc_irr <- function(cashflows) {
    uniroot(calc_npv, 
        interval = c(0, 1), 
        cashflows = cashflows)$root
}

# Try out function on valid input
cashflows <- c(-100, 20, 20, 20, 20, 20, 20, 10, 5)
calc_irr(cashflows)
## [1] 0.08296991
# Define profitability index function: calc_profitability_index
calc_profitability_index <- function(init_investment, future_cashflows, r) {
    discounted_future_cashflows <- calc_npv(future_cashflows, r)
    discounted_future_cashflows / abs(init_investment)
}

# Try out function on valid input
init_investment <- -100
cashflows <- c(0, 20, 20, 20, 20, 20, 20, 10, 5)
calc_profitability_index(init_investment, cashflows, 0.08)
## [1] 1.009938
# pull last year cashflow from vector of cashflows
last_year_cashflow <- cashflow[length(cashflow)]
last_period_n <- length(cashflow) - 1

# calculate terminal value for different discount raes
terminal_value_1 <- last_year_cashflow / ((0.15 - 0.1)*(1 + 0.15)^last_period_n)
terminal_value_2 <- last_year_cashflow / ((0.15 - 0.01)*(1 + 0.15)^last_period_n)
terminal_value_3 <- last_year_cashflow / ((0.15 + 0.05)*(1 + 0.15)^last_period_n)

# inspect results
terminal_value_1 
##       free_cf
## 1  -719183902
## 2  -392282129
## 3  -784564257
## 4 -1569128514
terminal_value_2
##      free_cf
## 1 -256851394
## 2 -140100760
## 3 -280201520
## 4 -560403041
terminal_value_3
##      free_cf
## 1 -179795976
## 2  -98070532
## 3 -196141064
## 4 -392282129
cashflow1 <- c(-50000, 100, 2000, 2000, 5000, 10000, 10000, 10000, 10000, 10000, 10000)
cashflow2 <- c(-1e+05, 20000, 20000, 20000, 20000, 20000)
cashflow3 <- c(-8000, 6000, 5000, 4000, 3000, 2000, 1000, 0)

# calculate internal rate of return (IRR) for each stream of cashflows
r1 <- calc_irr(cashflow1)
r2 <- calc_irr(cashflow2)
r3 <- calc_irr(cashflow3)

# calculate net present value (NPV) for each stream of cashflows, assuming r = irr
npv1 <- calc_npv(cashflow1, r1)
npv2 <- calc_npv(cashflow2, r2)
npv3 <- calc_npv(cashflow3, r3)

# examine results
npv1
## [1] -5.859804
npv2
## [1] 0
npv3
## [1] -0.1359058
cf1 <- c(-5000, 450, 450, 450, 450, 450, 450, 450, 450, 450, 450)
cf2 <- c(-5000, 2000, 2000, 2000, 2000, 2000, 2000, -2000, -2000, -2000, -2000)
rates <- c(0, 0.005, 0.01, 0.015, 0.02, 0.025, 0.03, 0.035, 0.04, 0.045, 0.05, 0.055, 0.06, 0.065, 0.07, 0.075, 0.08, 0.085, 0.09, 0.095, 0.1, 0.105, 0.11, 0.115, 0.12, 0.125, 0.13, 0.135, 0.14, 0.145, 0.15, 0.155, 0.16, 0.165, 0.17, 0.175, 0.18, 0.185, 0.19, 0.195, 0.2, 0.205, 0.21, 0.215, 0.22, 0.225, 0.23, 0.235, 0.24, 0.245, 0.25)

# create dataset of NPV for each cashflow and rate
npv_by_rates <- data.frame(rates) %>%
    group_by(rates) %>%
    mutate(npv1 = calc_npv(cf1, rates), npv2 = calc_npv(cf2, rates))
   
# plot cashflows over different discount rates     
ggplot(npv_by_rates, aes(x = rates, y = npv1)) + 
    geom_line() +
    geom_line(aes(y = npv2)) +
    labs(title = "NPV by Discount Rate", subtitle = "A Tale of Two Troubling Cashflows",
         y = "NPV ($)",x = "Discount Rate (%)"
         ) +
    annotate("text", x = 0.2, y = -500, label = "Two break-even points") +
    annotate("text", x = 0.2, y = -2500, label = "No break-even point")

cashflows <- data.frame(option=rep(1:4, each=11), time=rep(0:10, times=4), 
                        cashflow=c(-10, 4, 4, 4, 4, 4, 4, 4, 4, 4, 4, -1000, 300, 300, 300, 300, 300, 300, 300, 300, 300, 300, -1e+05, 20000, 20000, 20000, 20000, 20000, 20000, 20000, 20000, 20000, 20000, -10, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1)
                        )

# calculate summary metrics
cashflow_comparison <-
  cashflows %>%
  group_by(option) %>%
  summarize(npv = calc_npv(cashflow, 0.1), irr = calc_irr(cashflow))
      
# inspect output
cashflow_comparison
## # A tibble: 4 x 3
##   option       npv   irr
##    <int>     <dbl> <dbl>
## 1      1     14.6  0.385
## 2      2    843.   0.273
## 3      3  22891.   0.151
## 4      4     -3.86 0
# visualize summary metrics
ggplot(cashflow_comparison, aes(x = npv, y = irr, col = factor(option))) +
    geom_point(size = 5) +
    geom_hline(yintercept = 0.1) +
    scale_y_continuous(label = scales::percent) +
    scale_x_continuous(label = scales::dollar) +
    labs(title = "NPV versus IRR for Project Alternatives",
         subtitle = "NPV calculation assumes 10% discount rate",
         caption = "Line shows actual discount rate to asses IRR break-even",
         x = "NPV ($)", y = "IRR (%)",col = "Option"
         )


Chapter 4 - Understanding Outcomes

Building a Business Case:

  • Can combine metrics to evaluate potential business models
  • Example of working for a data-driven coffee shop - move from coffee to nitro-brew
    • Consider only the incremental costs; for example rent and sunk costs (prior to the project) should not be considered
    • May want to consider side-effects such as self-cannibalization
  • Business modeling is part art and part science; need a good blend

Scenario Analysis with tidyr and purrr:

  • May want to consider additional projects, and there may not be funding for pursuing all of these ideas
  • May be some variability in the accuracy of our estimates - “what if analysis”, aka “scenario analysis”
    • scenario1 <- mutate(assumptions, var1 = 1.2 * var1)
    • cashflow1 <- calc_model(scenario1)
    • calc_npv(cashflow1)
  • Can use tidyr and purr to automate some of this
    • all_scenarios %>% nest(-scenario)
    • all_scenarios %>% nest(-scenario) %>% mutate( cashflow = map_df( data, calc_model) ) # data frame in column ‘data’ will be passed to calc_model
    • all_scenarios %>% nest(-scenario) %>% mutate( cashflow = map_df( data, calc_model) ) %>% mutate( npv = map_dbl( cashflow, calc_npv) )

Sensitivity analysis:

  • Sensitivity analysis is an approach to uncertainty that assesses the impact of each base assumption on the outcomes
    • sensitivity <- expand.grid( factor = c(0.5, 1, 1.5), metric = c(“vbl1”, “vbl2”) )
    • sensitivity <- expand.grid( factor = c(0.5, 1, 1.5), metric = c(“vbl1”, “vbl2”) ) %>% mutate(scenario = map2(metric, factor, ~factor_data(assumptions, .x, .y))) # The ~ is for the anaonymous function
  • Can then visualize the impact of the sensitivity analysis; change in overall NPV vs. % change in base metric
  • Caution that errors are often correlated - this is just a univariate sensitivity analysis
  • Caution that not all metrics make the same magnitudes of change; analysis could be misinterpreted as a result

Communicating Cashflow Concepts:

  • Long data is tidy - one column per metric and one row per observation (time)
  • Financial stakeholders will be more accustomed to non-tidy data
    • long_cashflow <- gather(cashflow, key = Month, value = Value, -Metric) # make the data long with key column Month and values in Value and Metric left as a column
    • tidy_cashflow <- spread(long_cashflow, key = Metric, value = Value, -Metric)
  • Waterfall diagrams may be useful for communicating outcomes
    • ggplot(data) + geom_rect( aes( xmin = , xmax = , ymin = , ymax = ) )
    • ggplot(waterfall_data, aes( xmin = rn - 0.25, xmax = rn + 0.25, ymin = start, ymax = end) ) + geom_rect() + scale_x_continuous( breaks = waterfall_data\(rn, labels = waterfall_data\)category )

Advanced Topics in Cashflow Modeling:

  • Many additional topics can be covered in financial modeling
    • Debt vs. equity financing
    • Decisions made today change the options available to us in the future
    • Probabilistic simulation (impacts of uncertainty)

Example code includes:

assumptions <- data.frame(year=0:10, 
                          unit_sales_per_day=c(0, 10, 12, 14, 15, 16, 17, 18, 18, 18, 18),
                          capex=c(5000, rep(0, 10)),
                          pct_cannibalization=c(0, rep(0.25, 10)), 
                          maintenance_cost=c(0, rep(250, 10)), 
                          depreciation_cost=c(0, rep(500, 10)), 
                          profit_margin_per_nitro=3, 
                          profit_margin_per_regular=1, 
                          labor_cost_per_hour=8, 
                          days_open_per_year=250
                          )

# Check the first few rows of the data
head(assumptions)
##   year unit_sales_per_day capex pct_cannibalization maintenance_cost
## 1    0                  0  5000                0.00                0
## 2    1                 10     0                0.25              250
## 3    2                 12     0                0.25              250
## 4    3                 14     0                0.25              250
## 5    4                 15     0                0.25              250
## 6    5                 16     0                0.25              250
##   depreciation_cost profit_margin_per_nitro profit_margin_per_regular
## 1                 0                       3                         1
## 2               500                       3                         1
## 3               500                       3                         1
## 4               500                       3                         1
## 5               500                       3                         1
## 6               500                       3                         1
##   labor_cost_per_hour days_open_per_year
## 1                   8                250
## 2                   8                250
## 3                   8                250
## 4                   8                250
## 5                   8                250
## 6                   8                250
# Check the variable names of the data
names(assumptions)
##  [1] "year"                      "unit_sales_per_day"       
##  [3] "capex"                     "pct_cannibalization"      
##  [5] "maintenance_cost"          "depreciation_cost"        
##  [7] "profit_margin_per_nitro"   "profit_margin_per_regular"
##  [9] "labor_cost_per_hour"       "days_open_per_year"
# Plot the trend of unit_sales_per_day by year
ggplot(assumptions, aes(x = year, y = unit_sales_per_day)) + 
    geom_line()

tax_rate <- 0.36

# Create the cashflow_statement dataframe
cashflow_statement <-
  mutate(assumptions,
    sales_per_year = unit_sales_per_day * days_open_per_year,
    sales_revenue = sales_per_year * profit_margin_per_nitro,
    total_revenue = sales_revenue,
    labor_cost = days_open_per_year * 0.5 * labor_cost_per_hour,
    cannibalization_cost = sales_per_year * pct_cannibalization * profit_margin_per_regular,
    direct_expense = labor_cost + cannibalization_cost + maintenance_cost,
    gross_profit = total_revenue - direct_expense,
    operating_income = gross_profit - depreciation_cost,
    net_income = operating_income * (1 - tax_rate), 
    cashflow = net_income + depreciation_cost - capex    
  )


# build individual scenarios
optimist <- mutate(assumptions, unit_sales_per_day = unit_sales_per_day * 1.2, pct_cannibalization = 0.1)
pessimist <- mutate(assumptions, unit_sales_per_day = unit_sales_per_day * 0.8, profit_margin_per_nitro = 1)

# combine into one dataset
scenarios <-
  bind_rows(
    mutate(pessimist, scenario = "pessimist"),
    mutate(assumptions, scenario = "realist"),
    mutate(optimist, scenario = "optimist")
  )


calc_model <- function(assumptions){
  mutate( assumptions,
    sales_per_year = unit_sales_per_day * days_open_per_year,
    sales_revenue = sales_per_year * profit_margin_per_nitro,
    total_revenue = sales_revenue,
    labor_cost = days_open_per_year * 0.5 * labor_cost_per_hour,
    cannibalization_cost = sales_per_year * pct_cannibalization * profit_margin_per_regular,
    direct_expense = labor_cost + cannibalization_cost + maintenance_cost,
    gross_profit = total_revenue - direct_expense,
    operating_income = gross_profit - depreciation_cost,
    net_income = operating_income * (1 - 0.36), 
    cashflow = net_income + depreciation_cost - capex    
  )
}

calc_npv_from_cashflow <- function(cashflow, r){
  cashflow_line <- cashflow$cashflow
  sum(calc_pv(cashflow_line, r, 0:(length(cashflow_line)-1)))
}

# calculate scenario NPVs
scenario_analysis <- scenarios %>%
    nest(-scenario) %>%
    mutate(cashflow = map(data, calc_model)) %>%
    mutate(npv = map_dbl(cashflow, calc_npv_from_cashflow, 0.2))

# inspect results
select(scenario_analysis, scenario, npv)
##    scenario       npv
## 1 pessimist -2505.163
## 2   realist 18042.280
## 3  optimist 25018.853
# scenario analysis bar chart
ggplot(data = scenario_analysis, aes(x = scenario, y = npv, fill = scenario)) + 
    geom_bar(stat = "identity") +
    scale_y_continuous(labels = scales::dollar) +
    labs(title = "NPV Scenario Analysis of Nitro Coffee Expansion") +
    guides(fill = FALSE)

# define sensitivity factor function
factor_data <- function(data, metric, factor){
  data[[metric]] <- data[[metric]] * factor
  data
}

# create sensitivity analysis
sensitivity <-
  expand.grid(
    factor = seq(0.5,1.5,0.1), 
    metric = c("profit_margin_per_nitro", "labor_cost_per_hour", "pct_cannibalization", "unit_sales_per_day")) %>%
  mutate(scenario = map2(metric, factor, ~factor_data(assumptions, .x, .y))) %>%
  mutate(cashflow = map(scenario, calc_model)) %>% 
  mutate(npv = map_dbl(cashflow, calc_npv_from_cashflow, r = 0.2))


ggplot(sensitivity,
       aes(x = factor, y = npv, col = metric)
       ) +
  geom_line() +
  scale_x_continuous(labels = scales::percent) +
  scale_y_continuous(labels = scales::dollar) +
  labs(
    title = "Sensivity Analysis",
    x = "Factor on Original Assumption",
    y = "Projected NPV",
    col = "Metric"
  )

# examine current cashflow strucutre
tidy_cashflow <- data.frame(Month=1:6, 
                            Received=c(100, 200, 300, 400, 500, 500), 
                            Spent=c(150, 175, 200, 225, 250, 250)
                            )

# create long_cashflow with gather
# long_cashflow <- tidyr::gather(cashflow, key = Month, value = Value, -Metric)

# create tidy_cashflow with spread
# tidy_cashflow <- tidyr::spread(long_cashflow, key = Metric, value = Value)

# examine results
tidy_cashflow
##   Month Received Spent
## 1     1      100   150
## 2     2      200   175
## 3     3      300   200
## 4     4      400   225
## 5     5      500   250
## 6     6      500   250
# create long_cashflow with gather
long_cashflow <- tidyr::gather(tidy_cashflow, key = Metric, value = Value, -Month)

# create untidy_cashflow with spread
untidy_cashflow <- tidyr::spread(long_cashflow, key = Month, value = Value)

# examine results
untidy_cashflow
##     Metric   1   2   3   4   5   6
## 1 Received 100 200 300 400 500 500
## 2    Spent 150 175 200 225 250 250
gross_profit_summary <- data.frame(metric=c("Sales Revenue", "Keg Cost", "Cannibalization Cost", "Labor Cost", "Maintenance Cost"), 
                                   value=c(187200, -78240, -31200, -10000, -2500)
                                   )

# compute min and maxes for each line item
waterfall_items <-
  mutate(gross_profit_summary,
         end = cumsum(value), 
         start = lag(cumsum(value), 1, default = 0))

# compute totals row for waterfall metrics
waterfall_summary <- 
  data.frame(metric = "Gross Profit", 
             end = sum(gross_profit_summary$value), 
             start = 0)

# combine line items with summary row
waterfall_data <-
  bind_rows(waterfall_items, waterfall_summary) %>%
  mutate(row_num = row_number())
## Warning in bind_rows_(x, .id): Unequal factor levels: coercing to character
## Warning in bind_rows_(x, .id): binding character and factor vector,
## coercing into character vector

## Warning in bind_rows_(x, .id): binding character and factor vector,
## coercing into character vector
# Plot waterfall diagram
ggplot(waterfall_data, aes(fill = (end > start))) +
  geom_rect(aes(xmin = row_num - 0.25, xmax = row_num + 0.25, 
                ymin = start, ymax = end)) +
  geom_hline(yintercept = 0) +
  scale_x_continuous(breaks = waterfall_data$row_num, labels = waterfall_data$metric) +
  # Styling provided for you - check out a ggplot course for more information!
  scale_y_continuous(labels = scales::dollar) +
  theme(axis.text.x = element_text(angle = 45, hjust = 1),
        axis.title.x = element_blank()) +
  guides(fill = FALSE) +
  labs(
      title = "Gross Profit for Proposed Nitro Coffee Expansion",
      subtitle = "Based on pro forma 10-year forecast")


Visualizing Big Data with Trelliscope

Chapter 1 - General Strategies for Visualizing Big Data

Visualizing summaries:

  • Start with summarization plots for large datasets
  • Univariate variable descriptions from the gapminder dataset
    • Continuous - histograms
    • ggplot(gapminder, aes(lifeExp)) + geom_histogram()
    • Discrete - bar chart for counts
    • ggplot(gapminder, aes(continent)) + geom_bar()
    • Temporal - bin by time, compute number of observations
    • by_year <- gapminder %>% group_by(year) %>% summarise(medianGdpPercap = median(gdpPercap, na.rm = TRUE))
    • ggplot(by_year, aes(year, medianGdpPercap)) + geom_line()
  • Binning is a common strategy for summarizing large datasets - particularly the dplyr groupby function
  • Can extend to the NYC taxi cab dataset - millions of records on the number of taxi trips taken in NYC

Adding more detail to summaries:

  • Can bin pairs of variables in two dimensions, and facet vary on additional variables
  • The geom_hex() can be a useful means for showing the 2x2 plot
    • ggplot(tx, aes(tip_amount, total_amount)) + geom_hex(bins = 75) + scale_x_log10() + scale_y_log10() + geom_abline(slope = 1, intercept = 0)
  • Can use the facet_wrap to see visual subsets of the data - all elements of the main call are added to each of the facets automatically
    • ggplot(daily_count, aes(pickup_date, n_rides)) + geom_point() + facet_grid(~ pickup_dow)

Visualizing subsets:

  • May need to look in more detail than what is available in the summaries
  • A useful technique is to take a natural subset of a large dataset; for example, all of the price data for a single stock
  • Example of examining the “zero tip” nature of the cash rides shown in the NYC taxi dataset; subset to 5,000 rides from UES South to UES North
    • ggplot(tx_pop, aes(trip_duration, total_amount)) + geom_point(alpha = 0.2)
    • ggplot(tx_pop, aes(sample = total_amount, color = payment_type)) + geom_qq(distribution = stats::qunif) + ylim(c(3, 20)) # quantile plot against the uniform distribution

Visualizing all subsets:

  • May want to extend the analysis to all of the routes in the taxi dataset
  • Faceting will not work with over 20k total panels as in the taxi dataset
  • Refined approaches using trelliscope help enable these higher-volume visualizations

Example code includes:

load("./RInputFiles/tx_sub.RData")
glimpse(tx)
## Observations: 1,000,000
## Variables: 7
## $ pick_day      <date> 2016-07-09, 2016-07-28, 2016-07-20, 2016-07-30,...
## $ pick_dow      <fct> Sat, Thu, Wed, Sat, Tue, Thu, Fri, Sun, Mon, Thu...
## $ total_amount  <dbl> 47.60, 9.96, 6.80, 11.75, 7.30, 12.05, 13.80, 14...
## $ tip_amount    <dbl> 23.80, 1.66, 1.00, 1.95, 0.00, 2.75, 0.00, 2.36,...
## $ payment_type  <fct> Card, Card, Card, Card, Cash, Card, Cash, Card, ...
## $ trip_duration <dbl> 26.116667, 5.866667, 4.916667, 10.350000, 6.8666...
## $ pick_wkday    <lgl> FALSE, TRUE, TRUE, FALSE, TRUE, TRUE, TRUE, FALS...
tx <- tx %>%
    rename(pickup_date=pick_day, pickup_dow=pick_dow)
glimpse(tx)
## Observations: 1,000,000
## Variables: 7
## $ pickup_date   <date> 2016-07-09, 2016-07-28, 2016-07-20, 2016-07-30,...
## $ pickup_dow    <fct> Sat, Thu, Wed, Sat, Tue, Thu, Fri, Sun, Mon, Thu...
## $ total_amount  <dbl> 47.60, 9.96, 6.80, 11.75, 7.30, 12.05, 13.80, 14...
## $ tip_amount    <dbl> 23.80, 1.66, 1.00, 1.95, 0.00, 2.75, 0.00, 2.36,...
## $ payment_type  <fct> Card, Card, Card, Card, Cash, Card, Cash, Card, ...
## $ trip_duration <dbl> 26.116667, 5.866667, 4.916667, 10.350000, 6.8666...
## $ pick_wkday    <lgl> FALSE, TRUE, TRUE, FALSE, TRUE, TRUE, TRUE, FALS...
# Summarize taxi ride count by pickup day
daily_count <- tx %>%
  group_by(pickup_date) %>%
  summarise(n_rides=n())

# Create a line plot
ggplot(daily_count, aes(x=pickup_date, y=n_rides)) +
  geom_line()

# Create a histogram of total_amount
ggplot(tx, aes(x=total_amount)) +
  geom_histogram() +
  scale_x_log10()
## Warning: Transformation introduced infinite values in continuous x-axis
## `stat_bin()` using `bins = 30`. Pick better value with `binwidth`.
## Warning: Removed 58 rows containing non-finite values (stat_bin).

# Create a bar chart of payment_type
ggplot(tx, aes(x=payment_type)) +
  geom_bar()

# Create a hexagon-binned plot of total_amount vs. trip_duration
ggplot(tx, aes(x=trip_duration, y=total_amount)) +
  geom_hex(bins=75) +
  scale_x_log10() +
  scale_y_log10()
## Warning in self$trans$transform(x): NaNs produced

## Warning in self$trans$transform(x): Transformation introduced infinite
## values in continuous x-axis
## Warning: Transformation introduced infinite values in continuous y-axis
## Warning: Removed 1058 rows containing non-finite values (stat_binhex).

# Summarize taxi rides count by payment type, pickup date, pickup day of week, and payment type
daily_count <- tx %>%
  filter(payment_type %in% c("Card", "Cash")) %>%
  group_by(payment_type, pickup_date, pickup_dow) %>%
  summarise(n_rides=n())

# Plot the data
ggplot(daily_count, aes(x=pickup_date, y=n_rides)) +
  geom_point() +
  facet_grid(payment_type ~ pickup_dow) +
  coord_fixed(ratio = 0.4)

# Histogram of the tip amount faceted on payment type
ggplot(tx, aes(x=tip_amount+0.01)) +
  geom_histogram() +
  scale_x_log10() +
  facet_wrap(~ payment_type, ncol=1, scales="free_y")
## `stat_bin()` using `bins = 30`. Pick better value with `binwidth`.

# Get data ready to plot
amount_compare <- tx %>%
    mutate(total_no_tip = total_amount - tip_amount) %>%
    filter(total_no_tip <= 20) %>%
    sample_n(size=round(nrow(.)/20), replace=FALSE) %>%
    select(total_amount, total_no_tip, payment_type) %>%
    tidyr::gather(amount_type, amount, -payment_type)

# Quantile plot
ggplot(amount_compare, aes(sample=amount, color=payment_type)) +
  geom_qq(distribution=stats::qunif, shape = 21) +
  facet_wrap(~ amount_type) +
  ylim(c(3, 20))
## Warning: Removed 2202 rows containing missing values (geom_point).


Chapter 2 - ggplot2 + Trelliscope JS

Faceting with Trelliscope JS:

  • The trelliscope is a powerful tool for viewing moderate and large datasets - will again explore gapminder as a starting point
    • ggplot(gapminder, aes(year, lifeExp, group = country)) + geom_line() # enormouse over-plotting problem
    • ggplot(gapminder, aes(year, lifeExp, group = country, color = continent)) + geom_line() + facet_wrap(~ continent, nrow = 1) + guides(color = FALSE) # somewhat better to see insights by continent
    • ggplot(gapminder, aes(year, lifeExp)) + geom_line() + facet_wrap(~ country + continent) # labels overplot the data (impossible to view)
  • The trelliscope is just a replacement of a single call in the ggplot
    • It’s as easy as swapping out facet_wrap() for facet_trelliscope()
    • As with facet_wrap(), control rows and columns with nrow and ncol

Interacting with Trelliscope JS displays:

  • Can look at just one panel as per the JS user controls; focus in on the most interesting areas of a visualization
  • Can page through the panels using the Prev and Next panels and/or the arrow buttons
  • Can customize the grid layout by clicking on the “Grid” widget on the side of the plot
  • The “cognostics” are also clickable as far as which labels will be shown
    • Can subset by selecting portions of a histogram and/or categories for viewing
    • Default sorting order are low-to-high, though this can be customized

Additional Trelliscope JS features:

  • Can use plotly for additional interactivity within panels - adds tooltips and pop-ups
    • gap_life <- select(gapminder, year, lifeExp, country, continent)
    • ggplot(gap_life, aes(year, lifeExp)) + geom_point() + facet_trelliscope(~ country + continent, name = “lifeExp_by_country”, desc = “Life expectancy vs. year for 142 countries.”, nrow = 2, ncol = 3, as_plotly = TRUE)
  • Can calculate cognostics automatically for additional useful metrics
    • ggplot(gap_life, aes(year, lifeExp)) + geom_point() + facet_trelliscope(~ country + continent, name = “lifeExp_by_country”, desc = “Life expectancy vs. year for 142 countries.”, nrow = 2, ncol = 3, auto_cog = TRUE)
  • Multi-panel displays require good usage of axis limits
    • Similar to the scales argument in facet_wrap
    • Default behavior is scales = “same”
    • When scales = “sliced”, the scales have the same ranges but with potentially different starting points (these are currently only in trelliscopejs rather than in ggplot2)
    • When scales = “free”, the scales are independent by facet

Adding your own cognostics:

  • Can add new variables as cognostics by adding new variables to the data
  • Example of creating the latest observed life expectancy
    • gap <- gapminder %>% group_by(country) %>% mutate(latestLifeExp = tail(lifeExp, 1)) # do not summarize; maintain the original data
  • Can create links within the displays; for example
  • Customizing custom cognostics
    • A function cog() can be wrapped around a variable to fine-tune how a cognostic is handled in Trelliscope
    • desc: a meaningful description for the cognostic
    • default_label: boolean specifying whether the cognostic should be shown as a label by default or not

Example code includes:

library(trelliscopejs)

data(gapminder, package="gapminder")
glimpse(gapminder)


# Create the plot
gapminder %>%
    filter(continent=="Oceania") %>%
    ggplot(aes(x=year, y=lifeExp)) +
    geom_line() +
    # Facet on country and continent
    facet_trelliscope(~ country + continent, data=gapminder)

gapminder %>%
    filter(continent=="Oceania") %>%
    ggplot(aes(x=year, y=lifeExp)) +
    geom_line() +
    facet_trelliscope(~ country + continent, name = "lifeExp_by_country",
                      desc = "Life expectancy vs. year per country", nrow = 1, ncol = 2
                      )


# Create the plot
gapminder %>%
    filter(continent=="Oceania") %>%
    ggplot(aes(x=year, y=lifeExp)) +
    geom_point() +
    geom_smooth(method = "lm", se = FALSE) +
    facet_trelliscope(~ country + continent, name = "lifeExp_by_country",
                      desc = "Life expectancy vs. year for 142 countries.",
                      nrow = 2, ncol = 3,
                      # Set the scales
                      scales="sliced",
                      # Specify automatic cognistics
                      auto_cog=TRUE
                      )


# Group by country and create the two new variables
gap <- gapminder %>%
    filter(continent=="Oceania") %>%
    group_by(country) %>%
    mutate(delta_lifeExp = tail(lifeExp, 1) - head(lifeExp, 1),
           ihme_link = paste0("http://www.healthdata.org/", country)
           )

# Add the description
gap$delta_lifeExp <- cog(gap$delta_lifeExp, desc = "Overall change in life expectancy")

# Specify the default label
gap$ihme_link <- cog(gap$ihme_link, default_label = TRUE)

ggplot(gap, aes(year, lifeExp)) +
    geom_point() +
    facet_trelliscope(~ country + continent,
                      name = "lifeExp_by_country",
                      desc = "Life expectancy vs. year for 142 countries.",
                      nrow = 2, ncol = 3, scales = c("same", "sliced")
                      )

Chapter 3 - Trelliscope in the Tidyverse

Trelliscope in the Tidyverse:

  • Stock market dataset called “stocks” has price data for the 500 highest-traded NASDAQ stocks
  • Can use ggplot2 to understand stock price changes by year
  • Might instead want to use the canbdlestick chart from plotly - can also zoom, plot, and hover based on the plotly characteristics
    • candlestick_plot <- function(d) plot_ly(d, x = ~date, type = “candlestick”, open = ~open, close = ~close, high = ~high, low = ~low)
    • candlestick_plot(filter(stocks, symbol == “AAPL”))
  • Can use nesting to make for a smaller data frame with column data holding a tibble
    • by_symbol <- stocks %>% group_by(symbol) %>% nest()
    • by_symbol <- mutate(by_symbol, last_close = map_dbl(data, function(x) tail(x$close, 1)))
    • by_symbol <- mutate(by_symbol, panel = map_plot(data, candlestick_plot)) # map_plot is from the trelliscope package; one plot for each stock
    • trelliscope(by_symbol, name = “candlestick_top500”, nrow = 2, ncol = 3) # show the plot with the given initial layout

Cognostics:

  • Can add variables, which will then be included as cognostics in the trelliscope
  • Can add metadata to the stocks database, then use nest to have the metadata as a new variable
    • by_symbol <- left_join(by_symbol, stocks_meta)
    • by_symbol <- mutate(by_symbol, volume_stats = map(data, function(x) { data_frame( min_volume = min(x\(volume), max_volume = max(x\)volume) ) }))

Trelliscope options:

  • Can further customize multiple options related to a trelliscope plot
  • Can specify the output directory for sharing the display with others - default is just a temporary directory, and will over-write anything in the directory with the same name
    • trelliscope(dat, path = “…”, …)
    • ggplot(…) + … + facet_trelliscope(path = “…”, …)
  • May want to provide more detailed descriptions of the data - shows in the viewer icon
    • trelliscope(by_symbol, name = “candlestick_top500”, desc = “Candlestick plot of the 500 most-traded NASDAQ stocks in 2016”, md_desc = " ## Candlestick Plot A candlestick plot is a financial plot… … “) # multi-line markdown in md_desc
  • Plot aspect ratio is important for strong visual displays - default is a square of 500px x 500px
    • trelliscope(dat, width = 600, height = 300, …) # specified in units of pixels
    • ggplot(…) + … + facet_trelliscope(width = 600, height = 300, …)
  • Default state can be further specified - interface is currently undergoing active improvement
    • trelliscope(dat, state = …, …)
    • ggplot(…) + … + facet_trelliscope(state = …, …)

Visualizing databases of images:

  • May want to view large collections of images, which is a strong use case for trelliscope - example of the pokemon dataset
    • select(pokemon, url_image)
    • pokemon <- mutate(pokemon, panel = img_panel(url_image))
  • May have local images for comparisons instead
    • path <- file.path(tempdir(), “pokemon_local”)
    • dir.create(path)
    • for (url in pokemon$url_image)
    • download.file(url, destfile = file.path(path, basename(url)))
    • pokemon\(image <- basename(pokemon\)url_image)
    • pokemon <- mutate(pokemon, panel = img_panel_local(image))
    • trelliscope(pokemon, name = “pokemon”, nrow = 3, ncol = 6, path = path)

Example code includes:

# do not have dataset 'stocks'
by_symbol <- stocks %>%
  group_by(symbol) %>%
  nest()

min_volume_fn <- function(x) min(x$volume)

# Create new column
by_symbol_min <- by_symbol %>%
  mutate(min_volume = map_dbl(data, min_volume_fn))


ohlc_plot <- function(d) {
  plot_ly(d, x = ~date, type = "ohlc",
    open = ~open, close = ~close,
    high = ~high, low = ~low)
}

by_symbol_plot <- mutate(by_symbol, panel=map_plot(data, ohlc_plot))

trelliscope(by_symbol_plot, name="ohlc_top500")


# Create market_cap_log
by_symbol <- mutate(by_symbol,
  market_cap_log = cog(
    val = log10(market_cap),
    desc = "log base 10 market capitalization"
  )
)


annual_return <- function(x)
  100 * (tail(x$close, 1) - head(x$open, 1)) / head(x$open, 1)

# Compute by_symbol_avg
by_symbol_avg <- mutate(by_symbol,
  stats = map(data, function(x) {
    data_frame(
      mean_close = mean(x$close),
      mean_volume = mean(x$volume),
      annual_return = annual_return(x)
      )
    }
  )
)


# Create the trelliscope display
p <- trelliscope(by_symbol, width=600, height=300, name="ohlc_top500", desc="Example aspect 2 plot")


pokemon %>%
  # Reduce the variables in the dataset
  select(pokemon, type_1, attack, generation_id, url_image) %>%
  mutate(
    # Respecify pokemon
    pokemon = cog(pokemon, default_label=TRUE),
    # Create panel variable
    panel = img_panel(url_image)
  ) %>%
  # Create the display
  trelliscope(name="pokemon", nrow=3, ncol=6)

Chapter 4 - Case Study: Exploring Montreal BIXI Bike Data

Montreal BIXI Bike Data:

  • Bike riding data for 2017 for BIXI Montreal - desire to understand patterns of usages
  • Aggregations and summary plots for the big picture, followed by deep-dives with trelliscope
  • Randomly sub-samples down to 1,000,000 records for the examples

Summary Visualization Recap:

  • Clear differences in weekday usage (peaks at 08h00 and 17h00) and weekend usage (peak around 15h00)
  • Non-members tend to ride as much on weekends (over 2 days) rather than weekdays (over 5 days)
    • Hypothesis that members are more likely to be commuters and non-members more likely to be tourists

Top 100 routes dataset:

  • May want to examine route-specific behaviors
  • Considering a route as a from-to, we want to look at the top-100 routes, ignoring round-trip routes
    • route_tab <- bike %>% filter(start_station_code != end_station_code) %>% group_by(start_station_code, end_station_code) %>% summarise(n = n()) %>% arrange(-n)
    • top_routes <- paste( route_tab\(start_station_code[1:100], route_tab\)end_station_code[1:100])
    • top100 <- bike %>% filter(paste(start_station_code, end_station_code) %in% top_routes)
  • Preparing data for visualization
    • route_hod <- top100 %>% group_by(start_station_code, end_station_code, start_hod, weekday) %>% summarise(n = n())
    • route_hod <- route_hod %>% left_join(start_stations) %>% left_join(end_stations)

Wrap up:

  • Can filter and sort to find key information in the trelliscope facets
  • Can further investigate routes with rush hour peaks (AM, PM, or both) as well as routes with differences in weekend and weekday

Example code includes:

# DO NOT HAVE FULL BIXI Data
bike04 <- read_csv("./RInputFiles/BIXIData/OD_2017-04.csv")
bike05 <- read_csv("./RInputFiles/BIXIData/OD_2017-05.csv")
bike06 <- read_csv("./RInputFiles/BIXIData/OD_2017-06.csv")
bike07 <- read_csv("./RInputFiles/BIXIData/OD_2017-07.csv")
bike08 <- read_csv("./RInputFiles/BIXIData/OD_2017-08.csv")
bike09 <- read_csv("./RInputFiles/BIXIData/OD_2017-09.csv")
bike10 <- read_csv("./RInputFiles/BIXIData/OD_2017-10.csv")
bike11 <- read_csv("./RInputFiles/BIXIData/OD_2017-11.csv")
stations <- read_csv("./RInputFiles/BIXIData/Stations_2017.csv")

bike <- rbind(bike04, bike05, bike06, bike07, bike08, bike09, bike10, bike11) %>%
    mutate(membership=factor(is_member, levels=c(1, 0), labels=c("member", "non-member")), 
           start_day=as.Date(start_date), 
           start_dow=factor(lubridate::wday(start_date), levels=1:7, labels=c("Sun", "Mon", "Tue", "Wed", "Thu", "Fri", "Sat")),
           weekday=factor(ifelse(start_dow %in% c("Sat", "Sun"), 2, 1), levels=1:2, labels=c("workweek", "weekend")), 
           start_hod=lubridate::hour(start_date), 
           start_mon=lubridate::month(start_date), 
           start_wk=lubridate::week(start_date)
           )
glimpse(bike)


# Compute daily counts
daily <- bike %>%
  group_by(start_day, weekday) %>%
  summarise(n = n())

# Plot the result
ggplot(daily, aes(x=start_day, y=n, color=weekday)) +
  geom_point()


# Compute week_hod
week_hod <- bike %>%
  group_by(start_wk, start_hod, weekday) %>%
  summarize(n=n())

# Plot the result
ggplot(week_hod, aes(x=start_wk, y=n, color=weekday)) +
  geom_point() +
  facet_grid(cols=vars(start_hod)) +
  scale_y_sqrt()


# Compute wk_memb_hod
wk_memb_hod <- bike %>%
  group_by(start_wk, start_hod, weekday, membership) %>%
  summarize(n=n())

# Plot the result
ggplot(wk_memb_hod, aes(x=start_wk, y=n, color=weekday)) +
  geom_point() +
  facet_grid(membership ~ start_hod) +
  scale_y_sqrt()


# Compute daily_may
daily_may <- bike %>%
  filter(start_mon == 5) %>%
  group_by(start_day, start_hod, membership) %>%
  summarise(n = n())

# Plot the result
ggplot(daily_may, aes(x=start_hod, y=n, color=membership)) +
  geom_point() + 
  facet_wrap(~ start_day, ncol=7)


# ggplot(daily_may, aes(x=start_hod, y=n, color = membership)) +
#   geom_point() +
  # Facet on start_day
#   facet_trelliscope(~ start_day, nrow=2, ncol=7)


# Function to construct a Google maps URL with cycling directions
make_gmap_url <- function(start_lat, start_lon, end_lat, end_lon) {
  paste0("https://www.google.com/maps/dir/?api=1",
    "&origin=", start_lat, ",", start_lon,
    "&destination=", end_lat, ",", end_lon,
    "&travelmode=bicycling")
}

load("./RInputFiles/route_hod.RData")
glimpse(route_hod)

# Compute tot_rides, weekday_diff, and map_url
route_hod_updated <- route_hod %>%
  group_by(start_station_code, end_station_code) %>%
  mutate(
    tot_rides = sum(n),
    weekday_diff = mean(n[weekday == "workweek"]) - mean(n[weekday == "weekend"]),
    map_url = make_gmap_url(start_lat, start_lon, end_lat, end_lon))


# Create the plot
# ggplot(route_hod, aes(x=start_hod, y=n, color=weekday)) +
  # geom_point(size=3) + 
  # facet_trelliscope(~start_station_name + end_station_name, nrow=2, ncol=4) + 
  # theme(legend.position = "none")

Visualization Best Practices in R

Chapter 1 - Proportions of a Whole